ID: 968727370

View in Genome Browser
Species Human (GRCh38)
Location 4:2253990-2254012
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 352
Summary {0: 1, 1: 0, 2: 4, 3: 31, 4: 316}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968727356_968727370 16 Left 968727356 4:2253951-2253973 CCCCCACCCCAGGAACTGTGTAG 0: 1
1: 0
2: 1
3: 20
4: 278
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727362_968727370 9 Left 968727362 4:2253958-2253980 CCCAGGAACTGTGTAGGCAAGAG 0: 1
1: 0
2: 1
3: 13
4: 160
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727361_968727370 10 Left 968727361 4:2253957-2253979 CCCCAGGAACTGTGTAGGCAAGA 0: 1
1: 0
2: 2
3: 17
4: 183
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727363_968727370 8 Left 968727363 4:2253959-2253981 CCAGGAACTGTGTAGGCAAGAGG 0: 1
1: 0
2: 0
3: 24
4: 176
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727357_968727370 15 Left 968727357 4:2253952-2253974 CCCCACCCCAGGAACTGTGTAGG 0: 1
1: 0
2: 0
3: 16
4: 226
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727352_968727370 25 Left 968727352 4:2253942-2253964 CCCTGCCGCCCCCCACCCCAGGA 0: 1
1: 0
2: 10
3: 109
4: 883
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727353_968727370 24 Left 968727353 4:2253943-2253965 CCTGCCGCCCCCCACCCCAGGAA 0: 1
1: 0
2: 13
3: 137
4: 1905
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727359_968727370 14 Left 968727359 4:2253953-2253975 CCCACCCCAGGAACTGTGTAGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727354_968727370 20 Left 968727354 4:2253947-2253969 CCGCCCCCCACCCCAGGAACTGT 0: 1
1: 1
2: 15
3: 128
4: 934
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727360_968727370 13 Left 968727360 4:2253954-2253976 CCACCCCAGGAACTGTGTAGGCA 0: 1
1: 0
2: 3
3: 20
4: 218
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316
968727355_968727370 17 Left 968727355 4:2253950-2253972 CCCCCCACCCCAGGAACTGTGTA 0: 1
1: 0
2: 0
3: 25
4: 330
Right 968727370 4:2253990-2254012 TGCTCTCTCTGCTCAGGGAGGGG 0: 1
1: 0
2: 4
3: 31
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type