ID: 968727353

View in Genome Browser
Species Human (GRCh38)
Location 4:2253943-2253965
Sequence TTCCTGGGGTGGGGGGCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2056
Summary {0: 1, 1: 0, 2: 13, 3: 137, 4: 1905}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968727353_968727366 18 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727353_968727368 22 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727368 4:2253988-2254010 CGTGCTCTCTCTGCTCAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 172
968727353_968727367 19 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727367 4:2253985-2254007 AAGCGTGCTCTCTCTGCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 154
968727353_968727370 24 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727353_968727364 -7 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727364 4:2253959-2253981 CCAGGAACTGTGTAGGCAAGAGG 0: 1
1: 0
2: 2
3: 26
4: 234
968727353_968727369 23 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727369 4:2253989-2254011 GTGCTCTCTCTGCTCAGGGAGGG 0: 1
1: 1
2: 3
3: 20
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968727353 Original CRISPR TTCCTGGGGTGGGGGGCGGC AGG (reversed) Intronic