ID: 968727361

View in Genome Browser
Species Human (GRCh38)
Location 4:2253957-2253979
Sequence TCTTGCCTACACAGTTCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 183}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968727361_968727367 5 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727367 4:2253985-2254007 AAGCGTGCTCTCTCTGCTCAGGG 0: 1
1: 0
2: 0
3: 10
4: 154
968727361_968727368 8 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727368 4:2253988-2254010 CGTGCTCTCTCTGCTCAGGGAGG 0: 1
1: 0
2: 0
3: 12
4: 172
968727361_968727370 10 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727361_968727366 4 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727361_968727369 9 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727369 4:2253989-2254011 GTGCTCTCTCTGCTCAGGGAGGG 0: 1
1: 1
2: 3
3: 20
4: 247
968727361_968727371 23 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727371 4:2254003-2254025 CAGGGAGGGGTCCTTTCCCAAGG 0: 1
1: 0
2: 6
3: 49
4: 281

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968727361 Original CRISPR TCTTGCCTACACAGTTCCTG GGG (reversed) Intronic