ID: 968729207

View in Genome Browser
Species Human (GRCh38)
Location 4:2261785-2261807
Sequence GCCTCGGTGCTGCCCTTCGA CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968729207_968729213 13 Left 968729207 4:2261785-2261807 CCGTCGAAGGGCAGCACCGAGGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 968729213 4:2261821-2261843 GCCTCTGCGGACACACGGCGCGG 0: 1
1: 0
2: 0
3: 7
4: 85
968729207_968729208 -9 Left 968729207 4:2261785-2261807 CCGTCGAAGGGCAGCACCGAGGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 968729208 4:2261799-2261821 CACCGAGGCGTAGCCGTGCTCGG 0: 1
1: 0
2: 0
3: 1
4: 41
968729207_968729210 0 Left 968729207 4:2261785-2261807 CCGTCGAAGGGCAGCACCGAGGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 968729210 4:2261808-2261830 GTAGCCGTGCTCGGCCTCTGCGG 0: 1
1: 0
2: 0
3: 7
4: 112
968729207_968729215 20 Left 968729207 4:2261785-2261807 CCGTCGAAGGGCAGCACCGAGGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 968729215 4:2261828-2261850 CGGACACACGGCGCGGTCAGCGG 0: 1
1: 0
2: 0
3: 3
4: 32
968729207_968729212 8 Left 968729207 4:2261785-2261807 CCGTCGAAGGGCAGCACCGAGGC 0: 1
1: 0
2: 0
3: 4
4: 76
Right 968729212 4:2261816-2261838 GCTCGGCCTCTGCGGACACACGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968729207 Original CRISPR GCCTCGGTGCTGCCCTTCGA CGG (reversed) Exonic