ID: 968737402

View in Genome Browser
Species Human (GRCh38)
Location 4:2304500-2304522
Sequence GCGCCTCCTCCTGTCTCTCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968737393_968737402 6 Left 968737393 4:2304471-2304493 CCCGTTGGAGGCATCTTCTGAGG 0: 1
1: 0
2: 0
3: 9
4: 134
Right 968737402 4:2304500-2304522 GCGCCTCCTCCTGTCTCTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 208
968737392_968737402 9 Left 968737392 4:2304468-2304490 CCGCCCGTTGGAGGCATCTTCTG 0: 1
1: 0
2: 0
3: 7
4: 67
Right 968737402 4:2304500-2304522 GCGCCTCCTCCTGTCTCTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 208
968737391_968737402 10 Left 968737391 4:2304467-2304489 CCCGCCCGTTGGAGGCATCTTCT 0: 1
1: 0
2: 0
3: 7
4: 75
Right 968737402 4:2304500-2304522 GCGCCTCCTCCTGTCTCTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 208
968737395_968737402 5 Left 968737395 4:2304472-2304494 CCGTTGGAGGCATCTTCTGAGGG 0: 1
1: 0
2: 0
3: 13
4: 134
Right 968737402 4:2304500-2304522 GCGCCTCCTCCTGTCTCTCAGGG 0: 1
1: 0
2: 1
3: 30
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968737402 Original CRISPR GCGCCTCCTCCTGTCTCTCA GGG Exonic