ID: 968737391

View in Genome Browser
Species Human (GRCh38)
Location 4:2304467-2304489
Sequence AGAAGATGCCTCCAACGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968737391_968737403 11 Left 968737391 4:2304467-2304489 CCCGCCCGTTGGAGGCATCTTCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 968737403 4:2304501-2304523 CGCCTCCTCCTGTCTCTCAGGGG 0: 1
1: 1
2: 3
3: 52
4: 338
968737391_968737401 9 Left 968737391 4:2304467-2304489 CCCGCCCGTTGGAGGCATCTTCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 968737401 4:2304499-2304521 GGCGCCTCCTCCTGTCTCTCAGG 0: 1
1: 1
2: 5
3: 35
4: 356
968737391_968737407 23 Left 968737391 4:2304467-2304489 CCCGCCCGTTGGAGGCATCTTCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 968737407 4:2304513-2304535 TCTCTCAGGGGCCCTGTCGCTGG 0: 1
1: 0
2: 1
3: 18
4: 255
968737391_968737402 10 Left 968737391 4:2304467-2304489 CCCGCCCGTTGGAGGCATCTTCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 968737402 4:2304500-2304522 GCGCCTCCTCCTGTCTCTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 208
968737391_968737408 29 Left 968737391 4:2304467-2304489 CCCGCCCGTTGGAGGCATCTTCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 968737408 4:2304519-2304541 AGGGGCCCTGTCGCTGGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968737391 Original CRISPR AGAAGATGCCTCCAACGGGC GGG (reversed) Exonic