ID: 968738601

View in Genome Browser
Species Human (GRCh38)
Location 4:2314328-2314350
Sequence GCTGCTGTTTCAACCCAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 184}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968738600_968738601 -5 Left 968738600 4:2314310-2314332 CCAAGTACAGCTGTTGTTGCTGC 0: 1
1: 0
2: 0
3: 20
4: 180
Right 968738601 4:2314328-2314350 GCTGCTGTTTCAACCCAGACTGG 0: 1
1: 0
2: 0
3: 19
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968738601 Original CRISPR GCTGCTGTTTCAACCCAGAC TGG Intronic
900233926 1:1577576-1577598 GGCGCTGTTGCAACCCAGCCAGG + Intergenic
900679494 1:3908845-3908867 GATGTTGTTCCCACCCAGACAGG - Intergenic
901130307 1:6958400-6958422 TCTGCTCTTTCATCCCAGCCTGG + Intronic
901866902 1:12112311-12112333 GCTGGAGTTTGAACCCAGACAGG + Intronic
903370511 1:22832136-22832158 CCTGCTGTTGCACCCCAGCCTGG - Intronic
904029162 1:27523286-27523308 TCTGGTGCTTCAACCCAGACTGG + Intergenic
906939525 1:50244181-50244203 GAAGCTGTTTCAGCACAGACAGG + Intergenic
908536548 1:65083803-65083825 GCTACTGTTGAAACCCAGCCAGG + Intergenic
910730683 1:90392536-90392558 TTTGCTGGCTCAACCCAGACAGG - Intergenic
912008544 1:104932719-104932741 GGTGCTGTTGCAACCTGGACCGG + Intergenic
915602480 1:156930876-156930898 TCTGCTGTCTCAACTCAGCCAGG + Intronic
916389449 1:164315291-164315313 CCTCCTGGTTCAGCCCAGACGGG - Intergenic
916721962 1:167490906-167490928 CTTGCTCTGTCAACCCAGACTGG - Intronic
916853515 1:168727160-168727182 GCTGCTGCCTCCACCCAGAGTGG - Intronic
919519699 1:198572615-198572637 GCTGCAGTTGCAACACAGACTGG + Intergenic
920359080 1:205400094-205400116 GTCGCTTTGTCAACCCAGACTGG + Intronic
921276567 1:213526428-213526450 GCTGATGTTTCACCCCAGCTAGG + Intergenic
923042536 1:230329746-230329768 GCTGCTGGGTCAACCCAGCCTGG + Intronic
923142114 1:231169405-231169427 TCTGCTCTTATAACCCAGACTGG + Intronic
924587705 1:245374598-245374620 GCTGCTGTGTCTACCCAGTCAGG + Intronic
1064507698 10:16050985-16051007 GCCTCAATTTCAACCCAGACAGG - Intergenic
1068517730 10:58044919-58044941 GTTGCTTTTTCCACCCAGACAGG + Intergenic
1069620276 10:69833218-69833240 GCTGCAGTTTCCACCCTCACAGG - Intronic
1070669336 10:78367125-78367147 TCTGTTGTTTCAACACAGAGAGG - Intergenic
1070948966 10:80415533-80415555 GCTTCTGTGGCTACCCAGACTGG + Intronic
1073006679 10:100330219-100330241 GCAGCTGTTTCCACACAGCCTGG + Exonic
1075068616 10:119306154-119306176 TCTGCTGTTTCCAACCAGAGAGG - Intronic
1075092666 10:119452357-119452379 GCTCCTGTGTCACCCCAGCCAGG + Intronic
1077862205 11:6192312-6192334 GCTGCTCCTTCAACCCTGAAGGG + Intergenic
1078141031 11:8693268-8693290 GATGGTGTTTCATCCCTGACTGG + Intronic
1080452403 11:32389326-32389348 GCTGCTGTTTCAAGGCTGCCTGG - Intronic
1082226087 11:49709058-49709080 GCTGCTGATTCAAACCATATAGG + Intergenic
1083707735 11:64527792-64527814 TATTCTGTTTCAACCCTGACTGG - Intergenic
1083916006 11:65744199-65744221 GGTGCTGTTGCAACCCAGCTGGG + Intergenic
1083998111 11:66282218-66282240 GCTGCTGCCCCAACCCTGACGGG + Intronic
1084062537 11:66685668-66685690 TCTGCTGTTTAATTCCAGACTGG - Exonic
1086623004 11:88910685-88910707 GCTGCTGATTCAAACCATATAGG - Intronic
1089139193 11:116272865-116272887 CCAGCTGTATCAACCCAGCCAGG + Intergenic
1089172845 11:116527453-116527475 GCTCCTGTTCCAACTCAGAAGGG - Intergenic
1094763077 12:33557545-33557567 CCAGCTGGTTCCACCCAGACTGG + Intergenic
1095361777 12:41350868-41350890 ACTGCTGTTTCTACCCTGAGAGG - Intronic
1096334816 12:50746029-50746051 GCTGCTTTGGCAACCCAGATTGG - Exonic
1096755364 12:53795012-53795034 GATGCTGCTTCAAACCAAACAGG - Intergenic
1097806320 12:63968631-63968653 GCTACCGTTTCAACCCTGTCAGG + Intronic
1099441885 12:82708653-82708675 CCTGCTGTTTCATCTCAGAATGG + Intronic
1102029119 12:109729968-109729990 GCTGGGGCTTGAACCCAGACAGG + Intronic
1103173600 12:118843449-118843471 GGTGCTGTCACAACCCAGCCAGG + Intergenic
1104038908 12:125116767-125116789 GCTGCTGTTAGAACCCAGGTCGG - Intronic
1106766078 13:32915317-32915339 GCTGGGATTTGAACCCAGACAGG + Intergenic
1107077611 13:36340036-36340058 CTTGCTCTTTCAACCCAGGCTGG - Intronic
1107349963 13:39503356-39503378 GCTGCTGTTTGATCAGAGACAGG - Intronic
1109683593 13:65784385-65784407 GGTGCTGTTGCAACCCAGCCAGG - Intergenic
1110730862 13:78877184-78877206 GATGCTGTTGCAACCCAGCCAGG - Intergenic
1110775712 13:79405994-79406016 GTTGCTGTTTCAGCCCGGGCTGG - Exonic
1111072934 13:83193313-83193335 ACTGCTTTTTGAACCCAAACTGG + Intergenic
1112107677 13:96259522-96259544 GCTGCTGAGTCAACTCAAACTGG - Intronic
1115484942 14:33901509-33901531 GGTGCTGTTGCAACCCAGCCAGG + Intergenic
1117336611 14:54761619-54761641 AGTGCTGTGTCCACCCAGACAGG - Intronic
1117955354 14:61119147-61119169 CCAGCTGTTTCCACCCAGCCAGG - Intergenic
1118200168 14:63663921-63663943 GGTGCTGTTGCAATCCAGCCAGG - Intergenic
1118545674 14:66885579-66885601 GCCATTGTTTCAACCCACACTGG + Intronic
1122463987 14:101918285-101918307 GCTTCTGCTTCGACCCAGAGAGG + Intronic
1123579486 15:21703553-21703575 GATGCCGTGTGAACCCAGACAGG + Intergenic
1123616113 15:22146064-22146086 GATGCCGTGTGAACCCAGACAGG + Intergenic
1129483349 15:75844222-75844244 GCTGTTGTTTGAGCCCAGGCCGG + Intronic
1129872637 15:78950493-78950515 GCTGGTGTTTCATCACAGCCAGG + Intergenic
1131949076 15:97661146-97661168 GCTGCTATATCACCACAGACTGG - Intergenic
1202988356 15_KI270727v1_random:437798-437820 GATGCCGTGTGAACCCAGACAGG + Intergenic
1134875374 16:17693539-17693561 GCTGCTCTGTCAACACAGGCAGG + Intergenic
1135534133 16:23279758-23279780 GCAGCTCTTTAAACCCAGCCAGG + Intronic
1135638677 16:24100995-24101017 CCAGCTGGTGCAACCCAGACTGG - Intronic
1136126542 16:28186699-28186721 GTTGCTGTATCACCCCAGACTGG + Intronic
1137338333 16:47573104-47573126 GCAGCTGTCTCAAGCCAGTCTGG - Intronic
1139009322 16:62612947-62612969 GCTGCTGTTTCAAGGTAAACAGG + Intergenic
1139370273 16:66463215-66463237 GCTGCTTTGTGAACACAGACTGG - Intronic
1139625900 16:68188109-68188131 GGTGATGTTGCAACCCAGCCGGG - Intronic
1139795615 16:69481060-69481082 GCAGCTGTTACTGCCCAGACAGG + Intergenic
1141179272 16:81741350-81741372 GCTTCTATTTGAACCCAGTCTGG + Intronic
1142993946 17:3750193-3750215 GCTGAGGTTCAAACCCAGACGGG + Intronic
1143057979 17:4176633-4176655 CCTGCTTTTTCCACCCAGGCCGG - Intronic
1143585583 17:7848755-7848777 GCAGCTGTTTCCACCCGGCCTGG + Exonic
1144676621 17:17166247-17166269 CCTGCTCTGTCAACTCAGACTGG - Intronic
1145360970 17:22212010-22212032 GCTGGGGTTTGAGCCCAGACAGG + Intergenic
1145757530 17:27403600-27403622 GCTGGTATTCCAACCCAGGCCGG + Intergenic
1148581944 17:48750197-48750219 GCTGCTTTTGCGACCAAGACTGG - Intergenic
1149064949 17:52468129-52468151 TCTCATGTTTCAACCCAGAGTGG + Intergenic
1149808406 17:59641165-59641187 GCTGGTGTTTTAACTCAAACTGG + Intronic
1150880698 17:69023436-69023458 GCTGGTGTTTGAATCTAGACTGG + Intronic
1152471994 17:80494670-80494692 GCTGCTGTGTAACCTCAGACAGG + Intergenic
1153723911 18:7936439-7936461 GGTGCTGTCGCAACCCAGCCAGG + Intronic
1155041640 18:22069918-22069940 GCTGCAGATTCACCCCAGGCAGG - Intergenic
1155819114 18:30352681-30352703 GGTGCTCTTGCAACCCAGTCGGG + Intergenic
1160361869 18:78290192-78290214 GCTGGTGTTCCATCCCAGGCAGG - Intergenic
1161726509 19:5932437-5932459 GCTGCTGTTTCTTACCAGTCTGG + Exonic
1164412876 19:28020463-28020485 GCTGCTGCTTTAAACCATACAGG + Intergenic
1164729483 19:30491733-30491755 GCATCTGGTTCAACCCAAACTGG - Intronic
1165285604 19:34839166-34839188 GCGGCTGTTTAGACCCAGACCGG + Intergenic
1166936806 19:46338875-46338897 ACTGCCGTTTGAATCCAGACAGG + Intronic
928840430 2:35598886-35598908 GGTGCTGTAGCAACCCAGATGGG + Intergenic
934699744 2:96430068-96430090 GCTCCTGCTTCAACTCAGAAGGG - Intergenic
935287359 2:101577238-101577260 GCTGCTGTGTGTACCCAGAGAGG - Intergenic
935430301 2:102968663-102968685 GCCGCTTTTTCAACCCAGTATGG + Intergenic
937164108 2:119795525-119795547 GGTGCTGTCACAACCCAGCCAGG - Intronic
939959602 2:148554653-148554675 GCTGCTCTTTCTCCCCAGGCAGG + Intergenic
942046547 2:172102413-172102435 GCTGCTGTTGCCACCCGGGCCGG + Exonic
942585133 2:177466691-177466713 CGTGCTGTTGCAACCCAGCCGGG - Intronic
943064041 2:183068925-183068947 GGTGCTGTCACAACCCAGCCAGG + Intergenic
943388981 2:187238486-187238508 TGGGCAGTTTCAACCCAGACAGG + Intergenic
943947155 2:194081667-194081689 TCTGTTGTTTTAACCCAGCCGGG + Intergenic
945721232 2:213421268-213421290 GGTGCTGTTGCAACCCAGCCAGG + Intronic
946029044 2:216690846-216690868 TCTGCTGTGTCAGCTCAGACTGG - Intronic
946179659 2:217941902-217941924 GCTCCTGTTTCTACCCAGATAGG - Intronic
946199551 2:218063946-218063968 GCTCCTGTTTTTACCCAGATAGG - Intronic
1170094344 20:12629423-12629445 ACTGCTGTGCCAGCCCAGACTGG - Intergenic
1172557539 20:35855411-35855433 GCTGATGTTTTAACCCAACCAGG + Intronic
1173374646 20:42472416-42472438 GCTGCTGGTTGAACACATACTGG + Exonic
1176069899 20:63220773-63220795 GCTGCTCCTGCAACCCAGATGGG + Intergenic
1176274992 20:64260357-64260379 GCTGCGGTCTCGACCCAGGCAGG - Intronic
1180165670 21:46025644-46025666 GTTGCAGTTTCAACTCAGGCAGG - Intergenic
1181313768 22:21959423-21959445 CCTGCTCTTTCAACCCAGCCAGG + Intronic
1181359294 22:22322673-22322695 GCGGCTGCGTCAACACAGACTGG - Intergenic
1181369394 22:22404425-22404447 GCGGCTGCGTCAACACAGACTGG - Intergenic
1182055637 22:27352429-27352451 GCTGGCGTTTCAAACCAGACTGG + Intergenic
1182785967 22:32908041-32908063 GCTGGGATTTTAACCCAGACAGG + Intronic
1183443733 22:37838938-37838960 GCAGCTGTTTCCAGCCAGAATGG - Intronic
1184928276 22:47659671-47659693 GCTGCTAGTTCAACCCAGGGAGG - Intergenic
1185308965 22:50142316-50142338 GCTGCCGTCTCCACCCTGACTGG + Intronic
950665411 3:14492153-14492175 GCTGGGGGTCCAACCCAGACAGG + Exonic
953215520 3:40914390-40914412 GCACCTGTTTCTACCCATACTGG - Intergenic
953669895 3:44953590-44953612 GTTGGAGTTTCTACCCAGACTGG - Intronic
958498466 3:94875118-94875140 AGTGCTGTCTCAACCCAGCCGGG - Intergenic
958925533 3:100153134-100153156 CCTGTTTTTTCAATCCAGACTGG - Intronic
965289863 3:166865252-166865274 GGTGCTGTTGCAACCCTGCCAGG + Intergenic
967954958 3:194870949-194870971 GCTGCTGAGTCAACTCACACAGG + Intergenic
967988349 3:195112967-195112989 GCTGCAGTTGAAACCCAGATTGG - Intronic
968738601 4:2314328-2314350 GCTGCTGTTTCAACCCAGACTGG + Intronic
969906776 4:10404428-10404450 GCTGCTTTTGAAACTCAGACTGG + Intergenic
970326256 4:14928173-14928195 CCTGCTGCTTCCAGCCAGACTGG - Intergenic
970657066 4:18242940-18242962 GCTGCTCTTTAAAGTCAGACAGG - Intergenic
971669870 4:29542900-29542922 GGTGCTGTTGCAACCCAGCCGGG - Intergenic
971714175 4:30153780-30153802 GGTGCTGTTTCAGCCCAGCTGGG - Intergenic
974923215 4:68267746-68267768 TCAGCTGGTACAACCCAGACTGG + Intergenic
974949721 4:68573265-68573287 GTTGGAGTTTTAACCCAGACTGG - Intronic
978149430 4:105415442-105415464 GGTGCTGTTGCAACGCAGCCAGG - Intronic
978312092 4:107396023-107396045 GGTGCTGTTGCACCCCAGCCTGG - Intergenic
978988195 4:115042764-115042786 TCTGCTGTTTGAACTCAGAGAGG + Intronic
982901103 4:161003630-161003652 GCTGCTGTTGCGACCCAGCTGGG - Intergenic
985916082 5:2920069-2920091 AGTGCTGTTGCAACCCAGCCAGG + Intergenic
986003454 5:3648467-3648489 GCTGCTGTTTCTACCAGGAGGGG + Intergenic
986230521 5:5860579-5860601 GCTGCTGTTTCTACCATTACTGG + Intergenic
989386590 5:40860656-40860678 GCTGCTCCATCAACCTAGACAGG - Intergenic
990291609 5:54357694-54357716 CTTGCTCTTTCAACCCAGGCAGG - Intergenic
993794270 5:92248299-92248321 TCTGCTGTTTCAAGCCACCCAGG - Intergenic
995802517 5:116013654-116013676 CCTCCAGTTTCAACCCAGCCTGG - Intronic
995910795 5:117184130-117184152 GTAGATGTTTCAACCAAGACAGG - Intergenic
998451268 5:142236140-142236162 GCTGCAGTTTCCACACAGAATGG - Intergenic
999268080 5:150279933-150279955 CCTGCTGTTTCAGGCCAGAGAGG - Intronic
999318456 5:150599090-150599112 GGGCCTGTTGCAACCCAGACAGG + Intergenic
1000203438 5:159034484-159034506 GCTGGGGTTTCAAGCCAGAGAGG - Intronic
1002425196 5:179170805-179170827 GCTGCTGTTTAATCCCAGGGAGG - Intronic
1003119258 6:3306556-3306578 GCTGGGATTTAAACCCAGACAGG + Intronic
1003825040 6:9943002-9943024 GCTGCAGTGGCAACCCAGTCTGG + Intronic
1006724358 6:36186187-36186209 CCTGCAGTTTGAAACCAGACTGG - Intergenic
1006929350 6:37678378-37678400 GCTGCTGTCACAAGCCAGGCAGG - Intronic
1007058303 6:38911278-38911300 TCTGATGTTTCAACCCTGAGGGG - Intronic
1009674936 6:66806573-66806595 GCTACTCTTTCAAGCCAGAAAGG - Intergenic
1011674335 6:89716945-89716967 GCTTCTGTTTAAACACAGATAGG + Intronic
1012752718 6:103183985-103184007 GGTGCTGTTGCAGCCCAAACAGG + Intergenic
1013647500 6:112159982-112160004 GCAGCTGTGCCCACCCAGACAGG - Intronic
1015096294 6:129417820-129417842 GAGGCTGTTGCAACCCAGCCAGG - Intronic
1016539476 6:145148207-145148229 GCTGCTGTATGAACCCAGGAAGG + Intergenic
1017218197 6:151935042-151935064 GCTGGGGTTTGAACCCAGGCAGG - Intronic
1017539472 6:155385455-155385477 GCTGCTTTTGCACCCCAGACTGG + Intergenic
1017686232 6:156915864-156915886 CTTGCTGTGTCCACCCAGACTGG - Intronic
1018003463 6:159599669-159599691 TCTGTTGTTTCAACCCACTCAGG - Intergenic
1018548940 6:164971004-164971026 GGTGTTGTTTTAACCCACACTGG - Intergenic
1018832897 6:167459353-167459375 GCTGCTATTTCAACACAGTGGGG - Intergenic
1019972147 7:4549797-4549819 GTTGCTGTTCCAGCCCAGGCTGG - Intergenic
1024450126 7:49529995-49530017 CCTGTTATTTCAAGCCAGACTGG + Intergenic
1024561628 7:50649672-50649694 GCTGCTGTGTCGTCCCAGGCTGG + Intronic
1024567228 7:50691334-50691356 GCTGGGATTTGAACCCAGACTGG - Intronic
1027153555 7:75750419-75750441 GCTCCTGGTTCAACCCATAGAGG - Intergenic
1027739343 7:81980339-81980361 GCTGCTTTTTCTACAAAGACAGG - Intronic
1030027571 7:105339846-105339868 GCAGCTGTTTGAAACCAGCCTGG + Intronic
1030112617 7:106039501-106039523 GCTTCGGTTTCAACACTGACGGG - Intergenic
1030866245 7:114704708-114704730 GCTGCTCCTTCAACCAAGGCTGG + Intergenic
1030981177 7:116186604-116186626 GGTGTTGTTGCAACCCAGCCAGG - Intergenic
1032084209 7:128875126-128875148 GCTGCTGTTGCTACCCATATTGG - Intronic
1036442946 8:8797465-8797487 GTTGCTGAGTCAGCCCAGACCGG - Exonic
1037124873 8:15335640-15335662 GCTGCTGTTTAACACCACACTGG + Intergenic
1043195460 8:77287199-77287221 GGTGCTGTTGCAACACAGCCAGG + Intergenic
1043318098 8:78946362-78946384 GCTGCTGTTTCAACCTGGTCTGG - Intergenic
1048693125 8:136989813-136989835 GGTGCTGTTGCAACCCAGCTGGG - Intergenic
1053469687 9:38337469-38337491 GCTGCTTTTACAACCGAGGCTGG - Intergenic
1055040552 9:71866866-71866888 CCTGCTCCTTCAACCCAGAGAGG + Exonic
1056873900 9:90309403-90309425 GCTGCTGTTACTGCCCAGGCTGG + Intergenic
1190369430 X:49727039-49727061 GGTGCTGTTGCAGCCCAGCCGGG + Intergenic
1191178837 X:57537630-57537652 GCTTCTGTTTCAACCCACCCAGG - Intergenic
1195177389 X:102323820-102323842 ACTCCAGTTTCATCCCAGACTGG - Exonic
1195181475 X:102363273-102363295 ACTCCAGTTTCATCCCAGACTGG + Exonic
1195203164 X:102568568-102568590 GCTCAAGTTTCATCCCAGACTGG - Intergenic
1197891650 X:131275530-131275552 GCTGCTGCTACCACCCTGACTGG - Exonic
1199724042 X:150564859-150564881 GCTGCTTTTTAAATACAGACTGG + Intergenic
1200789811 Y:7289273-7289295 GTTGCTCTGTCCACCCAGACTGG - Intergenic