ID: 968727691

View in Genome Browser
Species Human (GRCh38)
Location 4:2255892-2255914
Sequence CACCCCCAGCTCCCCGGCAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 455
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 406}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968727691 Original CRISPR CACCCCCAGCTCCCCGGCAG CGG (reversed) Intronic
900156882 1:1206729-1206751 CCCCCGCAGGTCGCCGGCAGGGG + Intergenic
900341165 1:2190000-2190022 CACCCCCAGCTCGGACGCAGGGG - Intronic
900436624 1:2634114-2634136 CACTCCCAGCTCCCCAGAAAGGG - Intergenic
900595467 1:3478327-3478349 CCCACCCGGCTCCCCTGCAGTGG - Intronic
900677336 1:3896099-3896121 CCTCCCCAGCTCCCAGGCAGCGG + Intronic
900762704 1:4483567-4483589 CACCTCCAGCCCCCCGGGACTGG - Intergenic
901125099 1:6923648-6923670 CACCCCCAGCTCACCGCCACAGG - Intronic
901720484 1:11193406-11193428 CCACCCCAGCTCACCAGCAGTGG + Intronic
902472505 1:16658448-16658470 CACCCACCGCTGCCCGGCACCGG - Intergenic
902486300 1:16748998-16749020 CACCCACCGCTGCCCGGCACTGG + Intronic
902816076 1:18917542-18917564 CCTCCCCTGCTTCCCGGCAGAGG + Intronic
903032689 1:20475177-20475199 CACCCCCAACTCCAGGGGAGGGG + Intergenic
903222947 1:21878969-21878991 CAGCCCCAGCTCCGGGTCAGGGG - Intronic
903542960 1:24107187-24107209 CTCCTCCAGCTCCACGGCAGAGG + Exonic
903893228 1:26584270-26584292 CACACTCATCTCCCTGGCAGAGG - Intergenic
903968814 1:27106074-27106096 CAGGCCCAGCACCCCTGCAGGGG + Exonic
904031584 1:27536704-27536726 CACCCCCAACACCCCAACAGAGG - Intronic
904408681 1:30311769-30311791 CACCCCCTTCTCCCCAGCAGTGG - Intergenic
905172044 1:36115207-36115229 CACCCCCAGGCCTCAGGCAGGGG + Intronic
905445986 1:38028785-38028807 CCACCCCAGCCCCCCGCCAGGGG + Intergenic
905461205 1:38124055-38124077 CACCCACAGCTCCCAGAAAGGGG + Intergenic
906693925 1:47811366-47811388 CACCTCCATCTGCCCTGCAGTGG + Intronic
908037857 1:60074992-60075014 CACACTCAGCTCCCCTCCAGGGG + Intergenic
913069584 1:115286624-115286646 AGCCCGCAGCGCCCCGGCAGCGG - Exonic
914490640 1:148148486-148148508 CACCACCAGCTCCCACCCAGGGG - Intronic
914936376 1:151984414-151984436 CACCCTCAGCTTCCTGGCTGTGG + Intronic
915917680 1:159950795-159950817 CACCCCCAACTCCCTGGCAAAGG - Intergenic
916040160 1:160954782-160954804 CACTCGGAGCTCCCCTGCAGAGG + Exonic
916118986 1:161511615-161511637 CACCCCCAGTTCCCCTGCTCAGG - Intronic
916128745 1:161593275-161593297 CACCCCCAGCTCCCCTGCTCAGG - Intronic
917079039 1:171237587-171237609 CACACTGAGCTCCCTGGCAGAGG + Intergenic
917450918 1:175146724-175146746 TAACCCCAGCTGCCCAGCAGAGG + Intronic
917751920 1:178061230-178061252 CACCTCCAGCTCCCCGGGGAAGG - Intergenic
918118581 1:181517684-181517706 CATCCCCAGCTTCTCGCCAGTGG + Intronic
918494712 1:185121874-185121896 CAACCCCAGCACCCATGCAGTGG + Intronic
918943147 1:191027109-191027131 CACACTAAGCTCCCAGGCAGGGG + Intergenic
919419723 1:197355427-197355449 CACCCCCTGCTCCGCGGCGCCGG - Intronic
919821609 1:201476513-201476535 AGCCCCCAGCTCCCAGGGAGAGG - Intergenic
920052529 1:203172391-203172413 CAGCACCTGCTCCCCAGCAGGGG - Intronic
920074050 1:203324226-203324248 CACCCACATCTCCCAGGAAGTGG - Intergenic
920850522 1:209625219-209625241 CACCCCCATCCCACCAGCAGAGG - Intronic
921581854 1:216904679-216904701 CACCAACAACTCCCCGGCTGTGG + Intronic
922573359 1:226646534-226646556 CACCCCCAGGTTCCTGACAGGGG - Intronic
923369344 1:233295288-233295310 TACCCACAGCTCCCCGGGACCGG + Intronic
924508173 1:244705480-244705502 CACCCTCCACTCCCTGGCAGTGG + Intronic
924560711 1:245155036-245155058 CTCTCCCACCTTCCCGGCAGCGG + Exonic
1062919304 10:1267159-1267181 CACCCACACCTACCCGGGAGGGG - Intronic
1063071065 10:2664784-2664806 CAGCCCCAGCACCACAGCAGGGG + Intergenic
1063126156 10:3138367-3138389 CAACGCGAGCTCCCGGGCAGCGG - Intronic
1064217189 10:13410153-13410175 CACCCCCAGCGCCCCAGCATGGG - Intergenic
1064392466 10:14953857-14953879 AGCCCCCAGCGCCCCGGGAGCGG + Intronic
1065501973 10:26391888-26391910 CCCCCCGAGCTCCGCGGCACTGG + Intergenic
1067828644 10:49597415-49597437 CACCTCCAGGTCCCCATCAGAGG + Intergenic
1069897215 10:71687273-71687295 CACCCCCAGCTCCCATGCTGGGG - Intronic
1070704565 10:78628434-78628456 CACCCCCATCTCCTCAGCAGAGG - Intergenic
1072228927 10:93396710-93396732 CACCCTTAGCTCCCTGACAGTGG - Intronic
1073049430 10:100657893-100657915 CACCCCCACCTCCCCAGCTTAGG - Intergenic
1075651149 10:124128953-124128975 CACACCCAGCTCACCGGCCAGGG - Intergenic
1075999902 10:126905884-126905906 TACCCCCAACTCCCCGGCCCCGG + Intronic
1076352419 10:129826147-129826169 CACCACCTGCTCCCCAGGAGGGG - Intergenic
1076469859 10:130710795-130710817 CAGCACCATCTCCCCTGCAGTGG - Intergenic
1076704490 10:132293787-132293809 CACCCCCATTCCCCAGGCAGTGG - Intronic
1076725363 10:132410555-132410577 CACGCCCCCCTCCCCTGCAGTGG - Intronic
1076795118 10:132794610-132794632 CCCCCACAGCTCCTGGGCAGAGG - Intergenic
1076839386 10:133038604-133038626 CAGCCCCAGCTCCCAGGCCCGGG + Intergenic
1076908881 10:133377749-133377771 CTGCCCCAGCTCCCCAGCGGAGG - Intergenic
1077159178 11:1104927-1104949 GGCCCCCAGCTCCAGGGCAGGGG - Intergenic
1077341395 11:2027939-2027961 CATCCCCAGCTCTCAGGCACCGG + Intergenic
1077360352 11:2138006-2138028 CACCCCCAGCTCCGCCGCCAGGG + Intronic
1077499925 11:2904712-2904734 GACCCCCAGCTCCGAGGGAGTGG - Intronic
1077635835 11:3840906-3840928 CGCCCCCAGCTCCCCCGCCTCGG - Exonic
1078744293 11:14096557-14096579 CACCCACTGCTCCCTGCCAGTGG + Intronic
1079529051 11:21427032-21427054 CACCACCAGCTGCCTGGCTGTGG - Intronic
1079708628 11:23653210-23653232 CTCCCCCTGCTCCACGGCACGGG - Intergenic
1080601520 11:33825342-33825364 CACCTCCAGCTCCCCAGTAGTGG + Intergenic
1081611033 11:44563617-44563639 CACCCCCAGCTCGGAGGGAGCGG + Intergenic
1081717324 11:45259650-45259672 CATCCCCAGCTCCCAGGAAGAGG + Intronic
1081792126 11:45795571-45795593 AACCCCCAGTTCCCAGGGAGTGG + Intergenic
1082174892 11:49048563-49048585 GAGCCCCAGGACCCCGGCAGCGG + Intergenic
1082657710 11:55872989-55873011 GAGCCCCAGGACCCCGGCAGCGG + Intergenic
1082988327 11:59186458-59186480 TGCTCCCAGCTCCCCAGCAGGGG - Intronic
1083621834 11:64053150-64053172 CAGCCCCAGCTCTCCGTCTGGGG - Intronic
1083733626 11:64667427-64667449 CACCCCCAGCCCGCCGGCCCTGG + Exonic
1083815517 11:65130422-65130444 CAGACCCAACTCCCAGGCAGGGG + Intronic
1084965792 11:72743844-72743866 AACCCCCAGCCCTCAGGCAGGGG + Intronic
1084968466 11:72756560-72756582 CACCCACAGCACCCCTGGAGGGG + Intronic
1086690882 11:89787523-89787545 GAGCCCCAGGACCCCGGCAGCGG - Intergenic
1086714918 11:90052132-90052154 GAGCCCCAGGACCCCGGCAGCGG + Intergenic
1087743405 11:101915122-101915144 CAGCCCTAGCTCCCGCGCAGCGG - Exonic
1088598337 11:111455964-111455986 CACCCCCAGACACCCAGCAGGGG + Intronic
1088992236 11:114963695-114963717 TACCCCCAGCACACTGGCAGAGG + Intergenic
1089171824 11:116517336-116517358 CACACCCAGCTGCACGTCAGGGG + Intergenic
1091360827 11:134977490-134977512 CACCTCCAGCTCCCAGCCTGGGG - Intergenic
1202824380 11_KI270721v1_random:83128-83150 CATCCCCAGCTCTCAGGCACCGG + Intergenic
1091917120 12:4277699-4277721 CACCCCCAGCCCCACAGCTGTGG + Intronic
1091960915 12:4693466-4693488 CACCCCCAGTTTACCAGCAGTGG + Exonic
1096220546 12:49826101-49826123 CACCCCCAGGTCCCAGGCAAGGG - Intronic
1096240976 12:49960260-49960282 CACCCCCAGGATCCCGGGAGAGG - Intergenic
1096470120 12:51870292-51870314 CACCCACAGCTTCCCTGCAAAGG + Intergenic
1096699218 12:53371359-53371381 CACCCCCAGTTTCCGGGTAGGGG - Intergenic
1096782747 12:54000503-54000525 CTTCCCCAGCTTCCCGGCCGGGG + Exonic
1097182637 12:57179970-57179992 CACCCCATGCTCCCCGGCCCTGG - Intronic
1100581316 12:95942922-95942944 CACCCCAACCCCCCGGGCAGAGG + Exonic
1101970459 12:109309143-109309165 CACCCCCGGAGCGCCGGCAGCGG - Exonic
1102590257 12:113951218-113951240 CCTCCCCAGCTCTCCTGCAGGGG + Intronic
1103048776 12:117761232-117761254 TGCCCCCATCGCCCCGGCAGCGG - Exonic
1103049388 12:117766654-117766676 CACCCCCACCTCCTGGCCAGTGG - Intronic
1103587016 12:121963526-121963548 GACTCCCTGCTCCCCAGCAGCGG - Intronic
1103946311 12:124528643-124528665 CACCCTCATCTCTCCAGCAGAGG + Intronic
1104063085 12:125284440-125284462 TAACCCCTGCTCCACGGCAGCGG - Intronic
1105202843 13:18194566-18194588 CGCCCCCAGATCCCCGGGAGAGG + Intergenic
1105251084 13:18698584-18698606 CACTCTCAGCTCCCAGGCGGGGG + Intergenic
1105472216 13:20704202-20704224 CAACGCGAGCTGCCCGGCAGGGG + Exonic
1105724987 13:23154738-23154760 CACCCCCAGCTCTGGAGCAGTGG - Intergenic
1105823865 13:24104856-24104878 CTCCCCCAGCTCCTCGCCAGAGG + Intronic
1106534211 13:30624496-30624518 TAGCCCCAGCTACCCGGGAGGGG + Intronic
1107253297 13:38392142-38392164 CACCCCCACATCCCCTACAGTGG - Intergenic
1114451656 14:22830312-22830334 TACCCCCAGCTCCCCGTCCAGGG - Intronic
1115821400 14:37215946-37215968 CAACCCCAGCTACCCAGCTGAGG + Intronic
1118820729 14:69343997-69344019 CACCCCCAGTTCCTAGGCTGAGG + Intronic
1119296532 14:73537723-73537745 CACCTCCAGCTCCACGGCCAAGG - Exonic
1119300776 14:73569728-73569750 CACCTCCAGCTCCACGGCCAAGG - Exonic
1119779897 14:77270730-77270752 GCGCCCCAGCGCCCCGGCAGCGG + Intronic
1122300147 14:100726888-100726910 CGGCGGCAGCTCCCCGGCAGCGG + Exonic
1122548131 14:102536056-102536078 CAGCCCCAGCAGCCGGGCAGTGG + Intergenic
1123020948 14:105397683-105397705 CACCCCCAGCTCTCACCCAGAGG - Exonic
1123449018 15:20348996-20349018 CATCCCCAGCTCACAGGCACAGG - Intergenic
1123582160 15:21725380-21725402 CACCCCAACCACCACGGCAGAGG - Intergenic
1123618810 15:22167976-22167998 CACCCCAACCACCACGGCAGAGG - Intergenic
1124223401 15:27869255-27869277 CACCCTCAGCACCCCCACAGCGG + Intronic
1124593574 15:31075645-31075667 CTCCACCAGCTCCCAGTCAGGGG - Intronic
1124655020 15:31500570-31500592 CTCCCCCAGCCCTCCGCCAGAGG - Intronic
1124892953 15:33749621-33749643 CACTCCCAACTCCCCGTCTGAGG + Intronic
1126097083 15:45097469-45097491 CAGCCCTATCTCCCCGGCACAGG - Intronic
1126578576 15:50221305-50221327 CACCCCCACCCCACCGCCAGTGG - Intronic
1127480469 15:59372536-59372558 CAGCCCCAGTTCCCCGGCAGCGG - Exonic
1128217739 15:65945851-65945873 TACCCGCAGCTCACAGGCAGGGG + Intronic
1128374772 15:67066665-67066687 CAGCCCCAGCTCCCCGGAGTGGG - Intronic
1128549968 15:68591674-68591696 GACACCCAGCTCCCAGGCACAGG - Intronic
1128692354 15:69734659-69734681 CACCCCCTGATCCCAGGCATCGG - Intergenic
1129104428 15:73296346-73296368 GACCACCAGCTCCCCCGCCGTGG + Intronic
1129321473 15:74777375-74777397 CACCTCCAGGCCCCCCGCAGTGG - Intergenic
1130937513 15:88482778-88482800 CACCCCCACCTCCCACCCAGTGG - Intergenic
1131000920 15:88939284-88939306 CACCCCCAGCTTCCAGGCCCAGG + Intergenic
1132098524 15:99006108-99006130 GACCCACAGCTCCTAGGCAGCGG - Intronic
1132491558 16:234682-234704 CACCGCCAGGTTCCCGGCGGAGG + Exonic
1132859193 16:2061669-2061691 CACCCCCAGATCCTCTCCAGGGG - Intronic
1132880733 16:2160707-2160729 CACCCCCACTTCCCCAGCACTGG + Intronic
1132901446 16:2256963-2256985 CAGCCCCACCTCTCCGTCAGTGG - Intronic
1133023603 16:2977787-2977809 CTCCCCCAGCTCCCCGTCAAGGG + Intronic
1133139211 16:3731994-3732016 GACGCCCAGCTCCCAGGCCGTGG + Intronic
1133567171 16:7006820-7006842 AACCCTCAGCTCCCAAGCAGTGG + Intronic
1134291244 16:12903786-12903808 CACACACAGGCCCCCGGCAGAGG - Intronic
1135640823 16:24118483-24118505 CACTCCCAGCTACCCAGCAGTGG - Intronic
1136372447 16:29844850-29844872 CACCACCAACTCCCAGGAAGCGG + Exonic
1136564460 16:31061638-31061660 CACCACCAGCTCCTGTGCAGGGG + Exonic
1138694244 16:58796858-58796880 CACCCCCAACTCCTCGTCTGTGG + Intergenic
1139437395 16:66944029-66944051 CACCCCCTCCTCCCCGGCACAGG - Exonic
1139582931 16:67883947-67883969 CATCCCCAGCTACCTGGAAGAGG + Exonic
1139598118 16:67969630-67969652 CTCCCCCAGGGCCCCCGCAGCGG + Intergenic
1139782596 16:69364261-69364283 CCCTCCCTGCTCCCTGGCAGCGG + Intronic
1140890693 16:79282293-79282315 CACCCCAAGTTCCCTGGGAGAGG + Intergenic
1141169580 16:81682718-81682740 CTACCCCTGCTCCCTGGCAGTGG - Intronic
1142048278 16:87940219-87940241 AACGCCCAGCTCCCCGGCCATGG - Intergenic
1142098540 16:88259248-88259270 CACCCCCCGCCCCCCCGAAGCGG + Intergenic
1142155782 16:88532362-88532384 CACACCCAGGGCCCCCGCAGGGG + Intronic
1142217794 16:88838339-88838361 CATCCCCAGGACCCTGGCAGAGG + Intronic
1142222997 16:88864550-88864572 CACGGCCAGCACCCCTGCAGAGG + Intronic
1142223009 16:88864580-88864602 CACGGCCAGCACCCCTGCAGAGG + Intronic
1142223021 16:88864610-88864632 CACGGCCAGCACCCCTGCAGAGG + Intronic
1142278721 16:89137058-89137080 CTCCCGCATCTGCCCGGCAGAGG - Intronic
1142286387 16:89173189-89173211 CAGCCTGCGCTCCCCGGCAGAGG - Intronic
1143020524 17:3915133-3915155 CACCCCTAGGACCCCAGCAGGGG + Intronic
1144764429 17:17724989-17725011 CACCCCACTCCCCCCGGCAGAGG - Intronic
1144962344 17:19051938-19051960 CACCCCCAGCTCCAGGGCCCTGG + Intergenic
1144972817 17:19122582-19122604 CACCCCCAGCTCCAGGGCCCTGG - Intergenic
1145209872 17:21004872-21004894 CACCCCCAGCTCTTGGCCAGAGG + Intronic
1145826064 17:27878079-27878101 GGCCCCCAGCTCAACGGCAGGGG + Intronic
1146906809 17:36623165-36623187 TGCTTCCAGCTCCCCGGCAGAGG - Intergenic
1147705515 17:42422554-42422576 CCACCCCAACTCCCAGGCAGGGG + Intronic
1148060135 17:44830329-44830351 CGCCCCCCGCTCCCGGGCCGCGG - Intronic
1148108733 17:45132727-45132749 CACCCCCAGCCCCGCAGCATGGG - Intronic
1148122737 17:45222213-45222235 CTCCTCCAGCTCTCCGGCCGCGG - Exonic
1148157378 17:45431850-45431872 CCCCCCAAGGTCCCCAGCAGAGG - Intronic
1148178025 17:45584702-45584724 CAGCACCAGCGCCCCGGCCGGGG - Intergenic
1149582666 17:57762178-57762200 CACCCCCAGCCCCCCTACACCGG + Intergenic
1150389073 17:64780562-64780584 CCCCCCAAGGTCCCCAGCAGAGG - Intergenic
1150407913 17:64918988-64919010 CAGCACCAGCGCCCCGGCCGGGG - Intronic
1150562076 17:66302807-66302829 CGGCCGCAGCTCCCCGGCGGAGG + Exonic
1150823783 17:68457303-68457325 GTCCCCCACCTCCCTGGCAGGGG + Intronic
1151486152 17:74402100-74402122 CACTCCCAGCTCCCCGGTCCTGG + Intergenic
1152674965 17:81635221-81635243 CAACCCCAGCTACTCGGCTGAGG + Intronic
1152801824 17:82334224-82334246 GTCCCCCAGCTCCCCCGCAGAGG + Intergenic
1153219383 18:2847966-2847988 CACCCCCACCGCCCCGGCCCGGG - Intronic
1153897578 18:9580731-9580753 CTCCCGCAGCTCCCGGGCACAGG + Intronic
1154145352 18:11862125-11862147 CACCCCCAGCGCTGTGGCAGTGG + Intronic
1154437764 18:14360330-14360352 CACTCTCAGCTCCCAGGCGGGGG - Intergenic
1154494477 18:14945467-14945489 CACCTCCAGCTCCCAGCCTGGGG + Intergenic
1154501929 18:15001524-15001546 CACCCCCATCCCCACGGGAGGGG - Intergenic
1155474822 18:26227010-26227032 CACCGGCAGCGCCCCGGCCGGGG - Exonic
1156036561 18:32771918-32771940 CACCCCCACTTCCCCGGCCCTGG + Intronic
1156269061 18:35514346-35514368 CACCCCCAACTCCCCATCAAAGG - Intergenic
1156364024 18:36408977-36408999 CAGACCCAGCTCCCCAGCAGGGG - Intronic
1157601615 18:48896671-48896693 TACCCACAGCTTCCAGGCAGAGG + Intergenic
1160021797 18:75187016-75187038 CAGGCCCAGCTCCCTGGCAATGG - Intergenic
1160251952 18:77210518-77210540 CACCCCCACCCCCCAGCCAGAGG - Intergenic
1160302705 18:77700193-77700215 CACCCACAGCTCCCCTGCGCTGG - Intergenic
1160368778 18:78353023-78353045 CACTCTCAGGTCCCCTGCAGAGG + Intergenic
1160563611 18:79773543-79773565 CTCCCCGAGCTCCTCGGCAAGGG + Intergenic
1160592197 18:79951162-79951184 CACCCCCCCGTCCCAGGCAGGGG - Intronic
1160686309 19:438567-438589 CACCCCCAGCTCCTGCTCAGCGG + Intronic
1160795235 19:942323-942345 CCCCCGCAGCTGCCCGGCGGTGG + Intronic
1160832006 19:1108522-1108544 CACCTACAGCCCCCCGGCCGAGG - Exonic
1160994978 19:1878340-1878362 CACCACCAGCTCCCACCCAGGGG + Intronic
1161264974 19:3359856-3359878 CCCCCCCCGCACCCCGGCTGGGG + Intronic
1161767958 19:6217256-6217278 CTCCCCCAGCCCCCCTGCAAAGG + Intronic
1162127415 19:8506883-8506905 CAGCCCCAGTTCCCAGTCAGCGG - Intergenic
1162399481 19:10436116-10436138 CACCTCCAACTCCCCGGCCTAGG - Intronic
1162437604 19:10671549-10671571 CCCACCCACCTACCCGGCAGTGG - Intronic
1162803226 19:13122516-13122538 CACCCCCCCCCCCCCGGCAGGGG - Intronic
1163103185 19:15109583-15109605 CACACCCTCCTCCCCGCCAGGGG + Intronic
1163558814 19:18007269-18007291 CACCCCCAGGTCCACAGCTGCGG - Intronic
1164448416 19:28337412-28337434 CACCCCCAGCAGCCTGGCATTGG - Intergenic
1164647758 19:29872315-29872337 CAGCCCCTGCTCCCCGCCCGCGG + Intergenic
1164830401 19:31315518-31315540 CACACCCAGCTCCCTGGCAGAGG - Intronic
1164989172 19:32672475-32672497 AAGCCCCAGCTCCCAGGGAGAGG + Intronic
1165264061 19:34645971-34645993 CAACCCCAGCCCCCTGACAGAGG + Intronic
1165357265 19:35311933-35311955 GAGCCCCAGCTTCTCGGCAGGGG + Exonic
1166073301 19:40398814-40398836 CACCTCCACCTCGCCCGCAGGGG - Exonic
1166769381 19:45271768-45271790 CCCCCACACCTCCCCTGCAGAGG + Intronic
1166850336 19:45757071-45757093 CACCCCCAGCACTCCCCCAGGGG + Intronic
1167594252 19:50418875-50418897 CACCCTCCTCCCCCCGGCAGGGG + Intronic
1167621309 19:50562544-50562566 CAGCCACAGCTCCACTGCAGAGG - Intronic
1168078156 19:53991728-53991750 CACCCCCGACTCCCGAGCAGGGG - Intergenic
1168122018 19:54256885-54256907 CACCCCCAGCTGCCCGGGGTTGG + Intronic
1168134090 19:54338790-54338812 CACCCCCAGCTGCCCAGGGGTGG + Intronic
1168173704 19:54607959-54607981 CAGCCCCAGCTGCCCGGGGGTGG - Intronic
1202704896 1_KI270713v1_random:15253-15275 CACCCACCGCTGCCCGGCACCGG - Intergenic
926159082 2:10475336-10475358 GACCCCCAGCCCCCACGCAGAGG - Intergenic
926193001 2:10742349-10742371 CACCTCCAGCTCTCCCGCTGAGG - Intronic
926229739 2:10993256-10993278 CCCCGCCTGCTCCCTGGCAGTGG - Intergenic
926901149 2:17753529-17753551 GACCCCCAGCCACCCGGGAGAGG - Intronic
926905233 2:17799405-17799427 CACCCTCAGCTGCCCAGCACTGG - Intronic
927491004 2:23520996-23521018 CCCCCCCCGCTCCCCCTCAGGGG + Intronic
927712815 2:25336286-25336308 CACCCCCATTTCCCTGGCACTGG + Intronic
927809471 2:26173432-26173454 CCCTCCCAGCTCCCCGGCGTGGG + Intronic
927941626 2:27107014-27107036 CACCCCCAGATGACTGGCAGAGG + Intronic
929857541 2:45650026-45650048 AATCCCCAGCTCCCCGGCAGCGG + Intergenic
930034803 2:47078678-47078700 CTACCCCAGCTCCTCTGCAGTGG + Intronic
932107194 2:68954926-68954948 CACTCCCAGCTCCCCGCCGAGGG + Intergenic
932231345 2:70086885-70086907 CAGCTCCTGCTCCCCGGCGGCGG - Intergenic
932573790 2:72951766-72951788 CACCACCTGCTCCTGGGCAGAGG + Intronic
933671042 2:85007520-85007542 CACCTCCAGCTCCCAGGAACAGG + Intronic
933902887 2:86861951-86861973 CCCCCCCAGCTCCCCGACCCAGG - Intergenic
933994214 2:87656049-87656071 CAGCCCAAGCTTCCCTGCAGTGG - Intergenic
934567569 2:95349089-95349111 CCCCCCCCGCCCCCCGTCAGAGG + Intronic
935061113 2:99608615-99608637 GACCCTCAGCTCCCCAGCCGAGG + Intronic
935777658 2:106487319-106487341 CCCCCCCAGCTCCCCGACCCAGG + Intergenic
936299648 2:111294864-111294886 CAGCCCAAGCTTCCCTGCAGTGG + Intergenic
936886658 2:117318755-117318777 CACCACCACCACCCCTGCAGGGG + Intergenic
937169349 2:119850209-119850231 CCACCCCAGCTCCAGGGCAGTGG - Intronic
937362204 2:121237226-121237248 CACCTCCAGCTCCCAGGTCGTGG + Intronic
938031883 2:128002006-128002028 AACCTCCACCTCCCAGGCAGAGG + Intronic
938107643 2:128544360-128544382 CACTCCCAGCTCCCAGCCAATGG - Intergenic
938447668 2:131390708-131390730 GAGCCCCAGCACCCAGGCAGTGG - Intergenic
938501109 2:131831693-131831715 CACCCCCATCCCCACGGGAGGGG - Intergenic
939459926 2:142486646-142486668 CATCCCCAACTCCCAGGGAGGGG + Intergenic
947542861 2:230990713-230990735 GACCCCCACCTCCGCGGCAGAGG + Intergenic
948811592 2:240481158-240481180 CAGGCACAGCTCCCAGGCAGCGG - Intronic
948909522 2:240996150-240996172 AACCCCCAGCTCCCCGGGCCCGG + Intergenic
1171044306 20:21796246-21796268 CAGCCCCAGGTGCCCAGCAGAGG + Intergenic
1171448400 20:25220387-25220409 GACCCCCAGAACCCCAGCAGGGG - Intronic
1171869357 20:30513327-30513349 CACCACCAGCTCCCCCTCACGGG + Intergenic
1172619091 20:36307645-36307667 CACCCCCACCTGCCTGGAAGTGG + Intronic
1172640185 20:36436100-36436122 CATCCCCAGGTGCCCGGCGGCGG + Exonic
1173347421 20:42213747-42213769 CACCACCAGCTGCCAGGAAGAGG + Intronic
1174092348 20:48059172-48059194 CACCCCCGGCTCCACGGCGCTGG + Intergenic
1174535045 20:51244984-51245006 CACCCCCAGCCACCTGTCAGTGG - Intergenic
1174549908 20:51354837-51354859 CACCTCCAGCTCCACAGCTGAGG - Intergenic
1174611656 20:51802274-51802296 CTCACCCAGCTCCCCCGCCGCGG + Exonic
1174997772 20:55590030-55590052 AACCCCAAGCTCCACAGCAGAGG - Intergenic
1175272230 20:57742456-57742478 CACACCCAGCTCCTCTCCAGAGG - Intergenic
1175314986 20:58040875-58040897 CACCACCTGCTCCCTGGCTGTGG + Intergenic
1175973689 20:62699688-62699710 CACCCTCACCTCCCAGCCAGAGG + Intergenic
1175994396 20:62805592-62805614 CAATCCCAGCTCCCCGACAGGGG - Intronic
1176378806 21:6101566-6101588 GACCCCCACCTCCCCAGCATGGG + Intergenic
1176715113 21:10343439-10343461 CGCCCCCAGATCCCCGGGAGAGG - Intergenic
1178439107 21:32584226-32584248 CAGCCCCAGCTCCTGGGCACGGG + Exonic
1178707843 21:34889598-34889620 CCCCTCCGGCTCCCCGGAAGCGG + Intronic
1178942970 21:36922987-36923009 CACCACCAGCTCCGCGGCCCGGG + Intronic
1179488408 21:41725703-41725725 CAGCCTCAGCACCCCTGCAGCGG + Intergenic
1179744668 21:43436671-43436693 GACCCCCACCTCCCCAGCATGGG - Intergenic
1179996787 21:44977871-44977893 CACTCTCAGCTCCCAGGCGGGGG + Intergenic
1180603234 22:17036499-17036521 CGCCCCCAGATCCCCGGGAGAGG + Intergenic
1180612537 22:17107344-17107366 CACCCCCTGCCCCCCGGCACTGG + Intronic
1180842752 22:18966933-18966955 GCCCCCCAGCTCCCTGGCACCGG + Intergenic
1181058696 22:20271801-20271823 ACCCCCCAGCTCCCTGGCACTGG - Intronic
1181121034 22:20668874-20668896 CACCACCAGCTCCCACCCAGGGG + Intergenic
1181334000 22:22115900-22115922 CACCACCAGCTCCCACCCAGGGG + Intergenic
1181671553 22:24427756-24427778 CACCCCCTCCTCCCCGCCTGGGG - Intronic
1181884014 22:26004730-26004752 CATCCTCAGCTCCCAGCCAGAGG + Exonic
1182021700 22:27087001-27087023 GACCCCCCGCTCTCAGGCAGTGG + Intergenic
1182518163 22:30870692-30870714 CACCCCCACCGCCCTGGCACGGG + Intronic
1182917042 22:34043628-34043650 CCTCCCCATCTCCCAGGCAGGGG - Intergenic
1183236743 22:36624441-36624463 CACCCACAGCACCCAGGCTGAGG + Intronic
1183404822 22:37625210-37625232 CACCCCCAGCTCCCTCCCTGGGG - Intronic
1183509777 22:38227948-38227970 CTCCCCCAGCTCCTCAGAAGGGG - Intronic
1183642201 22:39099607-39099629 CACCCACAGTTCTCAGGCAGGGG + Intronic
1183668144 22:39256860-39256882 CACACCCAGCTCTCACGCAGGGG - Intergenic
1184173488 22:42772853-42772875 CACCCCCAGCCCATCAGCAGAGG + Intergenic
1185065287 22:48629024-48629046 CACTCGCAGCTGCCGGGCAGAGG + Intronic
1185170163 22:49288760-49288782 CACCCCCAGCACCCAGGCCTTGG + Intergenic
1185224943 22:49647056-49647078 CACCCCCAAGTCCCCGTGAGTGG + Intronic
949919349 3:8988972-8988994 CACCCCCAGCCCCCGGGCCATGG - Intronic
950335164 3:12187535-12187557 CAGCAGCAGCTCCCTGGCAGAGG + Exonic
951415492 3:22417279-22417301 CACCCCCTGCTCCATGGCACCGG + Intergenic
953027132 3:39151791-39151813 CTCCCCCAGCTCTCCTTCAGAGG - Intronic
953537405 3:43786748-43786770 CAGCCCCAGCTCCCTCCCAGAGG - Intergenic
955445643 3:59007154-59007176 CACCCCCAACTCCCCAACAGTGG + Intronic
956024624 3:64969849-64969871 CACCCTGAGCTCTTCGGCAGTGG - Intergenic
961952176 3:130761751-130761773 CTCCCCCATCCCCCTGGCAGTGG + Intergenic
962691911 3:137907544-137907566 CACACTAAGCTCCCTGGCAGGGG + Intergenic
962862204 3:139414588-139414610 CACCCCCACATCCCCTACAGGGG - Intergenic
964151548 3:153531693-153531715 CCTCCCCAACTCCCTGGCAGTGG + Intergenic
965837894 3:172871232-172871254 CACGCCCAGCCCCCAGGCTGAGG - Intergenic
966807241 3:183817273-183817295 CTCGCCCAGCCCCGCGGCAGTGG + Exonic
968491592 4:893178-893200 GAGCCCCAGATCCCCCGCAGAGG - Intronic
968491625 4:893298-893320 GAGCCCCAGATCCCCCGCAGAGG - Intronic
968511668 4:998335-998357 CACCCCCAGCTCCACAGCAAAGG - Intronic
968727691 4:2255892-2255914 CACCCCCAGCTCCCCGGCAGCGG - Intronic
968815174 4:2818239-2818261 CGGCCCCAGCTCCGCGGCCGCGG - Exonic
968908825 4:3466428-3466450 CACCCCCAGCCCCTCGTTAGCGG - Intronic
969489381 4:7490508-7490530 CAGCCCCACCTCCCTGGCAGTGG - Intronic
969658088 4:8509531-8509553 CACTCCCAGCTGCCGGGGAGGGG + Intergenic
972331290 4:38066691-38066713 AGCCCCCAGCTCCCCTCCAGGGG - Intronic
972895620 4:43616282-43616304 CTCCACTAGCTCCCCAGCAGAGG + Intergenic
973196214 4:47445038-47445060 CACCCCCAGTTCCCAGGGAAAGG - Intergenic
973722822 4:53742446-53742468 CATCCCCAGCTGCAAGGCAGAGG - Intronic
975147900 4:70990672-70990694 CACCCCCACTCCCCCTGCAGAGG - Intronic
976390008 4:84497676-84497698 CAGCCCCAGCGCCGCGGCCGTGG - Exonic
976600616 4:86934921-86934943 CACCCCCACCTCCCGAGCTGCGG - Intronic
977557272 4:98498640-98498662 CACCCCCAGGCCCTGGGCAGTGG - Intronic
977910116 4:102524516-102524538 CACCCCCAGCCCCCAGTCTGTGG - Intronic
979991515 4:127380264-127380286 CACCCCCTGCTCCACTGCAGGGG + Intergenic
982280205 4:153676502-153676524 CACCTTCGGCTCCCTGGCAGGGG - Intergenic
985670603 5:1204673-1204695 CCCCCCCAGCTCCTCTGCACAGG + Intronic
985748339 5:1660314-1660336 CAGCCCCAGCTCCCGGCCAGTGG - Intergenic
988547785 5:32174274-32174296 CACCCCGAGCTCCAAGGCGGAGG + Exonic
988554137 5:32221819-32221841 CACCACCACCTCCCCAGCAGTGG + Intergenic
989643192 5:43603161-43603183 CAGCCCCAACTCCGCGGCGGCGG - Intronic
991676525 5:69094177-69094199 CACCCGCTGTTCCGCGGCAGCGG + Exonic
996552354 5:124744218-124744240 CACTCCCAGTGCCCCCGCAGTGG + Exonic
996552794 5:124747632-124747654 CTCCCCCCGCCCCCCCGCAGTGG + Intronic
998216684 5:140242961-140242983 GACCCCCAGTTCCCCTCCAGGGG + Intronic
998957242 5:147451316-147451338 CAGCCCCAGCTTCAAGGCAGAGG + Intronic
999002668 5:147940612-147940634 CTCCCCCACCTCCCTGGCAGGGG - Intergenic
1001309927 5:170603314-170603336 CAGCCCCTCCTCCCCGCCAGAGG - Intronic
1002073189 5:176692823-176692845 CACCCCCAGCTCCTGAGCAGGGG + Intergenic
1002575726 5:180172690-180172712 CACGCCCAGCTCCCCAAGAGGGG + Intronic
1002926983 6:1610469-1610491 CAGCCCCAACTCCCTGGGAGTGG + Exonic
1004850245 6:19691729-19691751 CGCCCCCAGCTCCTTGGCAGAGG + Intergenic
1006554390 6:34853023-34853045 CACCCCCAGCCTCCTGGCAGTGG - Intronic
1006818937 6:36874925-36874947 CCACCCCAGCTTCCCGGCATTGG - Exonic
1007390052 6:41545847-41545869 CACCCCCAGCCCCCACGCAGTGG + Intergenic
1009366430 6:62861023-62861045 CACCCCCCTCTCCCCTGCTGCGG - Intergenic
1010233839 6:73558742-73558764 CACCCCCACCTGCCCTCCAGAGG - Intergenic
1013117438 6:107114346-107114368 CGCCTCCAGCTCCTGGGCAGCGG + Exonic
1013276405 6:108589304-108589326 GACTCCCAGCTCCGGGGCAGGGG - Intronic
1015166206 6:130202906-130202928 CCCCCCCTCCTCCCCCGCAGTGG + Intronic
1017016097 6:150100697-150100719 CACCCCCAGCTTCCAGGCCCCGG - Intergenic
1018743433 6:166747148-166747170 CACCCCCAACCCCCAGGAAGAGG - Intronic
1018794052 6:167172201-167172223 CAGCCCCAGCTCCCGGGCACGGG - Exonic
1018822283 6:167382876-167382898 CAGCCCCAGCTCCCGGGCACGGG + Exonic
1019133569 6:169894580-169894602 GACCCCCAGCTCCCGGGGACAGG + Intergenic
1019693530 7:2431675-2431697 CACCCCCTGGTGCCTGGCAGGGG + Intronic
1020023597 7:4883508-4883530 GCGCCCCAGGTCCCCGGCAGCGG + Intronic
1020096186 7:5370853-5370875 CACCCCCAGGTCCAGGGCGGCGG + Exonic
1020265299 7:6556501-6556523 CATCCCCAGCTGCCAGGCTGTGG + Intergenic
1022094449 7:27130226-27130248 CACCCCAGGCGTCCCGGCAGGGG - Exonic
1022936689 7:35185943-35185965 CACCTCCAGCTCCCGGGCGGGGG + Intergenic
1024232124 7:47370737-47370759 CACCAGCAGCTCCCTGGCTGTGG - Intronic
1025004312 7:55343040-55343062 CTCCACCAGCTTCCCTGCAGGGG - Intergenic
1029270575 7:99374762-99374784 CACCTCCCGCGCCCCGGCCGCGG - Exonic
1029470405 7:100750941-100750963 CGCCCCCAGATCCCAGGCATTGG - Intronic
1029832924 7:103280054-103280076 CACCTCCCGCTCCCGGGCGGGGG + Intergenic
1030701591 7:112646999-112647021 CACGCTCAGCTCCCTGGGAGGGG - Intergenic
1030727086 7:112939306-112939328 CAACCTCAGCACCCCGGCTGGGG + Intronic
1032949914 7:136895883-136895905 TATCCCAAGCTCCCAGGCAGAGG - Intronic
1034469551 7:151248125-151248147 CACCCCCACCCCCAGGGCAGGGG + Intronic
1035607426 8:939049-939071 CACCTCCCACTCCCAGGCAGGGG - Intergenic
1037787435 8:21911236-21911258 CACCCCCAGGGCCCCGGCAGTGG - Intronic
1037891953 8:22628251-22628273 CGCCCCCAGCCTCCCTGCAGGGG - Intronic
1037901558 8:22692167-22692189 CTTCCCCAGCTCCCCGGCCCCGG + Intronic
1038583760 8:28771702-28771724 CACACCCTGCTCCTCGGCAAGGG - Intronic
1040495570 8:47962096-47962118 CACTCCCAGCTCTCGGGTAGAGG + Exonic
1042556075 8:70034767-70034789 CACCTTCCGCACCCCGGCAGAGG - Intergenic
1042704374 8:71650853-71650875 GCTCCCCAGCTCCCCAGCAGAGG - Intergenic
1044594369 8:93943589-93943611 CACCCCCAGCTCCGGAGCAATGG + Intergenic
1045063404 8:98426750-98426772 CACCCCCAGGGCGCAGGCAGGGG - Intronic
1045887620 8:107118041-107118063 CATCCCCACTTCCCCAGCAGAGG + Intergenic
1047219871 8:122910728-122910750 CACCCCCCACCCCCCAGCAGGGG - Intronic
1048095157 8:131283994-131284016 CTACCTCAGCTCCCTGGCAGAGG - Intergenic
1049344353 8:142130498-142130520 CCCCCCCAGGTCTCCAGCAGTGG + Intergenic
1049625376 8:143617487-143617509 CACCGCCGGCTCCCCGACAGCGG + Exonic
1051418933 9:16871296-16871318 CGCCCGCAGCTCCCCGGGGGGGG - Intergenic
1051654377 9:19364569-19364591 CAGCCCCAGCTCCAGAGCAGTGG + Intronic
1053482227 9:38424202-38424224 CGCCCTCGGCTCCCAGGCAGCGG + Exonic
1055987193 9:82063610-82063632 CACCCCCAGCTCCACACCATGGG - Intergenic
1056475096 9:86945884-86945906 CACCCACCGCGCCCGGGCAGCGG - Exonic
1056583711 9:87914572-87914594 CACCCCCAGCTCCACACCATGGG + Intergenic
1056584203 9:87918041-87918063 CACCCCCAGCTCCACACCATGGG + Intergenic
1056612666 9:88134884-88134906 CACCCCCAGCTCCACACCATGGG - Intergenic
1056613163 9:88138374-88138396 CACCCCCAGCTCCACACCATGGG - Intergenic
1056830307 9:89911823-89911845 CACCCTCAGCTCCCCTGCCATGG - Intergenic
1057059892 9:91994301-91994323 CACACCCAGCTCCCAGGCGCTGG + Intergenic
1057159981 9:92882651-92882673 CACCCCCAGCTCCACACCATGGG + Intergenic
1057231989 9:93326821-93326843 CGCACCCAGCTCCCCGGCTCTGG - Intronic
1057263493 9:93599128-93599150 CTTCCCCATCTCCCTGGCAGAGG - Intronic
1057523979 9:95783671-95783693 CGCCCCCACCTCCCCGTCACAGG - Intergenic
1057826771 9:98377761-98377783 CACCCCCAACTCCCTTCCAGAGG - Intronic
1059329491 9:113525874-113525896 CACCCCCAGCTCCCGAACTGAGG - Intronic
1059365859 9:113786002-113786024 CACCCACAGTTCCCATGCAGGGG + Intergenic
1060137340 9:121170108-121170130 CACCCCCTCCTCCCTGCCAGTGG - Intronic
1060268763 9:122127113-122127135 CACCCCCATCTGCCGGGCTGGGG - Intergenic
1060397241 9:123324852-123324874 CACCCCCAGCTTGCCCTCAGAGG - Intergenic
1060748115 9:126151038-126151060 CACTCCCACCTCCCCAGGAGAGG - Intergenic
1060838693 9:126777690-126777712 CTCCCCCAGCTCCCAGGAGGGGG - Intergenic
1061293029 9:129663133-129663155 AAGCCCCAGCTCCCTGACAGTGG - Intergenic
1061309527 9:129753120-129753142 CACGCCCCGCCCCACGGCAGCGG + Intergenic
1061765517 9:132878784-132878806 CCCTCCCAGCTCCCCGGCTCTGG + Intronic
1062017091 9:134296446-134296468 CACCCCCAGCTCCCCCTCCCAGG - Intergenic
1062270086 9:135704348-135704370 AACCCCCAGCTCCACGCTAGTGG + Intronic
1062332423 9:136050649-136050671 CACCCCCTCCTCCCCCGCCGGGG + Intronic
1062498556 9:136842823-136842845 CACCCCCATCCCCACGGGAGGGG + Intronic
1187670223 X:21658914-21658936 AATCCCAAGCTCCCCGCCAGCGG + Intergenic
1188256875 X:27973534-27973556 CACCCCCTACTCCCAGGGAGAGG + Intergenic
1189166555 X:38866625-38866647 AACCCCCAGGCCCCAGGCAGAGG - Intergenic
1189709556 X:43795520-43795542 CACCCCCAGCCTCCAGGGAGGGG - Intronic
1190261919 X:48802654-48802676 CACCCCCAGAACCGCGGCAGGGG + Exonic
1191253445 X:58269921-58269943 CACCCCCAGGTGCCATGCAGGGG + Intergenic
1191880553 X:65840579-65840601 CCCTCCCAACTCCCCAGCAGTGG + Intergenic
1192181469 X:68918370-68918392 CACCCCCTGCTGGCAGGCAGGGG + Intergenic
1192541060 X:71973545-71973567 CACCCCCAGCTCCAGGGCAGTGG - Intergenic
1195081621 X:101376725-101376747 CACCCCCACCCCCCCACCAGAGG - Intronic
1196896437 X:120341408-120341430 CACCCCCAGCTCCAGGGCCATGG - Intergenic
1197590440 X:128402765-128402787 CACCCCCTGCCCTCCAGCAGTGG - Intergenic
1199760220 X:150899014-150899036 CGCCTCCCGCTCCCCGGCACTGG - Intergenic
1199950901 X:152705375-152705397 CACCCCCACCGCCCCCTCAGAGG + Intergenic
1199953203 X:152721947-152721969 CACCCCCCGCCCCCCCGCAGAGG + Intergenic
1199956479 X:152746499-152746521 CACCCCCCGCCCCCCCGCAGAGG - Intergenic
1199958781 X:152763086-152763108 CACCCCCACCGCCCCCTCAGAGG - Intergenic
1200040505 X:153362632-153362654 CACCCACAGATCCCCAGAAGTGG + Intergenic
1200155160 X:153971253-153971275 CACCCCCAAGTCCCCAGCACTGG + Exonic
1200234019 X:154459643-154459665 CACCACCATGTCCCCTGCAGGGG - Intronic
1202044754 Y:20727073-20727095 CACCCCAGGCTCCCCGGCTCCGG + Intergenic