ID: 968732063

View in Genome Browser
Species Human (GRCh38)
Location 4:2273870-2273892
Sequence CCACACAGGCAGGAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 766
Summary {0: 1, 1: 0, 2: 6, 3: 87, 4: 672}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968732063_968732078 23 Left 968732063 4:2273870-2273892 CCCTCCTCCTCCTGCCTGTGTGG 0: 1
1: 0
2: 6
3: 87
4: 672
Right 968732078 4:2273916-2273938 ACAGGAGTGCTGGCTCCTTAGGG 0: 1
1: 0
2: 0
3: 9
4: 159
968732063_968732079 24 Left 968732063 4:2273870-2273892 CCCTCCTCCTCCTGCCTGTGTGG 0: 1
1: 0
2: 6
3: 87
4: 672
Right 968732079 4:2273917-2273939 CAGGAGTGCTGGCTCCTTAGGGG 0: 1
1: 0
2: 0
3: 17
4: 211
968732063_968732075 13 Left 968732063 4:2273870-2273892 CCCTCCTCCTCCTGCCTGTGTGG 0: 1
1: 0
2: 6
3: 87
4: 672
Right 968732075 4:2273906-2273928 TTCTCCATGAACAGGAGTGCTGG 0: 1
1: 0
2: 1
3: 16
4: 149
968732063_968732072 5 Left 968732063 4:2273870-2273892 CCCTCCTCCTCCTGCCTGTGTGG 0: 1
1: 0
2: 6
3: 87
4: 672
Right 968732072 4:2273898-2273920 GTCCAGCCTTCTCCATGAACAGG 0: 1
1: 0
2: 0
3: 10
4: 184
968732063_968732077 22 Left 968732063 4:2273870-2273892 CCCTCCTCCTCCTGCCTGTGTGG 0: 1
1: 0
2: 6
3: 87
4: 672
Right 968732077 4:2273915-2273937 AACAGGAGTGCTGGCTCCTTAGG 0: 1
1: 0
2: 0
3: 12
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968732063 Original CRISPR CCACACAGGCAGGAGGAGGA GGG (reversed) Intronic
900296627 1:1955153-1955175 GAAGACAGACAGGAGGAGGACGG + Intronic
900311957 1:2037777-2037799 ACACAGAGGCAGGGGGAAGAGGG + Intergenic
900313112 1:2043909-2043931 CAACACAGTGAGGAGGAGGTGGG - Intergenic
900365275 1:2309671-2309693 ACCCACAGGGAGGAGGAGGTGGG - Exonic
900394305 1:2446868-2446890 CTGCAGGGGCAGGAGGAGGAAGG - Intronic
900496580 1:2978603-2978625 GCACACGGACAGGAGGGGGACGG + Intergenic
900574241 1:3375136-3375158 CCACACTGTCACGATGAGGATGG + Intronic
900902736 1:5527824-5527846 CCACACAGGCAGGTGGGGGCAGG + Intergenic
900950854 1:5857677-5857699 CAACAGGGGCAGGAGGAGGGAGG + Intergenic
901047407 1:6405549-6405571 CCACACAGCTAGGAGGTGCATGG - Intergenic
901265433 1:7906763-7906785 GAACACGGGCAGTAGGAGGAAGG + Intergenic
901269738 1:7942528-7942550 GCAGACGGGAAGGAGGAGGAAGG + Intronic
901700784 1:11043934-11043956 ACACACAGGAAGGAGGAAGAAGG + Intronic
901886654 1:12228308-12228330 CTCCACAGACAGAAGGAGGAAGG - Intergenic
902043745 1:13510642-13510664 GCACAAATGCAGGAGGAGGAGGG + Intronic
902206096 1:14869173-14869195 CAAGACAGGCAGGAAGGGGATGG - Intronic
902598663 1:17526181-17526203 CCACACAGGGAGGAAGGAGAGGG - Intergenic
902656857 1:17875047-17875069 CCCCACAGCCAGCAGGAGGAAGG - Intergenic
903192739 1:21666026-21666048 CCACACAGCCAGCAAGAGGCAGG + Intronic
903335663 1:22622623-22622645 CCACACAGCCAGGAAGGGGCAGG + Intergenic
903476236 1:23620800-23620822 CTGCGGAGGCAGGAGGAGGAAGG - Intronic
904208099 1:28867998-28868020 CCAGAGAAGCAGGAGGAGGATGG + Intergenic
904533747 1:31185579-31185601 TCACACAGCTAGGAGGAGGTAGG + Intronic
904901339 1:33859663-33859685 CCACAGAGGAAGGGGCAGGAGGG + Intronic
904936601 1:34134098-34134120 CCAAACAGGCAGAAATAGGAGGG + Intronic
904943006 1:34177840-34177862 CCAGAAAGAGAGGAGGAGGATGG + Exonic
904982904 1:34521852-34521874 TCACAGAGGTAGGAGGAGGGAGG + Intergenic
905105840 1:35563198-35563220 CCAGCCAGGCAGGAGGAGCCTGG - Exonic
905110424 1:35590523-35590545 CTACACAGGCAGGATGGGGCAGG + Intronic
905259364 1:36706610-36706632 CCACCCACGCAGGAGGAAGTTGG + Intergenic
905449447 1:38047117-38047139 CCACACAGCCAGGACGAGAGGGG - Intergenic
905518637 1:38580543-38580565 CCCAGCAGACAGGAGGAGGATGG - Intergenic
906550199 1:46659327-46659349 CCACAGTGGCAGGTGGAGAATGG - Intronic
907406806 1:54258723-54258745 CAACAGAGGCAAGAGGAGCAAGG + Intronic
907422615 1:54357362-54357384 TCAGGCAGGCAGGAGAAGGAAGG + Intronic
907455942 1:54575518-54575540 CCACACAGGCAGGGAGAATATGG - Intronic
907908682 1:58808423-58808445 CCAAAGAGGCAGGGGAAGGAGGG + Intergenic
907910844 1:58824785-58824807 CCAAACAGGAAAGAGGAGGAAGG + Intergenic
908111562 1:60903624-60903646 CCTCACAGCCTGGAAGAGGAGGG - Intronic
908363043 1:63388893-63388915 CCACACAGGCCAGAAGAGAATGG - Intronic
908667622 1:66510273-66510295 ACACACACGCAGGAGGGGCAAGG - Intergenic
908670527 1:66542599-66542621 CCAGACAGGATGGAGTAGGATGG + Intronic
908992294 1:70106805-70106827 CCACACAGGTAAGGGGAAGAAGG - Intronic
909021609 1:70437539-70437561 CCACATAGGCAGTATGTGGAAGG + Intronic
909482879 1:76144214-76144236 CCACAATGGAAGGAGGAGAAAGG + Intronic
910433545 1:87182027-87182049 ACACACAGACATGAGCAGGATGG - Intergenic
911055975 1:93708846-93708868 GGACACAGGCAGGAGGAGGTTGG + Intronic
912467463 1:109883823-109883845 CCCCAGAGGCTGAAGGAGGAAGG + Intergenic
912538414 1:110394055-110394077 CAACAAAGGCAAAAGGAGGATGG - Intergenic
912649014 1:111421782-111421804 CCCCACAGGCAGAAGGAGCAGGG - Intronic
912778492 1:112522573-112522595 CTGCACAGGCAGCAGGAGGTTGG + Exonic
913441701 1:118905390-118905412 CCACACAGCCAAGAGGACAATGG + Intronic
914343196 1:146777182-146777204 GGACCCAGGCAGGGGGAGGAAGG - Intergenic
914402263 1:147333167-147333189 CCACACAAGCAGGAAGAGAATGG + Intergenic
914901801 1:151715097-151715119 CACCATAGGCAGGTGGAGGACGG + Intronic
915584328 1:156836074-156836096 ACAGACACGCAGGAGGAGAAAGG - Intronic
915597496 1:156903946-156903968 GCCCACAGCCAGGAGAAGGAGGG - Exonic
915826813 1:159086718-159086740 CCACACAGGTTGGTGGAGCAGGG - Intronic
916190086 1:162169941-162169963 CCATACAGGCAGGAAAGGGAGGG - Intronic
916548376 1:165827799-165827821 TCGCACAGGCAGCGGGAGGAGGG + Exonic
918520479 1:185409523-185409545 CCACACCTGCCGGTGGAGGAGGG - Intergenic
918784118 1:188742840-188742862 CCACAAATGCAAGAGGAAGAGGG + Intergenic
919618379 1:199835470-199835492 CCACTCAGGCAGGGGAAGGGGGG - Intergenic
919755389 1:201062966-201062988 CCCCACTGGCAGGAGGATGGAGG - Intronic
919833290 1:201556803-201556825 CCACACAGGCATTTGGAGGATGG - Intergenic
920211664 1:204332996-204333018 CCACCTAGGGAGGAGGAGGCAGG + Intronic
920369819 1:205471657-205471679 CCACACAGGTAGGAGTGGCATGG + Intergenic
920530025 1:206695070-206695092 GCTCACAGAGAGGAGGAGGAAGG + Intronic
921164836 1:212499552-212499574 CCACACAGACACCGGGAGGAAGG + Intergenic
921889434 1:220339079-220339101 CAAACCAGGAAGGAGGAGGATGG - Intergenic
922792459 1:228317788-228317810 CCCCACAAGCTGGAGGAGGGAGG + Intronic
922803364 1:228373915-228373937 CCAGACCTGCAGGAGGAAGAGGG - Exonic
923101510 1:230821386-230821408 TCACACAGGAAGCAGGAGAAAGG - Intergenic
923310058 1:232726489-232726511 TCCCTCAGGCAAGAGGAGGAAGG + Intergenic
923499197 1:234550559-234550581 ACAGCCAGGCAGGAGGAGGGCGG + Intergenic
923779953 1:237013250-237013272 CCACAAAGGCAAGAGCAGCAGGG - Intergenic
923828215 1:237523695-237523717 CCACCCAGGCAGGAGGACAGTGG - Intronic
1062826059 10:569763-569785 CCACAAAGGCAGGGGTAGGGAGG + Intronic
1063082457 10:2781697-2781719 CAACACAGACAGCAGGAAGATGG + Intergenic
1063428023 10:5964932-5964954 TCACACAGGCAGCAGAGGGAAGG - Intronic
1063711057 10:8479012-8479034 CCACAGTGGGAGGAGGAGGGGGG + Intergenic
1064332034 10:14403014-14403036 CCAAAGAGTCAAGAGGAGGATGG - Intronic
1064359403 10:14650051-14650073 CCAGATAGGAAGAAGGAGGAAGG + Intronic
1064864271 10:19861396-19861418 CCAATCAGGCAAGAAGAGGAAGG - Intronic
1065046792 10:21752810-21752832 CCCCACGGGCAGGAGATGGAAGG + Intergenic
1065841549 10:29705428-29705450 CCATACAGAAAGGAGGCGGAGGG + Intronic
1065973269 10:30821963-30821985 CCACAGGGGAAGGAGGAAGAGGG + Intronic
1066349527 10:34624648-34624670 CCCTACAGACAGGAGGATGATGG + Intronic
1066496866 10:35950477-35950499 ACACACAGGACGGAGGAGGGGGG + Intergenic
1066499300 10:35974483-35974505 TCTCACAGGGAGGAAGAGGAAGG - Intergenic
1066512067 10:36111715-36111737 CCACACAGACAGGCAGAGAAAGG - Intergenic
1067143913 10:43679846-43679868 CCAAACAGGCATGAGGAGAAAGG - Intergenic
1067764048 10:49071815-49071837 CCACACATGCAGGAGGGGTTGGG + Intronic
1067828571 10:49597028-49597050 CCACAGCAGCAGGAGCAGGAGGG - Intergenic
1067838082 10:49653906-49653928 GCCCACAGGCAGGAGGAGGAGGG - Intronic
1067921711 10:50465040-50465062 CCACAGAGGAGTGAGGAGGAAGG - Intronic
1068783444 10:60944766-60944788 CCGCCCAGGGAGGAGGAGGCTGG - Intronic
1069383301 10:67862138-67862160 CCACAAGGTCAGGGGGAGGAGGG - Intergenic
1069800122 10:71076780-71076802 GCACACAGGGAGGAGGAGCCAGG + Intergenic
1069815640 10:71191970-71191992 CCAGAGAGGCAGGAGGAGAGGGG + Intergenic
1069865755 10:71501827-71501849 CCGGCCAGCCAGGAGGAGGAGGG + Intronic
1069951918 10:72024915-72024937 ACAGACAGGAAAGAGGAGGATGG + Intergenic
1070730942 10:78827964-78827986 CATCACAGGCTGGAGGTGGAGGG - Intergenic
1070805269 10:79267065-79267087 CCACACACTCCAGAGGAGGAAGG + Intronic
1070809661 10:79291217-79291239 CCCCACTGGAAGGAGGAAGAGGG - Intronic
1070945680 10:80389756-80389778 TTACACAGGCAGGAGATGGAGGG + Intergenic
1071175638 10:82923783-82923805 ACACACAGGTAGAAGGAGGAGGG - Intronic
1071293285 10:84202255-84202277 GCACACAGAGAGGAGGAGGTGGG - Intronic
1071500107 10:86197360-86197382 GCAGACAGGGAGCAGGAGGAGGG + Intronic
1071515633 10:86294911-86294933 CCACAGAGCCAGGAGGAGGGAGG + Intronic
1071876744 10:89850959-89850981 CCACAGAAGCAGGTGGAGCAGGG + Intergenic
1072758698 10:98038418-98038440 GGGCACAGGCAGCAGGAGGAGGG + Intergenic
1072821297 10:98560378-98560400 ACAAACAGGCAGGTGGAGGAAGG + Intronic
1073096800 10:100984821-100984843 CCACACAGGAAGGGAGAGGAGGG - Exonic
1073142577 10:101258590-101258612 CATCACTGGCAGCAGGAGGATGG + Intergenic
1073208688 10:101781862-101781884 ACACACAAGCAGTAGAAGGATGG + Intronic
1073915138 10:108394206-108394228 GCACAGGGGCAGGAGGAGTATGG + Intergenic
1074550105 10:114434850-114434872 CCACAGAGGAAGGATGAGGTGGG - Intronic
1075378328 10:121997546-121997568 CCACTCAGACAGGAGGGAGATGG + Intronic
1075673496 10:124280404-124280426 CCACACAGCCAGGAAGGGCAGGG + Intergenic
1075702271 10:124477419-124477441 CCCCAGAGGCAGGAGCAGGCTGG + Intronic
1075761662 10:124862212-124862234 CCACACTGGGAGCAGGAGCAGGG + Intergenic
1076175194 10:128362911-128362933 CCACACAGGCAGGAGATGATGGG + Intergenic
1076210678 10:128642220-128642242 ATTCACAGGCTGGAGGAGGATGG + Intergenic
1076228487 10:128800129-128800151 TGACAAAGGCAGCAGGAGGAAGG + Intergenic
1076358265 10:129868623-129868645 GCACACAGACAGCAGAAGGAGGG + Intronic
1076631880 10:131856513-131856535 CCTCACAGGCTGGAGCAGGAGGG + Intergenic
1076632472 10:131859212-131859234 CCACATGGCCAGGAGGAGGGTGG + Intergenic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077119498 11:900284-900306 CCTCACAGGCTGGAGAGGGAGGG + Intronic
1077286451 11:1768082-1768104 CCACACAGCCAGGAGGGAGCCGG - Intergenic
1078195818 11:9135852-9135874 CCACACATGGTGGAAGAGGAAGG - Intronic
1078545276 11:12242490-12242512 CCACCCGGGTAGGAGGAGGGAGG - Intronic
1078667861 11:13341094-13341116 CCAGACAGGCAGGACAAGGTGGG - Intronic
1079008780 11:16811546-16811568 CCCCACAGGCTGCAGGAGGATGG + Intronic
1079087251 11:17455304-17455326 ACACACAGGCTGGAGAATGAGGG + Intronic
1080195747 11:29606712-29606734 CTACCCAGGCACAAGGAGGAGGG - Intergenic
1081659907 11:44881723-44881745 GCACACAGGTAGGAGGTGGTTGG + Intronic
1081790471 11:45779744-45779766 CCACACGGGGAGCAGCAGGAGGG - Intergenic
1082830941 11:57616714-57616736 CAACAAAGTCAGGAGGTGGAAGG + Intergenic
1082854127 11:57791407-57791429 TCACAGAGGAAGGAGAAGGAGGG - Exonic
1084001959 11:66300703-66300725 CTGCACAGCCAGGAAGAGGAGGG + Intergenic
1084370079 11:68735439-68735461 CTACAGAGTCAGGAGGAGGCCGG + Intronic
1084477597 11:69397822-69397844 GCCCCCAGTCAGGAGGAGGAGGG + Intergenic
1084519259 11:69653576-69653598 CCACACAGGCTGGCGGGGGCCGG + Exonic
1084566357 11:69931115-69931137 ACACCCAGGGAGGAGGAGGAGGG - Intergenic
1084953932 11:72681384-72681406 GCAGACGGGCAGGGGGAGGAGGG + Intergenic
1085256609 11:75177116-75177138 CACCATAGGGAGGAGGAGGAGGG + Intronic
1085796015 11:79540699-79540721 CCACACAGGCAGCATGGGAATGG - Intergenic
1086065375 11:82738150-82738172 TCACTCAGGGAGTAGGAGGAGGG - Intergenic
1086741997 11:90379936-90379958 CCAAACAGTCTGGATGAGGAAGG - Intergenic
1087094294 11:94305316-94305338 CATCACAGGAATGAGGAGGAGGG - Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088560875 11:111114973-111114995 CCACACAGGTAGTAGAAGGGAGG - Intergenic
1088577982 11:111290091-111290113 TCACCCAGGCTGGAGGAGGGTGG + Intergenic
1088653682 11:111979042-111979064 CCAAACAGGCAGGAGGGGTAGGG - Intronic
1088737011 11:112736113-112736135 CAAGGCAGGCAGGAGCAGGAGGG + Intergenic
1088746382 11:112808185-112808207 CCACTAAAACAGGAGGAGGAAGG - Intergenic
1089162013 11:116445606-116445628 CCAGACAGGCTGGAGGGGAAGGG - Intergenic
1089376127 11:117996106-117996128 CCACACAGCCAGGAAGAGTCAGG + Intronic
1089610647 11:119666786-119666808 CCACACACGCCCCAGGAGGAGGG - Intronic
1089738448 11:120565129-120565151 CCCCACAGGCAGGATGACGCGGG - Intronic
1089784134 11:120895889-120895911 CCATGCAGAGAGGAGGAGGAAGG + Intronic
1089794220 11:120967340-120967362 CCTCTAGGGCAGGAGGAGGATGG - Intronic
1090495534 11:127207781-127207803 CCACACAAGCTGGAAGAGAATGG + Intergenic
1091296675 11:134478566-134478588 ATACACAGGCAGAAGGAAGAAGG - Intergenic
1091538133 12:1432969-1432991 CCGCACAGCCAGGAGGATGCAGG - Intronic
1091581585 12:1793688-1793710 ACACACAGGCAGCAGGAGTAGGG + Exonic
1091776336 12:3187367-3187389 GCACAAAGGCAGGCAGAGGAAGG - Intronic
1091793552 12:3284843-3284865 TCAGACAGGCAGGTGGAGGCTGG - Exonic
1091815396 12:3434039-3434061 CCCCATAGGCGGGAGCAGGAAGG + Intronic
1091823272 12:3491821-3491843 ACACACACACAGGAGGAGGCCGG - Intronic
1091991748 12:4961167-4961189 CCAGACAGGCAGCAGGAGCATGG + Intergenic
1092132783 12:6124244-6124266 CCTCAGAGGCAAGTGGAGGAGGG + Intronic
1092818512 12:12331703-12331725 TCTGACAGGGAGGAGGAGGAGGG + Intronic
1094478754 12:30863341-30863363 TCACACAGTCAGGATGGGGAGGG + Intergenic
1094498496 12:31004016-31004038 GCAGACAGGCAGGTGGAGGCTGG + Intergenic
1095361404 12:41345325-41345347 ACACACCGACAGGAGGGGGAGGG - Intronic
1095957138 12:47813390-47813412 CCAGAATGGCAGGAGGAGCAGGG - Intronic
1096072467 12:48782891-48782913 CCACATAGGCAGGCTGAGGGCGG + Exonic
1096454006 12:51770409-51770431 CCACACAGCCAGGAGGACAGTGG - Intronic
1096546796 12:52345657-52345679 TCTCACAGGCAGGAGGAAGAGGG + Intergenic
1096805911 12:54141029-54141051 CCACAGAGGCCAGAGCAGGAGGG + Intergenic
1097181543 12:57174771-57174793 ACAAACAGGCAAGGGGAGGAGGG + Intronic
1099304538 12:80937531-80937553 GCGCTCAGGCAGGAGGAGAAGGG - Intronic
1100390527 12:94142792-94142814 TCCCACAGGCCTGAGGAGGAGGG + Intergenic
1101436674 12:104670143-104670165 CCTCACAGGGAGAGGGAGGAAGG + Intronic
1101606131 12:106248345-106248367 CCACGCAGGCTGGGGGCGGAGGG + Intronic
1101814592 12:108136220-108136242 CCACATAGACAGTAGGAGGCAGG + Intronic
1101998969 12:109544910-109544932 CTTCACAGGCAGGAGGAAGTGGG - Intergenic
1102050613 12:109858962-109858984 CCACAGAGGCATGATGAAGATGG + Intronic
1102052798 12:109875289-109875311 CCAAACAGGCAAAAGGAGGGAGG + Intronic
1102226117 12:111229465-111229487 TCACACAGCCAGGAGAAAGATGG + Intronic
1102465629 12:113129461-113129483 GCACACAGTGAGCAGGAGGAAGG + Intronic
1102522431 12:113486920-113486942 CCACAGAGGCAGCAGGTGTAGGG - Intergenic
1102863470 12:116356260-116356282 CCAATCAGACAGGAAGAGGAAGG - Intergenic
1103000313 12:117380672-117380694 CCACACAGCCACTAAGAGGATGG + Intronic
1103716375 12:122947637-122947659 CCATTCAGGAAGCAGGAGGAGGG + Intronic
1103764214 12:123270138-123270160 CCCCACAGGCCAGAGGAAGAAGG + Intronic
1103834246 12:123806385-123806407 CCACACAGCCAGTAAGAGAAAGG + Intronic
1103922784 12:124407835-124407857 CTACACTGCCAGGAGGTGGAAGG - Intronic
1103932762 12:124459329-124459351 CCAGAGAGACAGGAGGAGGTGGG - Intronic
1103984895 12:124760639-124760661 CCACACAGGCAGGAAGGTCAGGG + Intergenic
1104732657 12:131116570-131116592 CTCCAGAGGAAGGAGGAGGAGGG - Intronic
1104898435 12:132175495-132175517 ACACACAGGCCAGAGCAGGAGGG - Intergenic
1105217157 13:18294634-18294656 CCACAGAGGAAACAGGAGGAGGG + Intergenic
1105249605 13:18685985-18686007 CCACACAATGAGGAGGAGGTGGG + Intergenic
1105566441 13:21553421-21553443 GCAGTCAGGCAGGAGAAGGAAGG - Intronic
1106160190 13:27194531-27194553 CCAAGCAGTGAGGAGGAGGAAGG + Intergenic
1106665575 13:31847157-31847179 ACATGGAGGCAGGAGGAGGACGG - Intergenic
1107657445 13:42606043-42606065 CCACACAGACAGGAGCAGAAAGG - Intronic
1108485492 13:50919466-50919488 CCACACAGCCAGGGGGCAGAAGG - Intronic
1108557999 13:51614588-51614610 CCAGGCAGGAAGGAGGAGAAGGG + Intronic
1108729038 13:53213823-53213845 CGTCATAGGCAGAAGGAGGAAGG - Intergenic
1109301253 13:60592437-60592459 ACACACAGACACGAAGAGGAAGG - Intergenic
1109470508 13:62798878-62798900 CCACAGAGCCAGGAGGAGCCAGG + Intergenic
1110615274 13:77534757-77534779 CCACTCTGGCAGGAGGAGGCAGG - Intergenic
1112117689 13:96374966-96374988 CCACACAGGCCCTAGGAGGTTGG + Intronic
1112883295 13:104135804-104135826 CCACACAAGCAGGAAGCAGAAGG - Intergenic
1113098738 13:106694566-106694588 CTGCACAGGCAGAAGAAGGAAGG - Intergenic
1113709661 13:112455040-112455062 CCACTGAGGCAGGGGGAGCAGGG + Intergenic
1113803810 13:113101807-113101829 GAGCAGAGGCAGGAGGAGGAGGG + Intergenic
1113885299 13:113655678-113655700 AGACACCGGCAGGAAGAGGACGG + Intronic
1114755884 14:25259486-25259508 CCAAACTGGAAGGAGCAGGAAGG + Intergenic
1115713209 14:36073124-36073146 ACACCCAAGCAGGATGAGGAAGG - Intergenic
1117951660 14:61089331-61089353 CCACAGGAGGAGGAGGAGGAGGG - Intergenic
1118324096 14:64769804-64769826 TCCCACAGGCAGGGGGAGGTGGG - Intronic
1118736562 14:68705395-68705417 ACAGAGAGGCAGGTGGAGGAAGG + Intronic
1118848282 14:69564851-69564873 CCACACAGGAATAAGGAAGAGGG - Intergenic
1119323209 14:73743635-73743657 CCTCACAGTGAGGAAGAGGAAGG + Intronic
1119474658 14:74920141-74920163 CCAGCCAGGAAGGAGGAGGAAGG + Intronic
1119555952 14:75552705-75552727 CCAGACAGAAAGGAGGAGAAAGG - Intergenic
1119806436 14:77485299-77485321 CCTCACAGGCCAGAGGAGAAAGG + Intronic
1121592509 14:95127092-95127114 ACACACAGGGAGGATGACGAAGG + Intronic
1121599868 14:95195404-95195426 AAACAGAGGCAGGGGGAGGAGGG - Intronic
1121693519 14:95894446-95894468 CCACACTAGCAGGAGGAGGGCGG + Intergenic
1121825790 14:97008467-97008489 ACACACAGGCAGGAGGATGAGGG - Intergenic
1122866931 14:104610465-104610487 CCACACATGCAAGAGAAAGAGGG - Intergenic
1123072998 14:105651268-105651290 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1123092922 14:105750037-105750059 CCTCCCAGGCTGGGGGAGGACGG + Intergenic
1202854737 14_GL000225v1_random:43344-43366 CCACACTGGCACGTGGGGGACGG + Intergenic
1124149008 15:27160062-27160084 CCACCCAGGAAAGAGCAGGAGGG - Intronic
1124232259 15:27955788-27955810 CCACCCCGGCAGGAGCAGCATGG - Intronic
1125234533 15:37497667-37497689 CCCCAGAGGAAGGAGGGGGAAGG + Intergenic
1125609525 15:40961071-40961093 CTCCACAGGCAGCAAGAGGAAGG - Intergenic
1126145012 15:45465903-45465925 CAAAACAGGCAGAAGAAGGAGGG + Intergenic
1126443627 15:48718400-48718422 GGACACGGGCAGGAGAAGGAAGG + Intronic
1127476481 15:59338673-59338695 TCCCACAGGCAGGAGGAGCAAGG + Intronic
1128066939 15:64770958-64770980 CCACACTGGGATGAGGTGGAAGG + Intronic
1128221816 15:65974686-65974708 CCACACCTCCAGGAGGAAGAAGG - Intronic
1128444576 15:67746840-67746862 ACACTCAGGCAGTAGGAAGAAGG + Intronic
1128523439 15:68390626-68390648 CCACAGAGGCAGGAAGAGCCTGG + Intronic
1129032521 15:72629303-72629325 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129079062 15:73023613-73023635 TCATACAGGAAGGAGGAGAAGGG - Intergenic
1129407291 15:75328051-75328073 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129460080 15:75696184-75696206 CCCCACAGTCAGGAGGGGGAAGG - Intronic
1129470477 15:75750914-75750936 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1129642250 15:77392912-77392934 CCACACAGGATGGGGGAGGGAGG - Intronic
1129734526 15:77952224-77952246 CCTCACAGGCAGAAAGAGGGAGG + Intergenic
1129841064 15:78743767-78743789 CCTCACAGGCAGAAAGAGGGAGG - Intergenic
1130196993 15:81789116-81789138 CAAAACAGGCAGGAAGAGAAAGG + Intergenic
1130828373 15:87573073-87573095 CCACCCACGCAGGACCAGGAGGG + Intergenic
1130934636 15:88458589-88458611 GCACACATGCAGGAGGAAAAAGG + Intergenic
1131667417 15:94585231-94585253 AGACAAAGGCAGGAGGAGAAAGG - Intergenic
1132083711 15:98888969-98888991 CCAGCCAGCAAGGAGGAGGATGG + Intronic
1132464186 16:70167-70189 CCACACAGTCAGAAAGGGGATGG + Intronic
1132746006 16:1436588-1436610 CCACACAGGGAGAGGGAGGAGGG + Intronic
1132951761 16:2566794-2566816 CAACACAGGCAGGAGGAGCCAGG - Intronic
1132962589 16:2633376-2633398 CAACACAGGCAGGAGGAGCCAGG + Intergenic
1133120887 16:3606654-3606676 TCAAACAGGAAGGAGGAGGCTGG + Exonic
1133294316 16:4743469-4743491 TCCCCCAGGAAGGAGGAGGAGGG - Intronic
1133625426 16:7566508-7566530 TCACACAGCCAGGAGATGGAAGG - Intronic
1133907295 16:10033921-10033943 CCAAGAAGGCAGGAGAAGGAAGG - Intronic
1134043233 16:11083764-11083786 CGCCACAGGCAGCAGGAGGCTGG - Intronic
1134792043 16:16997820-16997842 CCACAGAGGCAAGATAAGGAAGG - Intergenic
1135024621 16:18989554-18989576 CCACCCTTGGAGGAGGAGGAAGG + Intronic
1135296547 16:21283993-21284015 GGACGCAGGCAGAAGGAGGAAGG - Intronic
1136549123 16:30972942-30972964 GCACATCTGCAGGAGGAGGAAGG + Intronic
1136608621 16:31352978-31353000 ACAGAGAGGCAGGAGGAGGCTGG - Intergenic
1137602212 16:49764007-49764029 CCCCACGGGCAGGAGGAGACAGG + Intronic
1137646540 16:50080046-50080068 TCACTCAGGCAGCTGGAGGAAGG + Intronic
1137683892 16:50372839-50372861 CCACACAGGCTGCATGAGGCTGG - Intergenic
1137822386 16:51458491-51458513 CCACCCTGGCAAGAGGAGGTTGG - Intergenic
1138118442 16:54378922-54378944 TCACTCAGGCAGGAGAAAGAAGG - Intergenic
1138374089 16:56550716-56550738 CCCCACAGGAAGCAGGAAGATGG - Intergenic
1138417191 16:56878175-56878197 CCAGCCAGTCAGGAGGGGGAGGG + Intronic
1138507537 16:57485828-57485850 CCCCATAGGCAGGAGGGGGTCGG + Intronic
1138554387 16:57763331-57763353 CAGGCCAGGCAGGAGGAGGAAGG - Intronic
1139354553 16:66359864-66359886 CCAGACAGGCAGGAGGCAGATGG + Intergenic
1139565615 16:67773900-67773922 CCCCTCTGGCAGGAGGAGGCAGG - Intronic
1139650943 16:68361764-68361786 CCACACATGCAGGAGGCAGGTGG + Intronic
1139990795 16:70938145-70938167 GGACCCAGGCAGGGGGAGGAAGG + Intronic
1140070945 16:71649152-71649174 CCATAGAGGCAGGAGGTGGAGGG + Exonic
1141595551 16:85094929-85094951 CCACTCAGGCAGCTGGGGGAGGG - Intergenic
1141612105 16:85187665-85187687 CCACCCAGGTAGGAGCAGGTGGG - Intergenic
1141887088 16:86899507-86899529 CCACACAGCCAGGAGATGGCAGG + Intergenic
1142005391 16:87687409-87687431 CCAGACAGGCAGCAAGAGGCTGG - Intronic
1142244018 16:88960586-88960608 CCAGGCAGGAAGGAGGAAGAAGG - Intronic
1142468003 17:147033-147055 GCAGACAGACAGGTGGAGGATGG - Exonic
1142799972 17:2338531-2338553 CCACAGAGGCAGGCAGGGGAAGG - Intronic
1143159221 17:4858217-4858239 CCACACAGAGAGGAAGAGGGGGG - Intronic
1143374390 17:6458705-6458727 TCACTCAGGCAGGATGAGGAAGG - Intronic
1143462503 17:7112827-7112849 CCATGGAGGCAGGAGGAGCAGGG - Intronic
1143513647 17:7408599-7408621 CCACACAGGCAGCATGATGGCGG - Exonic
1143935473 17:10479866-10479888 CCTCACTGGAAGGAGGAAGATGG + Intergenic
1144291915 17:13834725-13834747 CCACGCAGGGAGGTAGAGGAAGG - Intergenic
1144795695 17:17889596-17889618 CCTCACAGGCAGGAGGTGTTAGG + Intronic
1145817305 17:27804789-27804811 CCACACAGTCAGGTGGTGGCAGG + Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146673596 17:34758222-34758244 CCTCCCAGGGATGAGGAGGAAGG - Intergenic
1147158693 17:38558623-38558645 GAACAGAGGCAGGAGGAGAACGG + Intronic
1147600745 17:41743794-41743816 ACAGACAGGCAGGAGGAGCCAGG + Intergenic
1147883347 17:43668301-43668323 CCACACAGCACGAAGGAGGAAGG + Intergenic
1147990651 17:44330921-44330943 CCACAGAGGCAGGGGGAGACAGG - Intergenic
1148215698 17:45833107-45833129 CCACAGAGGAAAGGGGAGGAAGG - Intronic
1148811779 17:50297610-50297632 CCACACAGGTGGGAGCAGCAGGG + Intergenic
1151115838 17:71733916-71733938 CTACACAGGGAGGAGGAGGAGGG - Intergenic
1151197369 17:72441207-72441229 AGAGACAGGAAGGAGGAGGAAGG - Intergenic
1151351468 17:73534505-73534527 ACAGACAGGAGGGAGGAGGAAGG + Intronic
1151503832 17:74513042-74513064 CAACACAGGCAGTCGGGGGAGGG - Intergenic
1151509492 17:74549597-74549619 ACAGACAGGCAGAAGGTGGAGGG - Intergenic
1151540778 17:74763641-74763663 CCTCCCATGAAGGAGGAGGAGGG - Intronic
1151700986 17:75742518-75742540 CCACACAGGCGGGAGGTGCGAGG - Intronic
1151735170 17:75935411-75935433 GCACTCTGGGAGGAGGAGGAGGG - Intronic
1152094252 17:78263845-78263867 CCACCCAGGGTGGAGGAGGTGGG - Intergenic
1152151551 17:78604340-78604362 GGACTCAGGCAGGTGGAGGAGGG - Intergenic
1152368551 17:79871095-79871117 CCACTCAGGCTGAAGAAGGAGGG + Intergenic
1152485193 17:80586547-80586569 CGACACAGGCAGAAACAGGAAGG - Intronic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1152693794 17:81733972-81733994 CCAGCCAGGCAGGGTGAGGAGGG + Intergenic
1153373912 18:4354295-4354317 CCACACAGCAAGGTGGAGGAAGG - Intronic
1154325697 18:13389179-13389201 ACACACAGTAAGGATGAGGAAGG - Intronic
1154991071 18:21599224-21599246 CCACTCAGGGAGGCGGAGGTGGG + Intronic
1155517384 18:26637214-26637236 CGATAGAGTCAGGAGGAGGAAGG - Intronic
1155882174 18:31162940-31162962 ACACATAGGCAGAAGGAGGAGGG + Intergenic
1156227389 18:35122881-35122903 CCACACAGGCAGGTTGAAGTTGG + Intronic
1156364377 18:36412101-36412123 CCACGCAGGCAGGAAGGGGCGGG + Intronic
1157300476 18:46475240-46475262 ACCAAAAGGCAGGAGGAGGAGGG + Intergenic
1157404407 18:47410886-47410908 CCACACAGACAGGAGGGGGTTGG + Intergenic
1157622322 18:49023786-49023808 CCAGGCATGGAGGAGGAGGAAGG - Intergenic
1157731299 18:50006711-50006733 CCACCCAGAAATGAGGAGGAAGG - Intronic
1157796513 18:50580133-50580155 CCCCACAGACTGAAGGAGGAAGG - Intronic
1157833469 18:50878702-50878724 CCACAGAGGAAGGGGGAGAACGG - Intergenic
1158557226 18:58485468-58485490 TCCCCCAGCCAGGAGGAGGAGGG - Intronic
1158832848 18:61299335-61299357 ACACATGGGCAGGAGGAGAATGG + Intergenic
1159115091 18:64104885-64104907 CCACAGGGCCTGGAGGAGGAAGG - Intergenic
1159388624 18:67759371-67759393 CCACCCAGGCAGGATGGGTAAGG - Intergenic
1160427200 18:78786853-78786875 CCACACGTGCAGGAGAGGGAAGG + Intergenic
1160698025 19:494088-494110 GGACACAGGAAGGAGGAGGGAGG - Intronic
1160855332 19:1214740-1214762 CTGCACAGGCAGCAGGAGGTGGG + Intronic
1161015611 19:1981401-1981423 CCGGACAGGCAGGATGGGGATGG - Intergenic
1161100179 19:2417833-2417855 CCACAGAGTGAGGAGGAGGTGGG - Intronic
1161153234 19:2720451-2720473 GCACCGAGGCAGGAGCAGGAGGG + Intronic
1161391559 19:4023869-4023891 CCGCCCAGGAAGGAGGATGAGGG - Intronic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1161915788 19:7226874-7226896 CAAAATTGGCAGGAGGAGGAGGG - Intronic
1162055655 19:8062374-8062396 CCAGACGGGCAGGAGGTGGTGGG - Exonic
1162472044 19:10878079-10878101 AGGCTCAGGCAGGAGGAGGATGG - Intronic
1162573396 19:11485272-11485294 CCACCCAAGCAGCAGCAGGAAGG - Intronic
1162788605 19:13051654-13051676 CCAAGAAGGGAGGAGGAGGAGGG - Intronic
1162796900 19:13091779-13091801 CCAGGCAGGCAGCAGGAGGGAGG - Intronic
1163105142 19:15119082-15119104 CTTCACACGAAGGAGGAGGAAGG - Intronic
1163122021 19:15223833-15223855 GAAGACGGGCAGGAGGAGGAGGG - Intergenic
1163127280 19:15251157-15251179 GAACACAGGCAGGAGGAGGATGG - Intronic
1163390589 19:17027550-17027572 CCACACGGGGAGGGGCAGGAGGG - Intergenic
1164912822 19:32026400-32026422 CCACATGGGTGGGAGGAGGAGGG - Intergenic
1165007745 19:32820254-32820276 ACACACACACACGAGGAGGAGGG - Intronic
1165313028 19:35040041-35040063 CCAAACAGGCAGCAGAAGCAGGG - Intronic
1167245588 19:48371216-48371238 TCAGACAGACAAGAGGAGGAAGG - Intronic
1167250293 19:48395656-48395678 CCAAGCGGGGAGGAGGAGGAGGG - Intronic
1167353575 19:48990698-48990720 ACACACAGGCAGCAAGTGGAGGG + Intronic
1168236894 19:55069206-55069228 CCAGCCTGGCAGGAGGAGGAGGG - Intronic
1168268712 19:55238030-55238052 CCACCCTGGCAGGAGAATGAAGG - Intronic
1168429617 19:56267937-56267959 GCACACAGCCAGGAGGTGGAGGG + Intronic
925058169 2:871408-871430 AGACACAGGCAGGAGGAAGATGG + Intergenic
925063982 2:914954-914976 ACACACAGGCAGTAGATGGAAGG + Intergenic
925065081 2:923151-923173 CCGAACAGAAAGGAGGAGGAAGG - Intergenic
925298309 2:2792740-2792762 CCACTCAGGCAGGAGGATGCAGG + Intergenic
925298354 2:2792917-2792939 CCACTCAGGCAGGAGGATGCAGG + Intergenic
925298400 2:2793094-2793116 CCACTCAGGCAGGAGGATGCAGG + Intergenic
925298416 2:2793153-2793175 CCACTCAGGCAGGAGGATGCAGG + Intergenic
925370794 2:3343963-3343985 GCGCTGAGGCAGGAGGAGGATGG + Intronic
926776947 2:16432272-16432294 TGACACAGGCAGGAGAAGAAAGG - Intergenic
927727001 2:25433290-25433312 CCACTCAGGCAGGAGGAAAAGGG + Intronic
927921398 2:26974682-26974704 CCACACAGCCAGGAGATGGCTGG - Intronic
928167593 2:28982029-28982051 CCACACAGCCAGAAAGAGGGGGG - Intronic
928255601 2:29719685-29719707 CCACACAGCCAGCAGGAGACAGG + Intronic
928412512 2:31065986-31066008 TCACACAGGTAGGAAGAGGGTGG - Intronic
928593599 2:32840405-32840427 CCAAAGAGGCAGCAGCAGGAAGG + Intergenic
929009409 2:37426127-37426149 CCTCAAAGGAAGGAGGAGAAGGG - Intergenic
929759920 2:44798340-44798362 CCCCATGGGGAGGAGGAGGATGG - Intergenic
929999758 2:46853178-46853200 ACACACACGCGGGAGGAGGAAGG - Intronic
931097470 2:58957453-58957475 CCAGGCAGGAAGAAGGAGGAGGG - Intergenic
931104111 2:59035239-59035261 CCACCCAGCTAGGAAGAGGAAGG - Intergenic
931140624 2:59453660-59453682 CCAGACCGGGAGAAGGAGGAAGG - Intergenic
931274255 2:60730382-60730404 CAACACAGGCAGGCTGAGGTGGG + Intergenic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
932731357 2:74224399-74224421 CCAGACAGGCAGGAGGGGCTGGG - Intronic
933206983 2:79517957-79517979 CCAAACAGGGAGGTGGAGTAAGG + Intronic
933686789 2:85147800-85147822 CCACACATGCACGAGGATGTGGG - Intronic
933906731 2:86901401-86901423 CCACACAGGCACAGGCAGGAAGG + Intergenic
933970366 2:87465065-87465087 CCACACAGCTAGCAAGAGGAAGG - Intergenic
934297168 2:91752048-91752070 CCACAGAGGAAACAGGAGGAGGG - Intergenic
935223170 2:101032233-101032255 CCAGATACACAGGAGGAGGAAGG + Intronic
935259760 2:101344096-101344118 CAGGGCAGGCAGGAGGAGGAAGG + Intergenic
935695414 2:105766909-105766931 CTGCACAGGCAGCAGGAAGACGG - Intronic
935775819 2:106470310-106470332 CCACACAGGCACAGGCAGGAAGG - Intergenic
935789261 2:106576052-106576074 CCACAGTGGCAGATGGAGGATGG - Intergenic
936013131 2:108938127-108938149 CCACAGAGGCAGGAAGAGCATGG + Intronic
936297241 2:111276281-111276303 CCACCCAGGAAGCAGGAGGTGGG - Intergenic
936323417 2:111485431-111485453 CCACACAGCTAGCAAGAGGAAGG + Intergenic
936365431 2:111850270-111850292 CCACACAGGCACAGGCAGGAAGG - Intronic
937127130 2:119482055-119482077 CCACACAGCCAGGACATGGAGGG + Intronic
937323665 2:120975991-120976013 GGGAACAGGCAGGAGGAGGAAGG - Intronic
937907841 2:127061038-127061060 CCCCTCAGGAAGGAGGTGGAGGG - Intronic
938053011 2:128192249-128192271 AAAAACTGGCAGGAGGAGGAGGG - Exonic
938662913 2:133505652-133505674 TCACACAGGCAGTAGGAGGCAGG + Intronic
938765183 2:134456343-134456365 CCACCCAAGCTGGAGGAGGTGGG + Exonic
938969042 2:136415309-136415331 CCACACAGCCTGGAGGATGGTGG + Intergenic
939162331 2:138605117-138605139 GCACCCAGGCAGGAGCTGGAAGG - Intergenic
940335591 2:152524035-152524057 CCACACTGACAGGTAGAGGAAGG - Intronic
942374348 2:175321432-175321454 GCACACAGGCAGTAAGAGAATGG + Intergenic
944115761 2:196184588-196184610 CCACTGGGACAGGAGGAGGAAGG + Intergenic
944504126 2:200392232-200392254 CCAAACTGGCAGGAGGAGAGAGG + Intronic
945422275 2:209653315-209653337 CCATACAGGGAGGATGAAGAGGG + Exonic
946143908 2:217714303-217714325 CCACACAGCCAGGGAGAGGATGG - Intronic
946325577 2:218983114-218983136 ACACAAAGACAGGAGGAGGTTGG - Intronic
946680980 2:222215705-222215727 CTACACATGCAGGAGGAAAAAGG - Intronic
948225502 2:236306433-236306455 TCACCCAGGCAACAGGAGGAGGG + Intergenic
948327514 2:237137859-237137881 CCACACAGGCAGAATGTTGAGGG - Intergenic
948507612 2:238440470-238440492 CAACACAGGCAGTATGTGGAGGG - Intronic
948708292 2:239809465-239809487 CCACACAGGGAGGAGGGAGGAGG - Intergenic
948733927 2:239986311-239986333 CCACCCAGGCAGGTGCAGGCAGG - Intronic
948919191 2:241053369-241053391 CCACATGGCCAGGATGAGGAGGG - Intronic
949071821 2:242029777-242029799 ACACACAGACTGAAGGAGGAAGG + Intergenic
1168970363 20:1926735-1926757 CCTCACAGCCAGGAGGTGGTGGG + Intronic
1169266623 20:4171061-4171083 CCAGGCAGGGAAGAGGAGGAGGG - Intronic
1169423658 20:5479583-5479605 CCACCCAGGCTGGAGCATGATGG - Intergenic
1170476579 20:16720979-16721001 CCACACAGGCATGTTGAGGACGG - Intergenic
1170661526 20:18345844-18345866 CCAGAGACTCAGGAGGAGGAAGG + Intergenic
1170841350 20:19927069-19927091 GCAGACAGGCAGGAGGAGATTGG + Intronic
1171130967 20:22652648-22652670 GCACACAAGCACGAGGAGGAAGG + Intergenic
1171317236 20:24205956-24205978 CCCCACAAGCAGGTGGTGGAAGG + Intergenic
1171393384 20:24815655-24815677 CAACAGAGGCAGGTGGAGAAGGG - Intergenic
1172313058 20:33932907-33932929 CGACACAGGCAGGAGGATTCTGG + Intergenic
1172628941 20:36365566-36365588 CCACACACCCAGGAAGAGGCAGG - Intronic
1172672398 20:36643507-36643529 CCACACTGCCTGGATGAGGACGG + Intronic
1172789909 20:37495950-37495972 CCACCCAGGCTGGAGTAGAATGG + Intronic
1173199544 20:40944411-40944433 GCACTGAGGCAGGAAGAGGAGGG + Intergenic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173811519 20:45958773-45958795 CCAGGCAGGAAGCAGGAGGAAGG - Intronic
1174419526 20:50390586-50390608 TCACACAGCCAGGAGGAGGCAGG - Intergenic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1175464043 20:59177668-59177690 CCTCACTGGCTGGACGAGGACGG + Intergenic
1175465159 20:59185743-59185765 CCACTGAGGCAGGAGCTGGACGG + Intergenic
1175954052 20:62599331-62599353 CCACCCCGGGAGGAGAAGGAGGG - Intergenic
1176000581 20:62829706-62829728 GCACACAGGCTGGATGGGGAGGG - Intronic
1176236196 20:64054622-64054644 CCACATAGGCTGGAGGGGGCAGG + Intronic
1176372275 21:6069218-6069240 CCACGCAGACAGCAAGAGGAGGG - Intergenic
1176456455 21:6916502-6916524 CCACACAATGAGGAGGAGGTGGG + Intergenic
1176834629 21:13781562-13781584 CCACACAATGAGGAGGAGGTGGG + Intergenic
1177860003 21:26441183-26441205 ACACACATGCACTAGGAGGATGG - Intergenic
1177894222 21:26842324-26842346 CCAGACAGGTAAGAGGAAGATGG - Exonic
1179080555 21:38166704-38166726 CTGCACCTGCAGGAGGAGGAGGG + Intronic
1179315848 21:40243876-40243898 CCACACAGGCATCAGAGGGAGGG + Intronic
1179362286 21:40722374-40722396 ACACAAAGGCAGGAGGAAGGAGG + Intronic
1179423019 21:41251134-41251156 CCACCCAGGCTGGTGTAGGATGG + Intronic
1179500788 21:41807404-41807426 CCACAGATTCAGGAGGAAGAAGG - Intronic
1179514448 21:41897189-41897211 CCAGACAGGGGGAAGGAGGAGGG + Intronic
1179610493 21:42547198-42547220 CCGCACAGGCAGGAGCAGGCTGG - Intronic
1179724646 21:43335381-43335403 GCCCACAGCCAGGAGGTGGACGG - Intergenic
1179751243 21:43469321-43469343 CCACGCAGACAGCAAGAGGAGGG + Intergenic
1180074175 21:45454390-45454412 CCGCACAGCCTGGAGGAGGCAGG + Intronic
1180703129 22:17792560-17792582 CCAGAAAGGCAGGTGGAGAAAGG - Intronic
1181672275 22:24431268-24431290 ACACAGAAGCAGGAGGAGGAAGG - Intronic
1181764719 22:25083240-25083262 CCACACACGCAGAGGGAAGATGG - Intronic
1181851150 22:25750834-25750856 CCCCACAGGCACGTGAAGGATGG + Intronic
1181896582 22:26113463-26113485 TCACACAGCCAGGAAGAGGCAGG - Intergenic
1182098010 22:27638890-27638912 ACCCACAGGCCTGAGGAGGAGGG + Intergenic
1182290969 22:29279273-29279295 TCACACAGGCAGGAGGGGAAGGG + Intronic
1182418978 22:30239490-30239512 CCAAATAGGCAGCGGGAGGAGGG + Intergenic
1182699092 22:32218541-32218563 CACCACAGCCAGGAGGAGGATGG + Exonic
1182848080 22:33447766-33447788 CAGCACAGGGAGGAGGAGGAAGG + Intronic
1182890201 22:33811818-33811840 AGACACAGGAAGGAGGAGGCCGG + Intronic
1183505603 22:38207065-38207087 CCACACAGGGAGGAGGTGTGTGG + Intronic
1183520433 22:38293603-38293625 GCCCACAGGCAGGAGGACGAGGG + Intronic
1183548682 22:38468766-38468788 CCACACATGCAGGCAGGGGAGGG - Intronic
1183734636 22:39637030-39637052 CCACACAGCCAGGGAGAGGCTGG - Intronic
1183758139 22:39790010-39790032 ACCCACAGGCAGGAGGGGGCTGG + Intronic
1184080237 22:42214177-42214199 CCACAGAGGCAGCTGGAGAAGGG + Exonic
1184098590 22:42329807-42329829 GCAGGCAGGCAGGGGGAGGAAGG - Intronic
1184109911 22:42388619-42388641 GCTCAGAGGCAGGAGGAGGGCGG + Intronic
1184152530 22:42647098-42647120 CCCCACAGTCTGGAGGAGGCTGG - Intronic
1184254616 22:43280050-43280072 CCAGCCAGTCAGGAGGAGGAAGG + Intronic
1184596428 22:45516886-45516908 CCACAAGGCCAGGAGGAGGGGGG - Intronic
1185078452 22:48695941-48695963 CCACACAGACAGGACGCAGAGGG + Intronic
1185178593 22:49346455-49346477 ACACAGAGGCAGGAGGAAGATGG + Intergenic
949144876 3:687174-687196 CCAAACTGGCAGGGGAAGGAAGG - Intergenic
949439847 3:4068667-4068689 ACACACAGCCAGCAGGTGGAAGG - Intronic
949612594 3:5717994-5718016 CTACACAGGCAAAGGGAGGAGGG + Intergenic
950136041 3:10581568-10581590 GTCCACAGGCAGGAGGAGAAGGG + Intronic
950193845 3:10995293-10995315 TCACATAGCCAGGAGGAGGAAGG + Intronic
950210246 3:11117749-11117771 GCCCTCAGGCAGCAGGAGGAAGG + Intergenic
951052975 3:18115149-18115171 CGTCACAGGAAAGAGGAGGAGGG + Intronic
951519687 3:23599718-23599740 GTCCACAGGCAAGAGGAGGATGG + Intergenic
951996543 3:28736325-28736347 CCAAACAGTCTGGATGAGGAAGG - Intergenic
953133956 3:40166951-40166973 CCCCACAGAGAGGAGCAGGAGGG - Intronic
953896553 3:46807630-46807652 CCACACCTGGAGGTGGAGGATGG + Intronic
954410519 3:50368655-50368677 GCACACAGCCAGGAAGAGGCAGG - Intronic
954436615 3:50499643-50499665 GCACACAGGCAGGAGGAGAAGGG + Intronic
954581258 3:51704086-51704108 CCCCAGAGGAAGGAGGAAGAGGG - Exonic
954614812 3:51964180-51964202 CCACTCAGGCTGGAGGAGGCGGG + Intronic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954707222 3:52487470-52487492 CCAGACGTGGAGGAGGAGGAGGG + Exonic
955202781 3:56866123-56866145 CCACACAGGCTGGAGTACAATGG - Intronic
955405735 3:58624636-58624658 CCACACTGGCAGGGGATGGAAGG - Intronic
955486389 3:59438819-59438841 CCACAAAGGAAGAAGAAGGAGGG + Intergenic
955809798 3:62775757-62775779 GCACTCAGGCAGCACGAGGAAGG - Intronic
955943517 3:64169189-64169211 CCAGACAGGAAGCAGGAAGAAGG - Intronic
956765046 3:72477789-72477811 CCACCCAAGCAGGAGAAGAAAGG + Intergenic
957275541 3:78086293-78086315 CCAGGCAGGAAGGAGCAGGATGG - Intergenic
957877941 3:86173737-86173759 TTTCACAGGCAGGAGCAGGAAGG - Intergenic
959946983 3:112135398-112135420 TAAAACAGGCAGGAGAAGGATGG + Intergenic
960257443 3:115525965-115525987 CCAATCAGCCAAGAGGAGGAAGG - Intergenic
960738793 3:120810085-120810107 CCATACAGGGAGGAAGAAGAAGG + Intergenic
960944587 3:122957438-122957460 GCACCCAGGCAGGAGCAGCACGG + Intronic
961218827 3:125183788-125183810 CCACACAGGTAAGTGGAGCAGGG + Intronic
961302736 3:125932656-125932678 TCACACAGACAAGAGAAGGAAGG + Exonic
961370361 3:126424869-126424891 CCACACAGGCTGGGCGAAGAGGG + Intronic
961459732 3:127042754-127042776 CCAGAGGGGCAGGGGGAGGAGGG - Intergenic
961536509 3:127573968-127573990 TCACACAGCCAGGGGGAGGAGGG - Intronic
961828865 3:129613024-129613046 TCACACAGGCAGCACGAGGCTGG - Intergenic
963049264 3:141127718-141127740 AGACACAGGCTGGAGAAGGAAGG + Intronic
963745830 3:149124487-149124509 GCACTCATGCAGGACGAGGAGGG - Intergenic
964183329 3:153913573-153913595 CTAAACAGTCTGGAGGAGGAAGG + Intergenic
966463219 3:180200829-180200851 GCACAGAGGCAGGAGCAGAAAGG - Intergenic
966822174 3:183933621-183933643 CCACACAGGCAGATAAAGGAGGG + Intronic
968462522 4:732444-732466 CCCCGCAGGGAGGAGGAGAAGGG + Intronic
968492808 4:899507-899529 TCACACAGGCAGCGAGAGGAAGG + Intronic
968732063 4:2273870-2273892 CCACACAGGCAGGAGGAGGAGGG - Intronic
968753316 4:2401552-2401574 TCACAGAGCCAGAAGGAGGAGGG - Intronic
968929810 4:3572903-3572925 CCACAGAGGCTGGAGAAGCAGGG - Intergenic
969232448 4:5841200-5841222 TCAGACAGGCAGCCGGAGGAGGG - Intronic
969257980 4:6015565-6015587 CCACACAGACATGGGGAGAATGG - Intergenic
969373899 4:6750593-6750615 CCACACAGCCAGGAAGGGGTTGG - Intergenic
969477699 4:7430923-7430945 GCAGAGAGGCAGGAGGAGCAAGG - Intronic
969492189 4:7505753-7505775 TCACAGAGTCAGGAAGAGGAAGG - Intronic
969556720 4:7916599-7916621 CCACTCCTGCAGGAGGGGGAGGG - Intronic
969612727 4:8236252-8236274 CCACACAGGCAGGTGGGGTCAGG - Intronic
969617871 4:8264301-8264323 CGAGTCAGGCAGGAGTAGGATGG + Intergenic
969641611 4:8402166-8402188 CCACACTACCAGGAGGAGCAAGG + Intronic
970289123 4:14552539-14552561 CCACACAGGCTGGAGAAGACAGG + Intergenic
970543645 4:17105033-17105055 GCACAGTGGCAGGAGGAGAAGGG - Intergenic
970867772 4:20778989-20779011 AGAGACAGGGAGGAGGAGGAAGG + Intronic
971141764 4:23932327-23932349 CCCTGGAGGCAGGAGGAGGATGG - Intergenic
971513423 4:27456300-27456322 TGACATAGTCAGGAGGAGGAGGG - Intergenic
974155755 4:58070043-58070065 CCACAGAGACAGAAGGAGGGAGG + Intergenic
975802796 4:78079844-78079866 CTACACAGCCAAGTGGAGGAGGG + Intronic
978755547 4:112298181-112298203 ACAAACAGGCAGGATCAGGAAGG + Intronic
981130576 4:141154379-141154401 CCACACAGGCACGCTAAGGAAGG - Intronic
982064324 4:151639822-151639844 CCACTAAGGAAGGAGGAGCAGGG - Intronic
984030526 4:174598702-174598724 TACCACAGGCAGGAGGAGGGAGG - Intergenic
984501623 4:180565749-180565771 CCACACAGGCCGAGGGAGAAGGG - Intergenic
985475532 5:76837-76859 CCACACGGACAGGTGGCGGATGG + Intergenic
985482100 5:119714-119736 TCACTGAGGCTGGAGGAGGATGG + Intergenic
985849527 5:2378601-2378623 CCACACCAGCAGGGAGAGGAGGG - Intergenic
986298434 5:6458971-6458993 CCACCCAACCTGGAGGAGGAAGG - Intronic
986806535 5:11313228-11313250 CTGCTCAGGGAGGAGGAGGAGGG - Intronic
987113683 5:14710639-14710661 CCACACATGCAGGAGGCGGGTGG - Exonic
988232094 5:28492352-28492374 ACACACAGTGAGGAGGAGCATGG + Intergenic
988350266 5:30095687-30095709 CCTGTCAGGGAGGAGGAGGAGGG - Intergenic
988454317 5:31373651-31373673 CAACAGAAGCAGGAGGAGGCAGG - Intergenic
988537963 5:32085976-32085998 CCAGAGAGTGAGGAGGAGGAAGG - Intronic
989507519 5:42244394-42244416 CCAGACAGGCAGTAGGAACAGGG - Intergenic
990376252 5:55173438-55173460 CCACCGCGGCAGGAGGCGGAGGG + Intergenic
990543496 5:56798547-56798569 CCACATAGCCAGGAGCAGAAAGG + Intergenic
992426370 5:76662158-76662180 CCTCACAGGGAGAAGGAAGAGGG + Intronic
992643805 5:78793691-78793713 GCACACAGCCAGGTGGAGGAAGG + Intronic
992713804 5:79488858-79488880 TCACACAGCCAAGATGAGGATGG + Intronic
996279855 5:121716148-121716170 CCACTCTTGCAGGAGGAAGATGG - Intergenic
997981830 5:138472444-138472466 CCTTTCAGGTAGGAGGAGGAAGG - Intergenic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
998618813 5:143771846-143771868 CCACTCAGGGAGGAGGAGGAAGG + Intergenic
999640468 5:153667300-153667322 CAGCACAGGCAGGATGATGAGGG + Intronic
1000543166 5:162566148-162566170 CCACCCAGGCAGGAAGGGGAGGG + Intergenic
1000614888 5:163415769-163415791 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1000758949 5:165197162-165197184 CCACACAGGAAGAATGCGGAGGG - Intergenic
1001099865 5:168805299-168805321 ACACACAGGGAAGGGGAGGAGGG + Intronic
1001399123 5:171436357-171436379 TCACACAGCCAGGAGCAGCAAGG - Intronic
1001429433 5:171647604-171647626 CCACTGAGGCAGGTGGAGAAGGG + Intergenic
1001487088 5:172127545-172127567 CTCCCAAGGCAGGAGGAGGAAGG - Intronic
1001545163 5:172566453-172566475 CCACACAGCAAGGAAGAGGTAGG - Intergenic
1001551080 5:172602805-172602827 CCACTCTGGCAGGACAAGGAGGG - Intergenic
1001842499 5:174890927-174890949 CCAAATAGTCTGGAGGAGGAAGG + Intergenic
1001843978 5:174904475-174904497 CCAAACAGTCTGGAGGAGGAAGG + Intergenic
1001885687 5:175288203-175288225 CCACAGAGGCAGCAGCAGAAGGG + Intergenic
1002776245 6:330049-330071 CCACACAGGCCGGTGAAGCAGGG + Intronic
1002887776 6:1311857-1311879 CCCCATTGGCGGGAGGAGGAAGG + Intergenic
1003116594 6:3287608-3287630 CCACACAGCCTGGAGGAGTCGGG + Intronic
1003187861 6:3848964-3848986 CATCAGAGGCGGGAGGAGGAGGG + Intergenic
1003521677 6:6863440-6863462 CCTGACTGGAAGGAGGAGGAAGG - Intergenic
1003747305 6:9017133-9017155 CCTCAAAATCAGGAGGAGGATGG - Intergenic
1004737167 6:18419206-18419228 AGCCATAGGCAGGAGGAGGAGGG - Intronic
1005083640 6:21981642-21981664 CAGCACAGGAAGGAGGAGGCAGG - Intergenic
1006425935 6:33963013-33963035 ACCCACAGGAAGGAGCAGGAAGG - Intergenic
1006638129 6:35474721-35474743 CCACACATGCTGGAGGCTGAAGG + Exonic
1006900137 6:37494653-37494675 TAACTCAGGAAGGAGGAGGAAGG - Intronic
1007247436 6:40472612-40472634 CCACACCAGCATCAGGAGGAGGG - Intronic
1007450747 6:41939351-41939373 CCACAGAGCAAGGTGGAGGAAGG + Intronic
1008052345 6:46913137-46913159 CCAGAGAGGCAGGAACAGGAGGG + Intronic
1008674940 6:53809388-53809410 GCAAAATGGCAGGAGGAGGAAGG + Intronic
1009778161 6:68233052-68233074 CCACACATACAGGAGGAGAAGGG + Intergenic
1010044123 6:71420614-71420636 CCGGCCCGGCAGGAGGAGGAGGG + Intergenic
1010081688 6:71871147-71871169 TCACACAGGCAGGAGTAGATGGG + Intergenic
1011389757 6:86838806-86838828 CCAAACTGGCAGAAGGAAGAAGG - Intergenic
1011480552 6:87789420-87789442 AGACACAGGCAGGAGGAGAAGGG + Intergenic
1011502522 6:88006846-88006868 CCATCCCGGCAGCAGGAGGAAGG + Intergenic
1011507246 6:88059261-88059283 TCACACAGGCAGGAAGTGGTAGG + Intronic
1011700398 6:89950109-89950131 CCACAGAGGCAGGATGCTGAAGG - Intronic
1011833679 6:91404231-91404253 CTCCACAGGCAGGGGGAAGAAGG + Intergenic
1012761815 6:103311621-103311643 CCATACAGGCTAGAGGAGAATGG + Intergenic
1012896311 6:104953657-104953679 CTGCAGAGGCAGGAGGTGGAGGG + Intergenic
1012953485 6:105543471-105543493 CCCCACAGGCAGGGGGATTATGG - Intergenic
1013872465 6:114782283-114782305 CCACTCAGGAAGGAGAAGGATGG - Intergenic
1016735629 6:147476723-147476745 CCTCAGAGACAGTAGGAGGAAGG - Intergenic
1016893676 6:149032302-149032324 GAACTCAGGCTGGAGGAGGATGG - Intronic
1017754486 6:157518018-157518040 ACACGCAGGCTGGAGGAGGGTGG + Intronic
1018268967 6:162055579-162055601 TGACACAGAAAGGAGGAGGAGGG + Intronic
1018427199 6:163694219-163694241 CCTCACAGGGAGGAGGTGGCTGG + Intergenic
1018491119 6:164294543-164294565 CCACACTGGCATGGTGAGGATGG - Intergenic
1018787454 6:167119167-167119189 CCAGGTAGGCAGGGGGAGGAAGG - Intergenic
1018824195 6:167397161-167397183 CCACACACACAGGAGCATGACGG + Intergenic
1018844646 6:167547300-167547322 GGAGACAGGCAGGAGGAGGGAGG - Intergenic
1018874125 6:167804767-167804789 CCACGCGGGCAGGAGGCGGGTGG + Intergenic
1018998171 6:168725893-168725915 CCACAGTGTCACGAGGAGGAAGG + Intergenic
1019227158 6:170522790-170522812 CCACACAGACAGGAAGAGATGGG + Intergenic
1019288163 7:234066-234088 CCAGAAAGGCAGGGGCAGGAAGG - Intronic
1019421399 7:952941-952963 CCAGCCTGGCAGGAGGAAGAGGG - Intronic
1019769812 7:2876600-2876622 GCCCACGGGCAGCAGGAGGATGG + Intergenic
1019938405 7:4271042-4271064 GCACAGAGGCTGGAGGAAGATGG - Intergenic
1020014865 7:4825040-4825062 CCACACAGGCCTGGGTAGGATGG - Intronic
1020155900 7:5724214-5724236 GCACACAGGGAAGAGGAGAAGGG + Intronic
1020664029 7:11016925-11016947 GGACACAGACAGGAGAAGGATGG - Intronic
1023037899 7:36148929-36148951 TCACACAGGGAGGAGAATGAGGG + Intergenic
1023401300 7:39794169-39794191 CCACTGAGGCAGGAGGAGCTGGG - Intergenic
1023735671 7:43234245-43234267 ACACACTGGAAGGATGAGGAGGG - Intronic
1023871112 7:44263490-44263512 CCCGGCTGGCAGGAGGAGGAGGG + Intronic
1023974938 7:45021730-45021752 TGAGACAGGGAGGAGGAGGAGGG + Intronic
1024604730 7:51014134-51014156 CCATTCAGGCAGGAGGAAGGAGG - Intergenic
1025251425 7:57353895-57353917 TCACACAGCCAGGAGGAGGCAGG + Intergenic
1025994325 7:66518604-66518626 GGACAGAGGCAGCAGGAGGAGGG - Intergenic
1026913613 7:74106923-74106945 GCATGCAGGCAGGAGGAGGAAGG + Intronic
1026985935 7:74555293-74555315 GGACAGAGGCAGCAGGAGGAGGG - Intronic
1028411781 7:90537940-90537962 CAACACAGGCAGGACCATGAAGG - Intronic
1028953838 7:96666764-96666786 GGACACAGGCAGGAGAAGCATGG - Intronic
1029634996 7:101777778-101777800 TCACAAAGGAAGGAAGAGGAAGG - Intergenic
1030205992 7:106953230-106953252 CCATACTGGCAGGAGGAAGGAGG - Intergenic
1031868714 7:127068755-127068777 CCACACAGTGAGGAGGAATATGG + Intronic
1032516758 7:132512153-132512175 CCAGACAGGCAGGTGCAGGTCGG + Intronic
1032533680 7:132643081-132643103 TCAGACCTGCAGGAGGAGGAGGG + Intronic
1032716098 7:134510580-134510602 ACACACAAGCAGGAGGAGAAGGG - Intergenic
1033399948 7:141013203-141013225 CAAGATAGCCAGGAGGAGGAAGG + Intronic
1033822115 7:145147398-145147420 TCACACAGTCAGGAACAGGAAGG - Intergenic
1034237413 7:149583145-149583167 CCTCCCAGGCAGCAGGAAGATGG - Intergenic
1034252867 7:149706380-149706402 CCAGCCAGGCGGGAGGATGAGGG - Intergenic
1034338907 7:150340211-150340233 ACAGACAGGCAGGCAGAGGATGG + Intronic
1034433707 7:151053291-151053313 CCTTACTGGCAGGAAGAGGAAGG - Intergenic
1034963379 7:155375797-155375819 CCCCACAGGAGGGAGGAGGAAGG + Intergenic
1035177515 7:157062359-157062381 GCACCCAGGCAGGAGGTGAATGG - Intergenic
1035336556 7:158133209-158133231 CCTAACAGGCAGGAGGAGTCCGG + Intronic
1035426899 7:158784051-158784073 AGGCACAGGGAGGAGGAGGAGGG + Intronic
1035553183 8:545128-545150 CCACACTGGGAGGAGGGGGCCGG - Intronic
1035661166 8:1349730-1349752 ACACACAGGTAGGAAGAGGAAGG + Intergenic
1035862275 8:3042106-3042128 CCACCCAGGCAGGAGGGTGATGG + Intronic
1036381611 8:8239501-8239523 TCACACAGACAAGAGAAGGAAGG + Intergenic
1036687727 8:10923100-10923122 CCACAGAAGCAGGAGGGGTATGG - Intronic
1037449633 8:19003733-19003755 CCACACTGGCAGGGGGTGGGGGG + Intronic
1038336719 8:26651478-26651500 CCAAACAGGCAGGAAGAAGCGGG + Intronic
1038781079 8:30568949-30568971 GAACATAGGCAGGAGGAGGGCGG - Intronic
1038834865 8:31108329-31108351 ACACACAGGCAGGCTGAGAAAGG - Intronic
1039371052 8:36984243-36984265 CCTGACAGGCTGGAGGAGGAGGG + Intergenic
1039436608 8:37563856-37563878 CCACAAAAGCAGAAGGAAGAAGG + Intergenic
1039609528 8:38908232-38908254 CCACACCAGCAGGAGAAAGAGGG + Intronic
1040817701 8:51526566-51526588 ATACAGAGGCAGGAGGAGGTTGG - Intronic
1040981043 8:53246412-53246434 CATGACAGGCAGGAGGATGAAGG + Intronic
1041685000 8:60635839-60635861 CAACACAGGCAGAAGAAAGAAGG - Intergenic
1042764766 8:72308886-72308908 TCACACAGGCAGCAGCTGGATGG + Intergenic
1042865938 8:73356775-73356797 ACACAGAGGAAGGAGGAGGCCGG - Intergenic
1043765753 8:84130063-84130085 CAAAAGAGGCAGGAAGAGGAGGG - Intergenic
1044805616 8:96005537-96005559 ACACACCTGCAGGAGGATGAAGG + Intergenic
1045379635 8:101610428-101610450 CCACCCAGGCAGGAGCATTAGGG + Intronic
1045479631 8:102581667-102581689 GGACACTGGCAGGAGGAGGCTGG + Intergenic
1046131671 8:109974551-109974573 CCCTAGCGGCAGGAGGAGGAAGG - Exonic
1047197557 8:122735237-122735259 ACACACAGGGAGAGGGAGGAAGG - Intergenic
1048133011 8:131718361-131718383 CCACTCAGGCTGCAGCAGGATGG - Intergenic
1048619806 8:136119219-136119241 CCATAAAGGGAGGATGAGGAGGG - Intergenic
1049306502 8:141906956-141906978 CCCCACATGCAGCAGGAGGAAGG - Intergenic
1049362540 8:142219243-142219265 CCAGACAGGCAGGAGGAAGGAGG + Intronic
1049366005 8:142237200-142237222 CCACGCAGGGAGAAGCAGGAGGG - Intronic
1049526697 8:143130447-143130469 CCACACGGGTAGTAGGAGGCAGG + Intergenic
1049654357 8:143791290-143791312 CCAGGCCCGCAGGAGGAGGATGG - Exonic
1049665237 8:143840070-143840092 TCACCCAAGCAGGATGAGGAGGG + Intronic
1049756969 8:144315091-144315113 CCACTCAGCCTGGTGGAGGAAGG + Exonic
1049831879 8:144705871-144705893 CCACAGAGGCTGCAAGAGGAGGG - Intergenic
1050394170 9:5177795-5177817 CCAAACAGTCCAGAGGAGGAAGG + Intronic
1053290696 9:36878038-36878060 CCACAAAACCTGGAGGAGGAAGG + Intronic
1054460469 9:65459569-65459591 CCACAGAGGCTGGAGAAGCAGGG + Intergenic
1055002998 9:71474669-71474691 CCACACAGGTTGGGGGAGAAGGG + Intergenic
1056130873 9:83585238-83585260 CCACTCAGCCAGGAGGAACAAGG + Intergenic
1056554641 9:87678358-87678380 GGACACAGGCAGGAGGAGGCTGG + Intronic
1056578845 9:87876011-87876033 CCACCCAGGCAGGACCTGGACGG + Intergenic
1056797876 9:89671310-89671332 CCACACAGGCAGGTGCTGGGAGG - Intergenic
1056958507 9:91101601-91101623 CCCTACAGGCAGGAGGGGGACGG - Intergenic
1057883272 9:98808790-98808812 ACACGCTGGCAGCAGGAGGAAGG + Intronic
1057884779 9:98822070-98822092 CAAACTAGGCAGGAGGAGGAGGG - Intronic
1058560134 9:106219383-106219405 GCAGAAAGGAAGGAGGAGGAAGG - Intergenic
1058985876 9:110207933-110207955 GGAGACAGGCAGGAGGAGGCAGG + Exonic
1059409495 9:114123274-114123296 GCATACAGGCAGGAGGTGGTGGG + Intergenic
1059689412 9:116670345-116670367 CCACAAGGGCAGGAGGTAGAAGG + Intronic
1060104862 9:120867218-120867240 GCTCACAGGCAAGTGGAGGATGG + Intronic
1060997823 9:127885075-127885097 TCACACAGGCAGGGTGAGGTGGG + Intergenic
1061079395 9:128361060-128361082 CCACCCAGGGAGGAGGATGGGGG - Exonic
1061191316 9:129084343-129084365 TCACACAGCCAGAAGGAGGTGGG - Intronic
1061678119 9:132229658-132229680 CCAGACATGGAGGTGGAGGAAGG + Intronic
1061694161 9:132358591-132358613 CCACACAGACATGGGGAGAAGGG - Intergenic
1061902515 9:133680350-133680372 CCTCACAGGCAGGTGGGAGATGG - Intronic
1062044728 9:134419750-134419772 CCACACAGGGAGGTGGAGCCAGG + Intronic
1062053663 9:134459738-134459760 CCACAGAGCCAGCAGGAGGGAGG - Intergenic
1062141182 9:134959956-134959978 CCCTGCAGGCAGGAGGAGGACGG + Intergenic
1062238820 9:135525244-135525266 CCACCCAGGTAGGAGTGGGATGG - Intronic
1062254525 9:135614773-135614795 CCACACAGGGAGGAGGAGCTGGG - Intergenic
1062414802 9:136442822-136442844 CCAGATAGGCCGGAGGAGAAAGG + Intronic
1062415655 9:136448314-136448336 CCACAGAGACACCAGGAGGATGG + Intronic
1062415664 9:136448352-136448374 CCACAGAGACACCAGGAGGATGG + Intronic
1062415675 9:136448389-136448411 CCACAGAGACACCAGGAGGATGG + Intronic
1062415686 9:136448426-136448448 CCACAGAGACACCAGGAGGATGG + Intronic
1062415694 9:136448463-136448485 CCACAGAGACACCAGGAGGATGG + Intronic
1062415705 9:136448501-136448523 CCACAGAGACACCAGGAGGATGG + Intronic
1062415739 9:136448647-136448669 CCACAGAGACACCAGGAGGATGG + Intronic
1062415757 9:136448721-136448743 CCACAGAGACACCAGGAGGATGG + Intronic
1062415768 9:136448759-136448781 CCACAGAGACACCAGGAGGATGG + Intronic
1062415777 9:136448797-136448819 CCACAGAGACACCAGGAGGATGG + Intronic
1062435996 9:136546778-136546800 GCGCCCGGGCAGGAGGAGGACGG - Intergenic
1062583456 9:137238227-137238249 CGACAGCTGCAGGAGGAGGAGGG + Intergenic
1062635377 9:137487803-137487825 CCTGACAGGCAGGTGGAGGCTGG - Intronic
1062689535 9:137834161-137834183 CCACACAGCGAGGAGAAGGCTGG + Intronic
1186917488 X:14239129-14239151 TCAACCAGGCAAGAGGAGGAAGG - Intergenic
1186979119 X:14939939-14939961 CCACAGTGGGAGGGGGAGGAGGG - Intergenic
1187591442 X:20721561-20721583 TCTCTCAGGTAGGAGGAGGAGGG - Intergenic
1189200976 X:39195390-39195412 CCAGACAGGCAGGAGGCAGGAGG + Intergenic
1189240172 X:39518817-39518839 CCCCACTGGCAGGAGGGGAATGG + Intergenic
1189267277 X:39726432-39726454 CCACACAGACTGGAGGGAGATGG - Intergenic
1189304839 X:39979217-39979239 CCACACAGCCAGGGAGAGGCTGG - Intergenic
1189839554 X:45059514-45059536 ACACTCAGGCAGAAGGAGGGTGG + Intronic
1190453559 X:50603938-50603960 TGACACAGACAGGTGGAGGATGG - Intronic
1190468130 X:50747800-50747822 CAAGACTGGCAGGAGGAGAAGGG + Intronic
1190625694 X:52336637-52336659 CCAAGCAGGCAGGGGGAGGGAGG - Intergenic
1195108818 X:101624915-101624937 TCACTCAGGCTGGGGGAGGAAGG - Exonic
1195856691 X:109339310-109339332 ACACACCAGCAGGAGGAGGCTGG + Intergenic
1197815143 X:130490403-130490425 CCAAACAGGCAGCAGCATGAGGG - Intergenic
1197841311 X:130750046-130750068 GCAGACAGGCAGAGGGAGGAAGG - Intronic
1198674267 X:139115456-139115478 CCAGTCAGGAAGGAGGAGGATGG - Intronic
1199843330 X:151672823-151672845 CCACACATGCAGAAGGATGATGG - Intronic
1200114906 X:153765728-153765750 GAACACAGGCAGGAAGAGCACGG - Intronic
1201730202 Y:17193983-17194005 GAACACAGGCAGGAGGAGAAGGG - Intergenic