ID: 968727354

View in Genome Browser
Species Human (GRCh38)
Location 4:2253947-2253969
Sequence ACAGTTCCTGGGGTGGGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1079
Summary {0: 1, 1: 1, 2: 15, 3: 128, 4: 934}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968727354_968727367 15 Left 968727354 4:2253947-2253969 CCGCCCCCCACCCCAGGAACTGT 0: 1
1: 1
2: 15
3: 128
4: 934
Right 968727367 4:2253985-2254007 AAGCGTGCTCTCTCTGCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 154
968727354_968727366 14 Left 968727354 4:2253947-2253969 CCGCCCCCCACCCCAGGAACTGT 0: 1
1: 1
2: 15
3: 128
4: 934
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727354_968727370 20 Left 968727354 4:2253947-2253969 CCGCCCCCCACCCCAGGAACTGT 0: 1
1: 1
2: 15
3: 128
4: 934
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727354_968727368 18 Left 968727354 4:2253947-2253969 CCGCCCCCCACCCCAGGAACTGT 0: 1
1: 1
2: 15
3: 128
4: 934
Right 968727368 4:2253988-2254010 CGTGCTCTCTCTGCTCAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 172
968727354_968727369 19 Left 968727354 4:2253947-2253969 CCGCCCCCCACCCCAGGAACTGT 0: 1
1: 1
2: 15
3: 128
4: 934
Right 968727369 4:2253989-2254011 GTGCTCTCTCTGCTCAGGGAGGG 0: 1
1: 1
2: 3
3: 20
4: 247

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968727354 Original CRISPR ACAGTTCCTGGGGTGGGGGG CGG (reversed) Intronic