ID: 968727355

View in Genome Browser
Species Human (GRCh38)
Location 4:2253950-2253972
Sequence TACACAGTTCCTGGGGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 356
Summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 330}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968727355_968727371 30 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727371 4:2254003-2254025 CAGGGAGGGGTCCTTTCCCAAGG 0: 1
1: 0
2: 6
3: 49
4: 281
968727355_968727367 12 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727367 4:2253985-2254007 AAGCGTGCTCTCTCTGCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 154
968727355_968727369 16 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727369 4:2253989-2254011 GTGCTCTCTCTGCTCAGGGAGGG 0: 1
1: 1
2: 3
3: 20
4: 247
968727355_968727370 17 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727355_968727366 11 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727355_968727368 15 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727368 4:2253988-2254010 CGTGCTCTCTCTGCTCAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968727355 Original CRISPR TACACAGTTCCTGGGGTGGG GGG (reversed) Intronic