ID: 968733337

View in Genome Browser
Species Human (GRCh38)
Location 4:2282174-2282196
Sequence GCAGCCGGTGCGGGAGTGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968733337_968733342 12 Left 968733337 4:2282174-2282196 CCAGACACTCCCGCACCGGCTGC 0: 1
1: 0
2: 0
3: 8
4: 157
Right 968733342 4:2282209-2282231 TCCTGCCACTCTCTTACAGAAGG 0: 1
1: 0
2: 2
3: 19
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968733337 Original CRISPR GCAGCCGGTGCGGGAGTGTC TGG (reversed) Intronic
901676598 1:10889101-10889123 CCAGCCGGGGCGGGCGTGCCGGG - Intergenic
902614445 1:17616210-17616232 GCTGCCCGAGCGGGAGGGTCTGG + Intronic
902808898 1:18877321-18877343 GCAGCCGGGGCTGGGGTGTGCGG - Intronic
904210453 1:28883776-28883798 GCAGCCGGTGTGGCCGTTTCGGG - Intergenic
904263234 1:29303301-29303323 GCAGCCAGTGGGGGAGTGGGTGG - Intronic
905807518 1:40887508-40887530 GAAGCCGGTGGGGGAGTGCAAGG + Intergenic
906320626 1:44813370-44813392 GCAGGCGGTGCTGGAGCGGCCGG + Exonic
906948488 1:50315754-50315776 GCAGCCTGTGCAGGGGTGTGGGG - Intergenic
908620625 1:65975696-65975718 ACAGCTGGAGCTGGAGTGTCTGG - Intronic
918757706 1:188358143-188358165 ACAGCCGGAGCTGGAGTGGCTGG + Intergenic
919924340 1:202184758-202184780 GCGGCTGGTGCGGGAGTAGCAGG + Intergenic
919942457 1:202297702-202297724 GGAGCCGGGGCGGGAGGGTGGGG - Intronic
920914920 1:210251801-210251823 GCAGTGGGTGTGGGTGTGTCCGG + Intergenic
922415046 1:225413842-225413864 GGAGCCAGTGGGGGAGTGGCTGG - Intronic
924502855 1:244653165-244653187 GCAGCCGGGGCGGAAGCATCGGG - Exonic
1062950858 10:1502200-1502222 GCAGCAGGTGCAGGAGGGGCCGG - Intronic
1063603924 10:7506671-7506693 GCAGCTGGAGCGAGAGTGTGGGG + Intergenic
1067290341 10:44935237-44935259 CCAGCCAGTGTGGGGGTGTCTGG - Exonic
1072634710 10:97170487-97170509 CCAGCCGGTGCTGGACTGGCAGG + Intronic
1073113129 10:101074441-101074463 GCAGCCGGTGGGGGAGAATAAGG + Intergenic
1073575357 10:104618422-104618444 TTAGCCGGTGCGGGAGGGTGTGG + Intergenic
1074592097 10:114822374-114822396 GGAGCCGGGGCGGGGGTGCCGGG + Intronic
1075913459 10:126146269-126146291 GCAGCCTGTGAGGGAGAGGCAGG + Intronic
1076687678 10:132205366-132205388 GGAGCGGCTGCGGGAGTGTAGGG - Exonic
1077018366 11:406816-406838 GGAGCAGGCGCGGGAGGGTCCGG - Intronic
1077196180 11:1281533-1281555 GCACCCTGTGCGGGGGTCTCTGG + Intronic
1077446332 11:2592723-2592745 GCAGCCGGGCTGTGAGTGTCAGG - Intronic
1085283599 11:75346101-75346123 GCTGCAGGTGTGGGAGTGTGAGG - Intronic
1087497581 11:98910036-98910058 ACAGCTGGAGCTGGAGTGTCTGG - Intergenic
1087708384 11:101521268-101521290 GCAGCTGGAGCTGGAGTGGCTGG - Intronic
1088094128 11:106077966-106077988 GCGGCCAGCGCGGGAGTGTCGGG - Intronic
1092917879 12:13204398-13204420 GCAGCCGGAGAGGATGTGTCTGG - Intronic
1098559120 12:71852224-71852246 ACAGCTGGAGCTGGAGTGTCTGG + Intronic
1101606069 12:106248192-106248214 GAAGCCGGCGCGGGGGTGGCTGG + Intronic
1104777285 12:131397894-131397916 ACAGCTGGAGCTGGAGTGTCTGG + Intergenic
1104802455 12:131563882-131563904 GCAGCCTGTGAGGGGGTGTTAGG - Intergenic
1106521099 13:30498424-30498446 GCAGCAGGAGCGGGAGGGGCTGG + Intronic
1108541684 13:51452325-51452347 GCGGCCGGGGCGGGGGTGTCGGG - Intronic
1108686803 13:52826641-52826663 GCGGGAGGTGCGGGAGTGGCAGG + Intergenic
1113612957 13:111661109-111661131 CAAGCAGGTGCGGGAGTGCCAGG - Intronic
1115851649 14:37594669-37594691 GCAGCCGGAGAGGGAGTTTTAGG - Intronic
1122960922 14:105093370-105093392 GCAGGCGGTGAGGGGCTGTCGGG - Intergenic
1123875730 15:24622039-24622061 GCAGCCTGTGCTAGACTGTCAGG - Intergenic
1132466209 16:78400-78422 GCCGCGGGAGCGGGAGTGCCGGG + Intronic
1132671644 16:1104356-1104378 GCAGCTGGTGCAGGAGCCTCAGG - Intergenic
1135755253 16:25091932-25091954 GCAGGTGGTGTGGGAGTGGCTGG - Intergenic
1135942631 16:26836074-26836096 GCACACGGTGCGGGACTGGCAGG - Intergenic
1138507769 16:57486610-57486632 GAAGCGGGTGCGGGGGTGCCAGG - Intronic
1138889844 16:61128838-61128860 GGAGCCGGTGGGGGAGGGGCGGG + Intergenic
1139697414 16:68685030-68685052 GCAGCAGGTGCAGGAGTCCCAGG - Intronic
1142214836 16:88825278-88825300 GCAGCCGGGGCTGGGGTGCCTGG + Intronic
1142214931 16:88825529-88825551 GCAGCCGGGGCTGGGGTGCCTGG + Intronic
1142673394 17:1498030-1498052 GCCGGCGGTATGGGAGTGTCGGG + Exonic
1143184622 17:5002857-5002879 GCATCCGGTGGGGGAGTGGGGGG - Intronic
1144724803 17:17496486-17496508 GGAGCCGGTGCGGGGGAGGCGGG - Intergenic
1149034800 17:52121802-52121824 GCAGCAGGGGCAGGATTGTCTGG - Intronic
1151717716 17:75839949-75839971 GGAGCAGGTGGAGGAGTGTCAGG + Intronic
1152210466 17:79000512-79000534 GCAGGTGGCGAGGGAGTGTCAGG - Intronic
1152275929 17:79357092-79357114 CCAGCGGGTGTGGGCGTGTCTGG - Intronic
1152570524 17:81119487-81119509 GCAGCCGGGGCGGGTGCGGCCGG + Exonic
1154214864 18:12408300-12408322 GCAGCCGGAGCGGGGGCGGCCGG + Intronic
1157449085 18:47772188-47772210 GCAGCCCAAGCGGGGGTGTCAGG + Intergenic
1158620950 18:59032068-59032090 GCTGCCGGTGTGGGAGTGCGGGG - Intergenic
1160932782 19:1578498-1578520 GCAGCAGGTGCGGAAGCGGCTGG - Exonic
1161719368 19:5894617-5894639 GCAGCCGGTGAGGGCGGATCTGG - Intronic
1162130368 19:8522577-8522599 GCAGGGGGTAGGGGAGTGTCTGG - Intronic
1162476798 19:10905262-10905284 GGAGCCGGTGAGGGAGGGTCTGG - Intronic
1164120562 19:22261764-22261786 GCGGGCGGGGCGGGGGTGTCGGG + Intergenic
1164835167 19:31351048-31351070 GCAGCCGGTGCTGGAGCGCGGGG - Intergenic
1166132051 19:40751507-40751529 CCAGCCCGTGCGGGACAGTCTGG - Intronic
1167120772 19:47515135-47515157 GCGGCTGGTGGGGGCGTGTCCGG - Exonic
1168273807 19:55265349-55265371 GCAGGGTGTGCGCGAGTGTCGGG - Exonic
927481048 2:23454220-23454242 GGGGCCGGGGCGGGAGGGTCAGG - Intronic
927507617 2:23624671-23624693 ACAGCCTGTGGGGGAGTCTCTGG + Intronic
931223565 2:60309942-60309964 GCAGCAGGGGCGGGAGGGTTGGG + Intergenic
931762678 2:65431605-65431627 GAAGCCGGAGTGGGGGTGTCAGG + Intronic
934954026 2:98601709-98601731 GCAGCAGGAGAGGGAGTGTTAGG + Intronic
935997207 2:108787023-108787045 GCAGCCACGGCGGGAGTGCCGGG - Intronic
936014534 2:108947681-108947703 GCAGCTGGAGCTGGAGTGGCTGG + Intronic
936389100 2:112055534-112055556 GCACCAGGTGCGGGTGTGGCAGG + Exonic
945777902 2:214130204-214130226 GCAGCCGGTGTGAGAGTTTGAGG + Intronic
948069192 2:235106197-235106219 GCAGCCGCTCCTGGAGTGACAGG - Intergenic
948609610 2:239158567-239158589 GCAGCAGGTGCAGGAGGGGCTGG + Intronic
948746125 2:240095580-240095602 GCTGCGGGTGCAGGAGTCTCGGG + Intergenic
1168861931 20:1051838-1051860 GCAGCCGGGGTGGGAGGATCTGG - Intergenic
1169423468 20:5477924-5477946 GCTGCAGGAGCGGGAGTGGCAGG - Intergenic
1170863763 20:20134369-20134391 GCATCAGGTGAGGGAGTGGCAGG + Intronic
1173516140 20:43666943-43666965 GCAGCCGGCCCTGGAGGGTCTGG + Intergenic
1173538175 20:43831680-43831702 GCAGCCGGTGGGGATGTGTGTGG + Intergenic
1173752381 20:45487490-45487512 GCAGCCGGTGGGGCAGCGGCTGG - Intergenic
1175698960 20:61123629-61123651 GCAGCCTCTGCGGGACTGGCTGG - Intergenic
1176171188 20:63697102-63697124 GAAGCCGGTGCGGCAGCGGCAGG - Exonic
1177218639 21:18161731-18161753 GCAGCCTGTGCTGGGGTGTAGGG - Intronic
1177795966 21:25778736-25778758 GCAGCCGGTGCGGGATCCACTGG + Intergenic
1177835760 21:26184707-26184729 GCAGCTGGAGCTGGAGTGGCTGG + Intergenic
1181091054 22:20472889-20472911 GCAGCCGGGGAGGGAGTTCCAGG + Intronic
1183418552 22:37697042-37697064 GCTGCCGGGGTGGGAGTGCCAGG - Exonic
1184817791 22:46885156-46885178 GCAGCGGGTGGGAGAGTGGCTGG + Intronic
950575815 3:13831570-13831592 GCAGCTGCAGAGGGAGTGTCTGG - Intronic
953975815 3:47381051-47381073 GCAGCAGCTACGGGAGTGGCCGG + Exonic
961463678 3:127068759-127068781 GAAGCCTGGGCGGGAGTGGCTGG - Intergenic
968733337 4:2282174-2282196 GCAGCCGGTGCGGGAGTGTCTGG - Intronic
968884240 4:3318755-3318777 GCTGCCAGTGTGGGAGTGTGCGG + Intronic
969107951 4:4822255-4822277 GCAGCTGGAGCTGGAGTGGCTGG - Intergenic
985634788 5:1030705-1030727 GCAGCCAGTCCCGGAATGTCGGG + Intronic
985867198 5:2523338-2523360 GCTGCCGCTCCAGGAGTGTCTGG - Intergenic
987201736 5:15584085-15584107 GCAGCTGGAGCTGGAGTGGCTGG + Intronic
988687376 5:33538233-33538255 GCAGCAGGTGAGGGAGAGTGGGG + Intronic
990760842 5:59127628-59127650 AAAGCCGGTGCTGGAGTGTGGGG - Intronic
993364678 5:87020745-87020767 GCAGCCTGTGTGGCAGTGTTTGG - Intergenic
996027801 5:118668249-118668271 GCAGCCGGTGGGGGGGTGTTTGG + Intergenic
998385901 5:141756983-141757005 GTAGGGGGTGCGGGAGTGTCAGG - Intergenic
998651497 5:144126082-144126104 GCAGAAGGTGCAGGAGTGACTGG - Intergenic
999305974 5:150519892-150519914 GCAGGCGGTGCGGGGGGTTCAGG + Intronic
1002167654 5:177358319-177358341 GCAGCAGGTGAGGGAGTGGTGGG - Intronic
1003112110 6:3259186-3259208 GCAGCCGCTACGTGAGTGCCTGG + Exonic
1004345399 6:14844577-14844599 GCAGCCGGTGGGGGAGGCTTGGG - Intergenic
1004492387 6:16129138-16129160 GCAGCGGGTGAGGGGGTGGCGGG + Exonic
1004502086 6:16218194-16218216 GCACACGGTGCGGGACTGGCAGG - Intergenic
1009864042 6:69374401-69374423 GCAGGCGGAGCAGGAGTGTCAGG - Intronic
1009936673 6:70242296-70242318 GCAGGCAGTGCGGGGGTGGCGGG - Intronic
1018163664 6:161073462-161073484 GCAGCTGGTGAGAGAGTGTAAGG + Exonic
1018651060 6:165991529-165991551 GCAGCCAGTGCAGGAGTTCCTGG + Intergenic
1020050450 7:5078017-5078039 GAAGCAGGGGCTGGAGTGTCTGG - Intergenic
1021096307 7:16539702-16539724 GCAGCTGGAGCTGGAGTGGCTGG - Intronic
1023861572 7:44220304-44220326 GCAGGCGGGGCGGGGGTCTCGGG + Intronic
1023999185 7:45179766-45179788 GCAGCCGGTGAGGGCTTGCCCGG + Intronic
1024283624 7:47738909-47738931 GCAGCAGGTGGGGGAGGGTCTGG - Intronic
1026854450 7:73743751-73743773 GCAGCAGGTGCGGGTGAGGCAGG - Intergenic
1027665963 7:81043095-81043117 GCACACGGTGCGGGACTGGCAGG + Intergenic
1028557974 7:92143344-92143366 GCACACGGTGCGGGATTGACAGG - Intronic
1031557655 7:123198290-123198312 GGAGCCGGGGTGGGAGTGGCAGG + Intronic
1031604223 7:123749024-123749046 GCCGCCGCTGCGGGAGGGTTGGG - Exonic
1032122857 7:129169304-129169326 GCAGGCGGGGCGGGCGCGTCCGG + Intronic
1032843604 7:135734218-135734240 GCAGACGGTGCGGAAGTCTGAGG + Exonic
1035303881 7:157917163-157917185 GCAGCCTGTCCTGGAGTGGCCGG - Intronic
1037884720 8:22589908-22589930 GCTGACGGTCCGGGAGGGTCCGG + Intronic
1040014544 8:42689899-42689921 GCGCCCGGTGCGGGACTGGCAGG + Intergenic
1044008756 8:86966318-86966340 GGAGCGGGTGCTGGTGTGTCCGG + Intronic
1045432152 8:102124160-102124182 GCAGCCGGGGCGGGTGTGCCGGG - Intronic
1045933802 8:107655985-107656007 GCACGCGGTGCGGGACTGGCAGG + Intergenic
1048223704 8:132565600-132565622 GCAGCCGGAGCGCCAGTTTCTGG + Intergenic
1049377330 8:142295462-142295484 GCAGCTGGAGCGGGCCTGTCTGG + Intronic
1049386298 8:142344650-142344672 GCACCTGGTGAGGCAGTGTCAGG - Intronic
1049684524 8:143933982-143934004 GCAGTCGGTGAGGGGGTGTGGGG - Exonic
1053157538 9:35791512-35791534 GCAGCCGGCGCCGGAGGGTGGGG + Intergenic
1056766391 9:89447080-89447102 GCAGCGGGCGAGGGAGGGTCGGG - Intronic
1061406473 9:130395269-130395291 GCAGCTGGTCCTGGAGTGTTCGG + Intronic
1062519663 9:136952399-136952421 GCATCGGGGGCGGGAGTGGCAGG - Exonic
1185445105 X:253747-253769 GCAGCCGGTACAGGAGCCTCCGG - Intergenic
1187139120 X:16575838-16575860 GCACACGGTGCGGGACTGGCAGG + Intergenic
1187650001 X:21391515-21391537 GCAGCTGGAGCTGGAGTGGCTGG + Intronic
1188657598 X:32717323-32717345 ACAGCTGGAGCTGGAGTGTCTGG - Intronic
1191214151 X:57918742-57918764 GCAGCAGGAGAGGGAGTCTCTGG - Intergenic
1200684255 Y:6245529-6245551 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1200686894 Y:6265857-6265879 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1200989772 Y:9336774-9336796 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1200992440 Y:9357107-9357129 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1200995092 Y:9377385-9377407 GCTGCGGGTGCGGGAGCCTCTGG + Intronic
1200997757 Y:9397731-9397753 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1201000267 Y:9466265-9466287 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1201002928 Y:9486577-9486599 GCTGCGGGTGCGGGAGCCTCTGG + Intronic
1201005586 Y:9506860-9506882 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1201008247 Y:9527190-9527212 GCTGCGGGTGCGGGAGCCTCTGG + Intergenic
1201010848 Y:9547375-9547397 GCTGCGGGTGCGGGAGCTTCTGG + Intergenic
1201048379 Y:9908857-9908879 GCTGCGGGTGCGGGAGCCTCTGG - Intergenic