ID: 968727366

View in Genome Browser
Species Human (GRCh38)
Location 4:2253984-2254006
Sequence AAAGCGTGCTCTCTCTGCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 148}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968727355_968727366 11 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727356_968727366 10 Left 968727356 4:2253951-2253973 CCCCCACCCCAGGAACTGTGTAG 0: 1
1: 0
2: 1
3: 20
4: 278
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727354_968727366 14 Left 968727354 4:2253947-2253969 CCGCCCCCCACCCCAGGAACTGT 0: 1
1: 1
2: 15
3: 128
4: 934
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727353_968727366 18 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727361_968727366 4 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727359_968727366 8 Left 968727359 4:2253953-2253975 CCCACCCCAGGAACTGTGTAGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727363_968727366 2 Left 968727363 4:2253959-2253981 CCAGGAACTGTGTAGGCAAGAGG 0: 1
1: 0
2: 0
3: 24
4: 176
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727362_968727366 3 Left 968727362 4:2253958-2253980 CCCAGGAACTGTGTAGGCAAGAG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727352_968727366 19 Left 968727352 4:2253942-2253964 CCCTGCCGCCCCCCACCCCAGGA 0: 1
1: 0
2: 10
3: 109
4: 883
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727360_968727366 7 Left 968727360 4:2253954-2253976 CCACCCCAGGAACTGTGTAGGCA 0: 1
1: 0
2: 3
3: 20
4: 218
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
968727357_968727366 9 Left 968727357 4:2253952-2253974 CCCCACCCCAGGAACTGTGTAGG 0: 1
1: 0
2: 0
3: 16
4: 226
Right 968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG 0: 1
1: 0
2: 0
3: 8
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968727366 Original CRISPR AAAGCGTGCTCTCTCTGCTC AGG Intronic
900425451 1:2576323-2576345 CAAGCGCCCTCTCTCTGCCCTGG - Intergenic
902727848 1:18349237-18349259 AGAGCTTGGCCTCTCTGCTCTGG + Intronic
903326447 1:22571548-22571570 CAAGCCTGCACTCTCTGCTGAGG + Intronic
904067583 1:27765934-27765956 ACAGCTTGCTCTCTCCGATCTGG - Intergenic
904295292 1:29516368-29516390 AAAACCAGCTCTCTCTGATCAGG - Intergenic
908790630 1:67777682-67777704 AGAGCATGCTCTCTCTATTCAGG - Intronic
910138820 1:84003285-84003307 AAAGCATCATCTCTCTGTTCTGG - Intergenic
913497888 1:119445256-119445278 AAAGCATGCTCTTTCTGGGCGGG + Intergenic
914953120 1:152136262-152136284 AAAGCGTTTTCTCTCTGATCAGG + Intergenic
915062346 1:153196749-153196771 AAAGCGAGATCTCTTTGCACAGG - Intergenic
916622602 1:166516906-166516928 AAAGCATTCACTCTCTGGTCTGG + Intergenic
919290854 1:195628369-195628391 AAAGCAAGCTCTATCTGTTCAGG + Intergenic
920998579 1:211018652-211018674 CAAGCATGCTCCCTCTGTTCTGG + Intronic
924888234 1:248243526-248243548 AAAGGTAGCTCTCTCTGCTGTGG - Intergenic
1062941539 10:1425369-1425391 AAAGCATAGTCTCTATGCTCCGG - Intronic
1063492692 10:6479422-6479444 AAAGTGTGCCCTGCCTGCTCAGG + Intronic
1064153199 10:12882382-12882404 AGAGTTTGCTCTCTCTGCCCAGG + Intergenic
1066291570 10:34019036-34019058 GAAACCTGCTCTCTCTGCACTGG - Intergenic
1068411710 10:56663911-56663933 AAAGCGTCCTATCTGTGCCCAGG + Intergenic
1069182749 10:65383552-65383574 CTAGCTTGCTCCCTCTGCTCTGG - Intergenic
1070304380 10:75230902-75230924 GAAGCTTACACTCTCTGCTCTGG + Exonic
1077635700 11:3840475-3840497 AAAAGGCGCTCCCTCTGCTCTGG - Intronic
1079368913 11:19833226-19833248 TAAGCCTCCTCTGTCTGCTCTGG - Intronic
1082739330 11:56893095-56893117 AAAGGGTGCTTTCTCTGGGCAGG - Intergenic
1083455790 11:62777876-62777898 CAAACGTGGGCTCTCTGCTCTGG + Intronic
1084706028 11:70816435-70816457 ACAGCGTGCTCTCCCTGCCGTGG - Intronic
1090626751 11:128614982-128615004 GAATCATGGTCTCTCTGCTCTGG + Intergenic
1090635770 11:128689757-128689779 TCAGCCTGCTCTCTCTGGTCAGG + Intronic
1091457377 12:618053-618075 AAAGCCTCCTCTCTCTCCTTCGG + Intronic
1092266079 12:6981632-6981654 CATCCGTTCTCTCTCTGCTCAGG - Exonic
1092299659 12:7234571-7234593 AAAGCGTTTTCTCTCAGATCTGG + Intergenic
1093803837 12:23408172-23408194 AAAGCCTTCTCTCTCTCATCAGG - Intergenic
1094267437 12:28574842-28574864 AAAGCCTGCCCTCTCTTCGCTGG - Intronic
1096274288 12:50192273-50192295 AAATCTTGCTGCCTCTGCTCAGG - Intronic
1096486122 12:51982525-51982547 ACAGCATCCTCTCTGTGCTCCGG - Intronic
1101095519 12:101335136-101335158 AAAGTCTCCTCTCCCTGCTCTGG - Intronic
1101424942 12:104580320-104580342 AAAGCGTTCACTGTATGCTCTGG + Intronic
1103099528 12:118160801-118160823 TAAGCCAGCTCTCACTGCTCTGG + Intronic
1103610943 12:122124011-122124033 AAAGCCTCCCCTCACTGCTCTGG + Intronic
1108274500 13:48793796-48793818 ACATGGTGCTCTCTCTGATCAGG - Intergenic
1110675840 13:78243038-78243060 GAGGCATGATCTCTCTGCTCTGG - Intergenic
1119728873 14:76938582-76938604 AAAGCGTGCCCACCCTGCTGGGG + Intergenic
1120119594 14:80663138-80663160 AGAGCCTGCTCTCTCAGCCCGGG - Intronic
1121644561 14:95509015-95509037 ATAGCGTGCTCTCTCTGGGCTGG + Intergenic
1122949163 14:105031491-105031513 CAAGAGTCCTCCCTCTGCTCCGG + Intergenic
1126704346 15:51393762-51393784 CAAGGGTGCTTTCACTGCTCAGG + Intronic
1128305506 15:66596143-66596165 AAAGCGATCTCTCACAGCTCTGG + Intronic
1130716653 15:86341277-86341299 AAAGCCTGCTCTGTCTAGTCAGG - Intronic
1130796027 15:87210292-87210314 AAAGAGTGCTCCATCTCCTCAGG - Intergenic
1132653038 16:1030222-1030244 AATGCGTTCTCTCTCAGCGCTGG - Intergenic
1137816647 16:51404432-51404454 AAAGGGCTCTCTCTCTGCCCTGG - Intergenic
1140117729 16:72057321-72057343 AATGCCTTCTCACTCTGCTCTGG + Intronic
1140119964 16:72075074-72075096 AATGCCTTCTCACTCTGCTCTGG + Intronic
1141574790 16:84956916-84956938 AACGTGTGTTCTCTCTGTTCTGG - Intergenic
1141835038 16:86532797-86532819 AAAGCTGGGGCTCTCTGCTCAGG + Intronic
1145032671 17:19516873-19516895 AAAGCTTGTTCTTTCTGCTAAGG - Intronic
1149350701 17:55784040-55784062 AACGCATGCTGTCTTTGCTCAGG - Intronic
1150727113 17:67660352-67660374 AAAGCATGTTGTCTCTGCCCTGG + Intronic
1153306983 18:3640442-3640464 ACAGCGGGCGCTCTCAGCTCAGG + Intronic
1157586204 18:48802892-48802914 CCAGCCTTCTCTCTCTGCTCAGG + Intronic
1158569083 18:58581510-58581532 GAAGCCTGCTCTCTCAGTTCAGG + Intronic
1160867655 19:1262844-1262866 CAAGCCCACTCTCTCTGCTCTGG - Intronic
1166076438 19:40416314-40416336 AAATCCCCCTCTCTCTGCTCAGG + Intergenic
1167903606 19:52640141-52640163 GACGCGTGCCCTCTCTGGTCAGG + Intronic
1168081286 19:54012279-54012301 AAACTGTGTTCTCCCTGCTCGGG + Exonic
925535235 2:4909506-4909528 AAAGCTTTTTCTCTCTTCTCCGG - Intergenic
926059061 2:9793967-9793989 TGAGCCTGCTCCCTCTGCTCGGG + Intergenic
927772166 2:25872770-25872792 TAAGCGTCCTCTCTCTACTAGGG - Intronic
928023793 2:27723581-27723603 AGAGCTTCCTCTCTCTACTCCGG + Intergenic
931737106 2:65205903-65205925 GAAGCTTACACTCTCTGCTCTGG + Intergenic
932043180 2:68320522-68320544 AGCAGGTGCTCTCTCTGCTCCGG - Intergenic
932221997 2:70006636-70006658 TAAGGGTGTTCTCTCTGCTTTGG - Intergenic
934042083 2:88135950-88135972 AAAAGGTGCTTCCTCTGCTCGGG + Intergenic
935200122 2:100849195-100849217 AAAGTCAGCTCTCTCTTCTCTGG + Intronic
937292730 2:120791283-120791305 AAAGCGGGCTCTGACTCCTCAGG - Intronic
938966488 2:136393213-136393235 AAGGCGTGCTCTTTCTGTTTTGG + Intergenic
939894663 2:147776863-147776885 AAAGGGTGCTTTCTGTCCTCTGG + Intergenic
940860790 2:158768739-158768761 AATGTTTGCACTCTCTGCTCTGG + Intergenic
944637379 2:201687908-201687930 AAATTCTGCTCTCTCTGCTGTGG + Intronic
946282445 2:218675922-218675944 CAAAGGTGCTCCCTCTGCTCCGG + Intronic
947278927 2:228426420-228426442 CAAGTGTGCTTTCTCTGCTCTGG - Intergenic
948576410 2:238954159-238954181 AATGCGTTCTCTCTATGATCAGG - Intergenic
949037018 2:241820615-241820637 AATGCGTCCTCTCGCGGCTCTGG - Intergenic
1172008751 20:31834290-31834312 AAAGCCTGCTCTGTCTTCCCTGG - Exonic
1172995663 20:39068918-39068940 AAAGGAAGCTCTCTCTGCTGTGG + Intergenic
1173026820 20:39315298-39315320 AACATGTGCTCTCTCTGCTCTGG - Intergenic
1173130559 20:40388986-40389008 ACAACTTGCTCTTTCTGCTCTGG - Intergenic
1174532108 20:51222348-51222370 CAAGGGTGCTCTCTCAGCACAGG - Intergenic
1174596594 20:51689088-51689110 ACAGCGTGTTCTCTATGCTCAGG + Exonic
1175176514 20:57115564-57115586 CAAGGGAGCTCTCTTTGCTCTGG + Intergenic
1175413252 20:58785190-58785212 AAAGCGTGCTCTCTTCACACTGG - Intergenic
1175692587 20:61076203-61076225 ATAGCGAGCTCTGCCTGCTCTGG + Intergenic
1175760005 20:61556009-61556031 AAGCCGCCCTCTCTCTGCTCCGG + Intronic
1175804327 20:61819059-61819081 ACAGGGTCCTCTGTCTGCTCAGG - Intronic
1176860162 21:14007596-14007618 AATGGGTGCTCCCTCTGGTCAGG + Intergenic
1178835252 21:36091931-36091953 GAAGCTTGCTCTCTCTCCTGAGG + Intergenic
1181115124 22:20627674-20627696 AAAACGTGCTCTCACTGATGAGG - Intergenic
1184735591 22:46395877-46395899 GCAGCGTGCTCTCTGGGCTCTGG - Intronic
1185364837 22:50432714-50432736 AATGGGTGCTCCCTCTGGTCAGG + Intronic
949880844 3:8659459-8659481 GAAGGGAGCTCACTCTGCTCTGG - Intronic
950097267 3:10337548-10337570 CAGCCATGCTCTCTCTGCTCTGG + Intronic
953342576 3:42147822-42147844 AAAGAAATCTCTCTCTGCTCTGG - Intronic
955721163 3:61882980-61883002 AAAGTGAGCTCTGTCTGCTAAGG - Intronic
962744416 3:138387089-138387111 CAAGCTTGCACTCTCAGCTCAGG - Intronic
967269033 3:187717861-187717883 GAAGCTTCCTATCTCTGCTCTGG + Intronic
967826446 3:193881506-193881528 ACACCTTCCTCTCTCTGCTCAGG + Intergenic
968727366 4:2253984-2254006 AAAGCGTGCTCTCTCTGCTCAGG + Intronic
969323004 4:6424405-6424427 AAAGTGTCCTCTCTCTGCAGAGG - Intronic
969465445 4:7353622-7353644 TGAGCGTGCTCTCTTTGCTCCGG + Intronic
970663095 4:18308050-18308072 AAAGAGTGTACTCTCAGCTCTGG - Intergenic
972027344 4:34399403-34399425 AAAGTTTGAGCTCTCTGCTCTGG - Intergenic
972339291 4:38137182-38137204 TCAGCTTGCTCTCACTGCTCAGG - Exonic
977741713 4:100491827-100491849 AAAGCAGGCTCTCTCTGACCAGG + Intronic
979172332 4:117617047-117617069 AAAGCGTTCTCTCTAAGATCAGG + Intergenic
980563510 4:134507588-134507610 GAAGCCGGCTCTCTCTGGTCAGG - Intergenic
980882938 4:138731963-138731985 AAAGAGTGTGCTCTCTTCTCTGG - Intergenic
982415867 4:155131147-155131169 AAACCGGCCTCTCTCTGCTTTGG - Intergenic
982996048 4:162347192-162347214 AAAGACTTCTCTCTCTTCTCTGG + Intergenic
984249105 4:177310187-177310209 AAAGTGTCATCTCTTTGCTCTGG + Intronic
984556846 4:181224735-181224757 AATGTGTGCTCTGTCTGTTCTGG - Intergenic
985550458 5:530880-530902 AAAACGAGCTCACTCTGCTCTGG + Intergenic
994263680 5:97689276-97689298 AAATCCTTCTCTCTCTGTTCAGG - Intergenic
998041484 5:138953432-138953454 TCAGCGTGCTCGGTCTGCTCTGG - Intronic
998395007 5:141812589-141812611 GAAACGTGCTCTCTCTGAGCTGG + Intergenic
999372146 5:151062404-151062426 GGAGCATGGTCTCTCTGCTCAGG - Intronic
1000545628 5:162597678-162597700 AAAGCCTCCTCTCACTGGTCTGG - Intergenic
1004465718 6:15883047-15883069 GAGGTGTGCTGTCTCTGCTCAGG + Intergenic
1006108752 6:31731892-31731914 AAAGCCTGCTCTGTCTAATCTGG + Intronic
1006519930 6:34565354-34565376 ACAGCGGGCTCTCTCCCCTCAGG + Intergenic
1007410745 6:41659894-41659916 AAATCGTTCCCTCCCTGCTCTGG - Intergenic
1009468169 6:63999648-63999670 ACAGTGTAATCTCTCTGCTCAGG - Intronic
1014510118 6:122310194-122310216 AAAGTTTGCTTTCTCTTCTCCGG - Intergenic
1020976037 7:15007771-15007793 AAGGAGTGATCTCTCTGCACTGG - Intergenic
1022619716 7:31970753-31970775 AAAGCATTCCCTCTCTGCTAAGG + Intronic
1023965856 7:44962785-44962807 AAATCGGGCTCTGGCTGCTCCGG + Exonic
1026144839 7:67737721-67737743 AAGGGGTGCTCTCTCTGAGCCGG + Intergenic
1027259919 7:76457480-76457502 AAATAGGGCTCTCTCTTCTCTGG - Intergenic
1028095654 7:86757169-86757191 AATGCTTTCTCTCTTTGCTCTGG + Intronic
1030327744 7:108239201-108239223 ATACTGTGCTCTCCCTGCTCTGG - Intronic
1034308173 7:150063471-150063493 AAAGCTGGCTCTCTCCTCTCTGG + Intergenic
1034343038 7:150370019-150370041 AGAGCGCACTCTCTCTTCTCAGG - Intronic
1034798682 7:154037200-154037222 AAAGCTGGCTCTCTCCTCTCTGG - Intronic
1037434826 8:18851444-18851466 AAAGCAGGCTCTGTCTCCTCAGG + Intronic
1042302943 8:67305421-67305443 AAAGCTTGCTCTTGTTGCTCGGG + Intronic
1048468050 8:134683799-134683821 AAAGCCTGCTCTGTCTGATGGGG + Intronic
1048869101 8:138782740-138782762 AAAGTGTGCACACTCTGCTGTGG + Intronic
1054451208 9:65404392-65404414 AGAGCGTGCTCTCCCGGCCCAGG - Intergenic
1054979373 9:71186434-71186456 AATTCATGCTCTCTCTGCTCTGG + Intronic
1056835849 9:89954403-89954425 AAGCCGTGCTCTCTCTGAGCTGG - Intergenic
1056843178 9:90015143-90015165 GAAGGGTGCTCTGTCTGCTGTGG + Intergenic
1059506736 9:114806044-114806066 AATGGGGGCTCTCTCTGCCCAGG - Exonic
1059767008 9:117393182-117393204 AAAGCTGGCTCCTTCTGCTCAGG - Intronic
1061683927 9:132259423-132259445 AAATCTTGCCCGCTCTGCTCTGG + Intergenic
1062445555 9:136592661-136592683 AAAATGTGCTCTCCCCGCTCTGG - Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1199326932 X:146510292-146510314 AAAGCCTGATATATCTGCTCAGG - Intergenic