ID: 968737393

View in Genome Browser
Species Human (GRCh38)
Location 4:2304471-2304493
Sequence CCTCAGAAGATGCCTCCAAC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 134}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968737393_968737401 5 Left 968737393 4:2304471-2304493 CCCGTTGGAGGCATCTTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 968737401 4:2304499-2304521 GGCGCCTCCTCCTGTCTCTCAGG 0: 1
1: 1
2: 5
3: 35
4: 356
968737393_968737407 19 Left 968737393 4:2304471-2304493 CCCGTTGGAGGCATCTTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 968737407 4:2304513-2304535 TCTCTCAGGGGCCCTGTCGCTGG 0: 1
1: 0
2: 1
3: 18
4: 255
968737393_968737408 25 Left 968737393 4:2304471-2304493 CCCGTTGGAGGCATCTTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 968737408 4:2304519-2304541 AGGGGCCCTGTCGCTGGCCTTGG 0: 1
1: 0
2: 1
3: 17
4: 250
968737393_968737403 7 Left 968737393 4:2304471-2304493 CCCGTTGGAGGCATCTTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 968737403 4:2304501-2304523 CGCCTCCTCCTGTCTCTCAGGGG 0: 1
1: 1
2: 3
3: 52
4: 338
968737393_968737402 6 Left 968737393 4:2304471-2304493 CCCGTTGGAGGCATCTTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 968737402 4:2304500-2304522 GCGCCTCCTCCTGTCTCTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968737393 Original CRISPR CCTCAGAAGATGCCTCCAAC GGG (reversed) Exonic