ID: 968742825

View in Genome Browser
Species Human (GRCh38)
Location 4:2339972-2339994
Sequence CAGGGAGCCCCCAGACCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 342}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968742825_968742829 -8 Left 968742825 4:2339972-2339994 CCCTTGGGTCTGGGGGCTCCCTG 0: 1
1: 0
2: 2
3: 32
4: 342
Right 968742829 4:2339987-2340009 GCTCCCTGCAGGAGGAACCCTGG No data
968742825_968742836 30 Left 968742825 4:2339972-2339994 CCCTTGGGTCTGGGGGCTCCCTG 0: 1
1: 0
2: 2
3: 32
4: 342
Right 968742836 4:2340025-2340047 CCGCTCCCCGTCCAGGCCACAGG No data
968742825_968742834 23 Left 968742825 4:2339972-2339994 CCCTTGGGTCTGGGGGCTCCCTG 0: 1
1: 0
2: 2
3: 32
4: 342
Right 968742834 4:2340018-2340040 CTCTTTTCCGCTCCCCGTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968742825 Original CRISPR CAGGGAGCCCCCAGACCCAA GGG (reversed) Intronic
900145568 1:1157495-1157517 CAGGGAGCCTCCAGGCCGATGGG - Intergenic
900244585 1:1631324-1631346 CGGGGAGCTCGGAGACCCAAAGG - Intergenic
900504859 1:3024887-3024909 CAGGGAGCCCACTGACCCTAAGG + Intergenic
901109230 1:6782341-6782363 GAGGGAGCCCCAAGACTCAAGGG - Intergenic
901200049 1:7461672-7461694 CAGGGAACCCCCAGAAGCCAGGG - Intronic
901490806 1:9595394-9595416 CAGGGAGCCTCCAGATTGAAAGG - Intronic
902103213 1:14011085-14011107 TTGGGAGCCCCCAGACCAAGAGG + Intergenic
902669014 1:17959241-17959263 CAGGGAGCTCCCAGTCTCAAAGG - Intergenic
903499930 1:23795210-23795232 CAGGGAGCCCACAGCAGCAAGGG - Exonic
903855808 1:26337030-26337052 CTGGGAGTGCCCAGACCCCAGGG + Intronic
904264604 1:29311107-29311129 CAGGCAGCCACCAGACCGAGAGG - Intronic
904611247 1:31727446-31727468 CTGGGAGCCCACAGAACCACCGG - Exonic
904614294 1:31741762-31741784 CATGGGGCCCCCAGCCCCCAGGG + Intronic
906027547 1:42686625-42686647 AAGGGAGCCCCCACCCCAAAGGG - Intronic
906381232 1:45333221-45333243 CCCACAGCCCCCAGACCCAAGGG + Intronic
906965787 1:50455112-50455134 CAGAGAGCTTCCAGAGCCAAGGG - Intronic
913109211 1:115642363-115642385 CAGGGAACCCCGGGACCCCAAGG - Intronic
915214453 1:154330522-154330544 CAGGCAGCCCTCAGTCCCAACGG - Intronic
915538441 1:156551893-156551915 CAGGGGGCCCCTAGACTTAATGG + Intronic
917959221 1:180129049-180129071 CAAGGAGCCCTCGGAGCCAAGGG - Intergenic
918220876 1:182435429-182435451 CAGGGAGCCCGCAAACTCACGGG - Intergenic
919794750 1:201314663-201314685 CAGGGAGCCCCCAGCCCTGAAGG - Intronic
919991054 1:202709090-202709112 CTGGGCGCCCCCAGATCCTAAGG + Intronic
920338149 1:205258611-205258633 CAGAGAGCCACCAGCCCCACCGG + Intronic
922932491 1:229401311-229401333 CATGGAGCCCCCACACTCACAGG + Intergenic
924283012 1:242457047-242457069 CAGGGAGCCCAGAGACCCCCTGG - Intronic
924385417 1:243495145-243495167 CAGGGCGCACCCAAGCCCAAGGG - Intronic
924730937 1:246711062-246711084 CAGTGAGACCACAGACCCACTGG + Intergenic
924941242 1:248813570-248813592 CAGGGAGCCCTCAGCGCCAATGG + Intronic
1063130637 10:3173695-3173717 CAAGAAGCCCCCAGACCCCAAGG - Intergenic
1065424255 10:25582552-25582574 CAGAGAGCCCCCAGCTCCTAGGG + Intronic
1066043443 10:31576482-31576504 CAGGGAGTCCCCACCTCCAAGGG + Intergenic
1066439718 10:35426939-35426961 CAGGGAGCCCAGAGGCACAAAGG - Intronic
1069870841 10:71532039-71532061 CAGAGAGACCCCAGAGCAAAAGG + Intronic
1069900444 10:71703795-71703817 GAGGAAGCCCCCAGACCGGAGGG + Intronic
1071564311 10:86663755-86663777 AAGGCACCCCCCAGACCCCAGGG + Exonic
1072750661 10:97975977-97975999 CGTGGAGCCCCCAAACCCAGAGG + Intronic
1073139218 10:101236638-101236660 CAGGCGGCCCCCTGACCCATGGG - Intergenic
1073336379 10:102713813-102713835 CAGGGCGACCTCAGAGCCAATGG + Intronic
1073514328 10:104063576-104063598 CAGGGAGAACTCAGACCCCAAGG - Intronic
1074455884 10:113594833-113594855 CACGGAGCCCCAGGACACAATGG + Intronic
1076260892 10:129065143-129065165 CAGGGATCCCCCAGCCTGAATGG + Intergenic
1076306254 10:129467391-129467413 CAGGGCGGCCCCACACCCGACGG - Intronic
1076629849 10:131845910-131845932 CAGGCATTCCCCAGGCCCAAGGG + Intergenic
1076681559 10:132174433-132174455 CACGGAGCCCACAGAGCCCACGG - Intronic
1076789204 10:132767862-132767884 CAGGGTGCCCACGCACCCAATGG + Intronic
1076789253 10:132768052-132768074 CAGGGTGCCCACGCACCCAATGG + Intronic
1076813298 10:132900095-132900117 CAGTCAGCCCCCAGAACCATGGG + Intronic
1077111987 11:866008-866030 CAGGGAGCCCGCAGGCCCCCAGG - Intronic
1077119345 11:899653-899675 CAGGGAGCCCCCAGACCCCCGGG - Intronic
1077297139 11:1831609-1831631 CAGGGTGCCCCCAGCCCCAAGGG + Intronic
1078367759 11:10720724-10720746 GAAGGAGGCCCCAGACCCTAAGG + Intergenic
1079081288 11:17415238-17415260 CAGGGTGCTCTCAGGCCCAAGGG - Intronic
1079502680 11:21119495-21119517 CAGGGAAACCCCAGTCCCCAGGG - Intronic
1083398240 11:62405860-62405882 CATGCATCCCCCAGCCCCAAGGG - Intronic
1084485837 11:69447661-69447683 CAGGGAGGCCCCAGAGCTGAGGG - Intergenic
1084501383 11:69537612-69537634 CACGGAGCCCCCAGAAGCAGGGG + Intergenic
1084656249 11:70520865-70520887 CAGGGAGCTCCCAGAGGCCAAGG - Intronic
1084673355 11:70620487-70620509 CAGGCAGCCTCCAGGCCCACAGG - Intronic
1084678028 11:70648195-70648217 CAGGCAGACCCAAGACCCAGAGG + Intronic
1085265916 11:75238003-75238025 CAGAGATCCCTCAGCCCCAATGG + Intergenic
1085558427 11:77447241-77447263 CAGGGAGAGCCCAAACACAAAGG - Intronic
1089104363 11:115990013-115990035 CAGGGAGACCCCCGCTCCAAGGG + Intergenic
1089792938 11:120957402-120957424 CAGCAAGCCCCCAGAGCCAGAGG - Intronic
1090205663 11:124882750-124882772 CAGGAAGCCCCCAGTCCCCATGG + Intergenic
1090455373 11:126844330-126844352 TAAGGAAACCCCAGACCCAAAGG + Intronic
1091825122 12:3506552-3506574 CAGGGAGCCTCGTGACCCACAGG + Intronic
1092899427 12:13044582-13044604 CACAGAGACCCCAGCCCCAAGGG - Intronic
1093091433 12:14925268-14925290 GAGGAAACCCCCTGACCCAAAGG + Intronic
1094493124 12:30973616-30973638 CAGGGAGCCTCCAGAATCACTGG - Intronic
1095282399 12:40370240-40370262 CAGGGAGGCACCTGACCCAAAGG + Intergenic
1095969091 12:47889343-47889365 CAGGGAACTCTCAGCCCCAAAGG - Intronic
1095983699 12:47986406-47986428 CAGGGAGCCCCTGGACCCGCTGG - Exonic
1096495344 12:52036745-52036767 CAGGGCGCCCGCAGACTCAAAGG + Intronic
1099222957 12:79935385-79935407 CCGGGAGCCCCCAGCCCGACAGG - Intronic
1099228013 12:79992765-79992787 CAGGGAGACCACAAACCCACCGG - Intergenic
1099450427 12:82801272-82801294 CAGGGAGACCACAAACCCACCGG - Intronic
1100963334 12:99986633-99986655 CATGCAGCCCCCACCCCCAATGG + Intergenic
1102565717 12:113796325-113796347 CAGCAAGCCCCCAGACCCCGCGG + Intergenic
1102774240 12:115505003-115505025 CAGGGAGCCCAATGGCCCAAGGG + Intergenic
1103701398 12:122850404-122850426 CAGGGGGCCCCCCAACCCAGCGG - Intronic
1103701457 12:122850528-122850550 CAGGGGGCCCCCCCACCCAGCGG - Intronic
1103701516 12:122850652-122850674 CAGGGGGCCCCCCCACCCAGCGG - Intronic
1103734057 12:123047698-123047720 CAGGGAGCCTCCAGGCTCCAGGG + Intronic
1104139859 12:125977245-125977267 CAGACAGCCCGCAGAACCAAGGG - Intergenic
1104521769 12:129482128-129482150 CAGCCAGCCCCCAGACACACGGG + Intronic
1107357725 13:39585754-39585776 CAGGCAGCCCTCAGAACCAAAGG - Intronic
1107414553 13:40188617-40188639 CAGGCAGCCCCGAAACCCAGTGG + Intergenic
1108206497 13:48095204-48095226 CAGTGCGCCTCCAGGCCCAAAGG - Intergenic
1108855404 13:54787135-54787157 CAGCGAGACCCCAAACCCACCGG - Intergenic
1109425223 13:62158199-62158221 CAGTGAGACCCCAAACCCACTGG + Intergenic
1113025533 13:105937212-105937234 CTGGCAGCCCCCAAACCCCATGG + Intergenic
1113866870 13:113532293-113532315 CCGTGAGCCCCCAGACGCACAGG + Intronic
1113913655 13:113857043-113857065 CATGGAGCCCCAAGTTCCAAGGG + Intronic
1113962041 13:114131649-114131671 CGGGGAGACCCCGGACCCATCGG - Intronic
1114538074 14:23435701-23435723 CAGGGCACCCCCACCCCCAACGG + Exonic
1118717355 14:68569817-68569839 TAGGGAGCCCCCCAACCCAGGGG + Intronic
1119467177 14:74867466-74867488 GAGGGAGCTCACAGACCAAAGGG - Intronic
1121104448 14:91271254-91271276 CAGGGAGCCCCAAGTCCCCAGGG + Intergenic
1121735875 14:96217763-96217785 CAGGAAGCCCCCAGGCTCTAAGG + Intronic
1122021886 14:98844849-98844871 CATGCTGCCTCCAGACCCAAGGG + Intergenic
1122847121 14:104506130-104506152 CAAGCTGCCCCCAGAACCAAAGG - Intronic
1123108325 14:105853218-105853240 CAGATAGCCCCCACACCCACCGG - Intergenic
1124649616 15:31465173-31465195 GTAGGAGCCCCCAGACCCAGGGG + Intergenic
1126845684 15:52758743-52758765 AATGGAGCCCTCAGACCCCAGGG + Intronic
1127212068 15:56783703-56783725 CAGGGAGCTCCCAGAACTGAGGG - Intronic
1127870418 15:63068327-63068349 CAGGGAGCTCCCAGTCAGAATGG - Intronic
1128930639 15:71702185-71702207 CAGGGGCCCCCCAGAACCACTGG + Intronic
1129466846 15:75728817-75728839 GAGAAAGCCCCCAGACCTAATGG + Intergenic
1129720389 15:77874936-77874958 AGAAGAGCCCCCAGACCCAATGG - Intergenic
1129728870 15:77918170-77918192 CATGGAGCCCCCAGTCACAGGGG - Intergenic
1129876783 15:78980813-78980835 CAGGAGGCCCCCAGATCCCAAGG - Intronic
1131147188 15:90021644-90021666 CAGTGAGCCCCCAGTCCAGAAGG + Intronic
1131422538 15:92319290-92319312 CAGGGAGCCCTCCGAGCCCAGGG - Intergenic
1132469143 16:92241-92263 TAGGCAGTCCCCAGTCCCAAAGG + Intronic
1132517106 16:371011-371033 AGGGAAGCCCCCAGAGCCAAGGG + Exonic
1132668960 16:1094979-1095001 GCTGGAGCCCCCAGACCCTACGG + Intronic
1132723192 16:1327097-1327119 CAGGGCGTCCCCCGACCCCAAGG + Intergenic
1133072715 16:3257045-3257067 CAGGGACCTTCCAGAGCCAATGG + Intergenic
1134462114 16:14438465-14438487 CAGTGAGCCACCAGACACACAGG + Intronic
1136086373 16:27888163-27888185 CACGCAGCCCCCACACCCCAGGG + Intronic
1136293840 16:29290826-29290848 TCAGGAGCCCCCAGACCCACTGG - Intergenic
1138546368 16:57722176-57722198 TAGGGAGCACCCAGACCTATGGG + Intronic
1139137691 16:64224688-64224710 CAGGGAGCCCTCTGACTCAAAGG + Intergenic
1139692388 16:68649625-68649647 CAGGGACCCCCCTTACCCAGGGG - Intronic
1139891822 16:70258059-70258081 CAGGGAGCCAGCAGGCCCAGAGG + Exonic
1141252357 16:82370017-82370039 CTGGGACCCCACAGACCCAGTGG + Intergenic
1142099740 16:88264872-88264894 TCAGGAGCCCCCAGACCCACTGG - Intergenic
1142738653 17:1917683-1917705 CAGGCTGCTCCCAGACCCACTGG + Intergenic
1142940773 17:3378450-3378472 CAGGAAGCCCCCTGCCCCCACGG - Intergenic
1143649726 17:8255990-8256012 CAGGGAGGCCCCTAAGCCAAGGG - Intronic
1144478975 17:15613325-15613347 CAGAGAACCCCCAGCCCCCAGGG - Intronic
1144919329 17:18750405-18750427 CAGAGAACCCCCAGCCCCCAGGG + Intronic
1145058086 17:19716195-19716217 CAGGCAGCCCCCACACAGAAGGG - Intronic
1146056772 17:29585240-29585262 CTGGCAGCCCCCTGACCCAGTGG - Intronic
1146919909 17:36703605-36703627 CAGGGAGCTCCCAGACCACTGGG + Intergenic
1147119081 17:38324958-38324980 CAGGGAGACCAAATACCCAAAGG - Intergenic
1147369473 17:39981441-39981463 GAGGGAGTCCCCAGGCCCACTGG - Intronic
1147449620 17:40496045-40496067 CTGGGAGCCCCCAGTCCCTGGGG + Exonic
1147558116 17:41492480-41492502 CAGCCAACCCCCCGACCCAAGGG + Intronic
1147723963 17:42554977-42554999 CAGGGACCACACAGACCCAGGGG - Exonic
1147938161 17:44025528-44025550 CAGGGAAGCCGCAGCCCCAAGGG + Intergenic
1148502661 17:48103535-48103557 CAGGGAGACCACAAACCCACCGG + Intronic
1148717147 17:49723782-49723804 CAGGGAGCCCCAATCCCCAGTGG - Intronic
1148724551 17:49779397-49779419 TGGGGAGCCCCCAGAACCCATGG + Intronic
1149585363 17:57782759-57782781 CAGGGAGGCCCCAAATCAAAAGG - Intergenic
1149875784 17:60231614-60231636 CAGGGACCCCCCAAAGCCCATGG + Intronic
1151116795 17:71745019-71745041 CAGGGAGCCAGGAGACCCAGTGG - Intergenic
1151875877 17:76868204-76868226 CAGGGCGCCACCAGCCCCGAGGG - Intergenic
1152087699 17:78230790-78230812 CAGGGAAGCCCCAGCTCCAAGGG + Intergenic
1152178075 17:78800802-78800824 CAGGGAGCCCCGAGGGCCCAGGG + Intronic
1152590452 17:81208996-81209018 CTGGGAGCCCCCAGGCCCTGTGG + Exonic
1152882836 17:82830257-82830279 CAGTGTGACCTCAGACCCAAAGG - Exonic
1153912769 18:9718781-9718803 CAGGGAGCTCCCTTACCCAATGG - Intronic
1154383816 18:13875678-13875700 CAGGGGGCCCACAGCCCCAACGG + Intergenic
1155884115 18:31186697-31186719 CAGGGAGCTTACAGACCCAGAGG + Intergenic
1156616997 18:38799177-38799199 CAGAGAGCCCCCCGACCCACAGG + Intergenic
1159920073 18:74220046-74220068 CAGGAAGCCAACAGCCCCAAAGG + Intergenic
1159951316 18:74486357-74486379 CAGGTGGGCACCAGACCCAAAGG + Intergenic
1160549356 18:79683508-79683530 CAGGGACCTCCCAGCACCAATGG + Intronic
1160629205 18:80233572-80233594 CAGGGAGGCCCCTGAGCCACGGG + Intronic
1160773285 19:843415-843437 CAGGGAGCCCCCAGGCTGCAGGG - Intronic
1161108327 19:2455482-2455504 CAGGGAGCCCCCAAATCCCCAGG + Intronic
1161596218 19:5152288-5152310 GAGGGAGGCCCCAGACCCCCGGG - Exonic
1162023333 19:7878939-7878961 CAGGGAGCCCACAGCAGCAAGGG + Intergenic
1162320460 19:9968392-9968414 CAGGGACCCCCTGGTCCCAAGGG - Exonic
1162909546 19:13841858-13841880 CAGCCAGGCCCCAGACCCAGTGG - Intergenic
1162930124 19:13953404-13953426 CAGGGAGCTCCCAGTCAAAAGGG - Intronic
1162966302 19:14157758-14157780 CAGGGGCCCCCCACACCCATGGG + Intronic
1163122868 19:15228316-15228338 CTGGGAACCCCCATATCCAAAGG + Intronic
1163288839 19:16365559-16365581 CAGGGAGCCACCAAAGCCACCGG + Intronic
1164692541 19:30222247-30222269 CAGAGAGAGGCCAGACCCAAGGG + Intergenic
1164757221 19:30699036-30699058 GAAGAAGCCCCCATACCCAAAGG - Intronic
1166304945 19:41932354-41932376 CAGGGAGCCTCAAGCCCCGAGGG - Intergenic
1166688360 19:44809124-44809146 CATGGAGCCCCCGGACGCACCGG + Exonic
1167199625 19:48055280-48055302 CCCGCAGCCCCCAGCCCCAAAGG - Intronic
1167456621 19:49599612-49599634 CAGGGCGCCCCCAAGCCCAAAGG - Exonic
1167535520 19:50048660-50048682 CAGACTGCCCCCACACCCAATGG - Exonic
1167660173 19:50791738-50791760 CAGGGAGCCCCGAGGCCCGCTGG + Exonic
1167787003 19:51645359-51645381 CAGGAAGGACCCAGACCCAGGGG + Intronic
1168343575 19:55640069-55640091 CAGCGAGCCCCAAGACCCTGGGG - Intronic
925294288 2:2767418-2767440 CAGGGAGGCCACAGACCCTGCGG + Intergenic
926309878 2:11667812-11667834 ATTGGAGCCCCCAGACCCACGGG + Intronic
926426848 2:12746007-12746029 TCTGGAGCTCCCAGACCCAAGGG + Intergenic
927697828 2:25250171-25250193 AATGGACCCCCCAGATCCAAGGG + Intronic
927900742 2:26816561-26816583 GAGGAACCCCCCAGACCAAAAGG - Intergenic
927917879 2:26948233-26948255 GAGGGAGACCCCAGGCCCACAGG + Exonic
930000957 2:46861199-46861221 CAGGCAGCCCACAGCCCCACCGG - Intergenic
932459503 2:71873184-71873206 CAGGGAGCCCCTAGACTGATAGG - Intergenic
932789801 2:74645118-74645140 CAGGGAGACCACAAACCCACCGG + Intronic
932827496 2:74955271-74955293 CAAGGAAACCCCTGACCCAAAGG + Intergenic
932977795 2:76625153-76625175 CAGGGATTCCCCAGTCCCATTGG + Intergenic
933581122 2:84128211-84128233 CAGCGAGACCACAGACCCACTGG + Intergenic
933691330 2:85181552-85181574 CAGGCAGCTCCCAGAGCCCAGGG + Intronic
934716286 2:96546566-96546588 CAGGGAGCCCCAGGAGCCACAGG + Intronic
934819178 2:97357237-97357259 CAGGAAACCCCCAGACCAGAGGG + Intergenic
935088867 2:99875253-99875275 TAGGGAGCACCCAGAACCACAGG - Intronic
935174848 2:100640801-100640823 TCGGGAGCCCTCAGACTCAACGG + Intergenic
935405816 2:102707923-102707945 CTGGGAGCACCCATACCCACAGG - Intronic
935598017 2:104894865-104894887 CAGGGAGCTCCCAGGTCCTAGGG + Intergenic
936548299 2:113412013-113412035 CAGGGAGACCCCGAAGCCAAAGG + Intergenic
937428206 2:121816966-121816988 CAGGGAGCCACCAGCCCGGATGG + Intergenic
938310610 2:130286177-130286199 CAGGGAGTCTCCAGGACCAATGG - Intergenic
942182698 2:173395659-173395681 CAGGCAGCCCCCAGAATCACAGG + Intergenic
943740346 2:191400466-191400488 CAGGTAGGCCCGAGACCCCAAGG + Exonic
944842981 2:203642114-203642136 CAGCGAGGCCACAGACCCACCGG - Intergenic
946055662 2:216899810-216899832 GAGGGAGCCCCCTGACCCCAGGG - Intergenic
947151507 2:227121084-227121106 CTGGGAGCCCCAGGACCCATTGG - Exonic
947534717 2:230933476-230933498 CAGGAAGCCCCCATCTCCAAGGG + Intronic
948722277 2:239908536-239908558 CAGGGAGCCCTCAATCCCCATGG - Intronic
1168988266 20:2070489-2070511 CATGGAGCCACCACACCCGACGG - Intergenic
1171847003 20:30283439-30283461 CAGGCAGCACCCCGACCCACGGG + Intergenic
1173789325 20:45817481-45817503 CAGGGAGCCCCCAGCCCCTTGGG + Intergenic
1174296738 20:49550658-49550680 CAGGGAGCTCCCAGCCCTACTGG - Intronic
1174402581 20:50283896-50283918 CTGGTAGCCCCTAGACCCCATGG + Intergenic
1175309780 20:58003638-58003660 AAGGGAGTCCCCAGAGCCCAGGG - Intergenic
1175344284 20:58260811-58260833 CAGAGAGCCCCCAAACACATCGG + Intergenic
1175466920 20:59195544-59195566 CCGGGAGCCCCCACACCCCTGGG - Intronic
1175685200 20:61023776-61023798 CAGGGAGCCCCCCGCCCACACGG + Intergenic
1175892627 20:62322284-62322306 CAGGGAGCCCCCAGTAGCCAGGG + Exonic
1176060504 20:63170418-63170440 CAGGTGGCCACCAGAGCCAAGGG + Intergenic
1176091164 20:63319247-63319269 CAGGGAGGCCCCAGAGCCCTGGG + Intronic
1176155911 20:63620348-63620370 CAGGGAGCCCCCACACTCTTGGG - Intronic
1176381033 21:6111979-6112001 CGCGGAGCCCCCAGTCCCCACGG - Intronic
1178459578 21:32790536-32790558 TAAGGAGACCCCTGACCCAAAGG - Intergenic
1179742439 21:43426261-43426283 CGCGGAGCCCCCAGTCCCCACGG + Intronic
1179884120 21:44306211-44306233 CACGGAGCCCCCACACTCACAGG - Intronic
1179907215 21:44428663-44428685 CAGGGAGGAGCCAGACCTAAGGG - Intronic
1180009421 21:45040031-45040053 CAGGGACCCCCCAGGCCCCCAGG - Intergenic
1180182814 21:46125411-46125433 CGGGGAGACCTCAGACCCTAGGG - Intronic
1181006803 22:20017365-20017387 GAGAGAGCCCCCAGGCCCCAGGG - Intronic
1181724874 22:24804794-24804816 CAGGGAGGGCCCAGACCCCTGGG - Intergenic
1183166196 22:36148880-36148902 CATGGAGTCCCCCGACCCAAGGG - Intronic
1183428274 22:37751150-37751172 CTGGTAGCCCCCAGACCCCGGGG + Intronic
1183491778 22:38120683-38120705 CAGGGAGCCCTCTGTCCCCAGGG + Intronic
1184527439 22:45033539-45033561 GAAGGAGCCCTCAGACCCACAGG + Intergenic
1184687730 22:46104121-46104143 CAGGCAGCCCCCAGTCCCCCGGG + Intronic
1184714665 22:46274063-46274085 CAGGGAGGCCCCTCACCCATTGG - Exonic
1184896166 22:47408105-47408127 CAGGGAGCACCCCAGCCCAATGG - Intergenic
949877418 3:8635326-8635348 CAGGGAGGCCCCAGGAGCAAAGG - Exonic
950212527 3:11134456-11134478 CAGGGAGAGCCCAGATTCAAGGG - Intergenic
950286894 3:11752088-11752110 CAGGGAGACCACAAACCCACCGG - Intergenic
950520852 3:13496881-13496903 CTGGGGGCCCCCACACCCCAGGG + Intronic
952834314 3:37590793-37590815 CAGGAAGCCCTCTGACCCAGAGG - Intronic
952889120 3:38029411-38029433 CAGGGAGCCCCCAGCTCCTTCGG - Intronic
954134235 3:48574804-48574826 CAGGGACCCCCTGGACTCAAGGG - Exonic
955056776 3:55461900-55461922 CACTGAGTCCCCAGACTCAATGG - Intergenic
956759346 3:72425092-72425114 CAGGGGGCCACCAGGCCCAGTGG + Intronic
957913275 3:86650989-86651011 CAGGCAGCCCCCAGAATCACAGG - Intergenic
958703396 3:97621696-97621718 CATGAAGTCCCCAGACCCAGGGG + Intronic
958990246 3:100835028-100835050 CAAAGAGGGCCCAGACCCAAGGG + Intronic
962921268 3:139952839-139952861 CAGGGAGCCCCAGGATGCAATGG + Intronic
963171546 3:142256411-142256433 CAAGGAGCTCCCAGAACCAGGGG - Intergenic
963352745 3:144172327-144172349 CAGGCAGCCACAAGAGCCAAAGG - Intergenic
966147047 3:176823831-176823853 GAGGAGGCCCCCCGACCCAAAGG - Intergenic
968742825 4:2339972-2339994 CAGGGAGCCCCCAGACCCAAGGG - Intronic
968903690 4:3442367-3442389 GGGGCAGCCCCCAGACCCATAGG - Intronic
968935058 4:3605469-3605491 GAGGGAGCCCCGCGCCCCAAAGG - Intergenic
968936665 4:3614597-3614619 AGGGGACACCCCAGACCCAACGG + Intergenic
969210922 4:5686628-5686650 CAGGGAGCCACCTGACCCTCTGG + Intronic
970012076 4:11470348-11470370 GAGGGAGCCCCCATCCCCAGAGG + Intergenic
976072445 4:81257445-81257467 GTGGGGGCTCCCAGACCCAAAGG + Intergenic
979809626 4:125020065-125020087 CAGGCAGCCACCAGAACAAAAGG + Intergenic
981413678 4:144462838-144462860 CATACAGTCCCCAGACCCAATGG - Intergenic
981838486 4:149082898-149082920 CAGCCAGCCCACAGACTCAAAGG - Intergenic
982991785 4:162285959-162285981 CAGGCAGCCCACAGTCCTAACGG - Intergenic
983583558 4:169333080-169333102 CAGGCAGCCACCACACCCACTGG - Intergenic
984923772 4:184788414-184788436 CATGGAGCCCCCAGGGCCACAGG + Intronic
985497485 5:218004-218026 CCGGGATCGCCCAGACCGAAGGG - Intronic
985521289 5:374958-374980 CCGGCAGCCCCCAGACCCACAGG - Intronic
985737824 5:1594741-1594763 CTGGGATCGCCCAGACCGAAAGG + Intergenic
987341487 5:16943439-16943461 CAGGGATCCCACCCACCCAAAGG + Intergenic
989268320 5:39503307-39503329 CAGGGAGCCCACAGACAGATTGG - Intergenic
989743353 5:44798078-44798100 TAGGGAGTTCCCAGAACCAAGGG - Intergenic
991435777 5:66596294-66596316 CGGGCAGCCCGCAGAGCCAATGG - Intergenic
992696985 5:79299157-79299179 CAGTGTGCCCTCAGAGCCAAAGG - Intronic
997747079 5:136308776-136308798 CAGGGAGCTCACAGACACAGTGG - Intronic
999371764 5:151060000-151060022 TTGGAAGCCCACAGACCCAAAGG + Intronic
999910410 5:156191768-156191790 CACTGAGCCCCAAGACCCATTGG - Intronic
1000247105 5:159457877-159457899 CAGGGTGACCCCAGAACAAAGGG + Intergenic
1000667127 5:164012531-164012553 CAGGGAGTCCCCAGGCACTAAGG - Intergenic
1000734787 5:164885745-164885767 CAGGGAGCCCCCAGAGAGAAAGG - Intergenic
1001586216 5:172834983-172835005 CATGGTGCCCCCATACCCAGCGG - Intronic
1001997560 5:176174487-176174509 CAGGGACCCCCCAGCCTCCATGG - Intergenic
1002199861 5:177521620-177521642 CAGGTAGCCATCAGACCCATGGG - Intronic
1002376411 5:178792163-178792185 CAGGTGGCCGCCAGCCCCAAGGG + Intergenic
1002768625 6:267481-267503 CAGTGAGCCCCCAGTGGCAATGG + Intergenic
1003187078 6:3841287-3841309 CAGGGACCCACCAGCCCCAGGGG - Intergenic
1003369227 6:5508599-5508621 CAGGGAGGGCACAGGCCCAAAGG + Intronic
1005418749 6:25627943-25627965 AAGGTTGCCCTCAGACCCAAAGG - Intergenic
1006327434 6:33365044-33365066 CAGGGAGCCCACAGCAGCAAGGG + Intergenic
1012980306 6:105822744-105822766 CAGGGAATCCCCAGAGCCCAGGG + Intergenic
1014219625 6:118786919-118786941 CTGGGAGCCCCAAGTCCCATGGG - Intergenic
1014384625 6:120785745-120785767 CAGGAAGCCCCCTGCCCCACAGG + Intergenic
1014460120 6:121685833-121685855 CAGCAAGCCCACAGACCCACCGG - Intergenic
1015528285 6:134194439-134194461 CAAGCAGCCCTCAGAACCAAAGG - Intronic
1018794805 6:167177477-167177499 CTGCGAGCCCCCAGACGCACGGG - Intronic
1018821513 6:167377590-167377612 CTGCGAGCCCCCAGACGCACGGG + Intronic
1018935111 6:168269182-168269204 GAGGGAGCCCCCAGCCCCTCTGG + Intergenic
1019354046 7:569821-569843 CAGTGAGCCCGCAGACCCCACGG + Intronic
1019410502 7:904643-904665 CAAGGTGGCCCCAGACCCATGGG - Intronic
1019616408 7:1964904-1964926 TAGGGAGACCCGAGGCCCAACGG + Intronic
1022076277 7:26974078-26974100 GAGGGAGTCTCCTGACCCAAGGG + Intronic
1023127981 7:36974037-36974059 CAGGGAGGCTCCAGACGCACAGG - Intronic
1023371633 7:39517809-39517831 CAGGGGCTCTCCAGACCCAAAGG + Intergenic
1024794507 7:53005134-53005156 CAGGGAGACCACAAACCCACTGG + Intergenic
1025209660 7:57013424-57013446 AAGGGACCCGACAGACCCAAGGG - Intergenic
1025662292 7:63563427-63563449 AAGGGACCCGACAGACCCAAGGG + Intergenic
1029494917 7:100891310-100891332 CAATGAGCCCCGAGACCCCAAGG - Exonic
1031304096 7:120102142-120102164 CTGGGAGCCCCCAGCCACCAGGG + Intergenic
1033033030 7:137845843-137845865 CATGGAGCCCCCATAACCAGTGG + Intronic
1034228564 7:149501315-149501337 CAGGCAGCGTCCAGACCCACAGG - Intergenic
1034954644 7:155326992-155327014 CAGGGAACCCCCAGACAGCAGGG + Intergenic
1035062467 7:156079699-156079721 CAGGGAGAGCACAGACCCCAGGG - Intergenic
1035366218 7:158350592-158350614 CAGGCAGCCCTGAGATCCAATGG - Intronic
1037908254 8:22728022-22728044 CAGGGAGCCCCAAGGCCCCTAGG + Intronic
1037963284 8:23115703-23115725 TATGGAGCCTCCAGACCCATGGG + Intronic
1038134474 8:24770446-24770468 CAGGGAGTCACCAGAACAAAGGG - Intergenic
1038780377 8:30564749-30564771 CGCGGAGCCCCCAGACCCCATGG - Intronic
1039602813 8:38855642-38855664 CAGGGGGCCTCCATTCCCAAAGG + Intergenic
1039948815 8:42152479-42152501 CTGGAAGCCCCCAGCCCCACTGG - Intergenic
1040963659 8:53062409-53062431 CAGGGAGACCACAAACCCACCGG + Intergenic
1041018795 8:53617539-53617561 CAGGGAGACCCTAGACCCAGCGG - Intergenic
1041679559 8:60574958-60574980 TGGAGAGCTCCCAGACCCAATGG + Intronic
1043556785 8:81439408-81439430 CATGCAGCCCACAGTCCCAAAGG + Intergenic
1044439708 8:92209027-92209049 CAAGGAGACCCCTGACCCAAAGG - Intergenic
1044947929 8:97408221-97408243 CAAGCAGCCTCCAGTCCCAAAGG + Intergenic
1045102789 8:98862082-98862104 TAGGGAGTCCACAGACCCTAAGG + Intronic
1045553785 8:103195852-103195874 CATGGAGCTCCCAGACCAATGGG + Intronic
1045897524 8:107237269-107237291 CAGGGAGCAGCCAGGCCCAGGGG + Intergenic
1048205959 8:132415419-132415441 CAGAGAGCTCCCAGACTCATGGG - Intronic
1048314645 8:133353005-133353027 CAGGGGGCTCCCATACCCGAAGG - Intergenic
1048794903 8:138141022-138141044 CACTCAGCCCCCAGACACAAGGG + Intronic
1048865137 8:138755191-138755213 CAGGGAGCTCCAGGACCCAGAGG - Exonic
1048874894 8:138828936-138828958 GAGGCAGCCCCCAGCCCCCAGGG - Intronic
1049263681 8:141653512-141653534 GAGGGAGCATCCAGACCCCAGGG + Intergenic
1049792689 8:144479234-144479256 CAGGCAGCCCCCAGCCCCTCAGG - Intronic
1049850137 8:144826540-144826562 CAGGCAGCCCCCAGCCCCCCAGG - Intergenic
1050682784 9:8133523-8133545 CAGGGATGCCCCAAACCCACTGG + Intergenic
1052759442 9:32574852-32574874 CAGGCAGCCCTCAGAACCAGAGG - Intergenic
1052991628 9:34522183-34522205 CAGGAAGCCCCCAGCCCAAAAGG + Intronic
1053727264 9:41016774-41016796 CAGGGAGACCCCGAAGCCAAAGG - Intergenic
1053873015 9:42513580-42513602 CAGGGAGCCCCCAGAAAGCAGGG - Intergenic
1053899737 9:42782340-42782362 CAGGGAGCCCCCAGAAAGCAGGG + Intergenic
1054261909 9:62875253-62875275 CAGGGAGCCCCCAGAAAGCAGGG - Intergenic
1054269315 9:62953172-62953194 CAGGGAGCCCCCAGAAAGCAGGG + Intergenic
1054767254 9:69052482-69052504 CAGGCAGCCCCCATTCCCAGAGG - Intronic
1056536177 9:87529743-87529765 AAAGAAGCCACCAGACCCAAGGG + Intronic
1057229019 9:93307812-93307834 CAGGCAGCCCCCTGGCCCACGGG - Intronic
1057523036 9:95775235-95775257 CAGGGAGCCACCTGGACCAAAGG - Intergenic
1060533303 9:124362319-124362341 CAGGGCTCCCCCAGCTCCAAGGG + Intronic
1060982275 9:127800287-127800309 CAGGATGCCCCCAGACCACAGGG - Intronic
1061072931 9:128322885-128322907 CCGGGAGCCCGCAGAGCCGACGG - Exonic
1061820264 9:133223479-133223501 CAGCCAGCCCCCACACCCCAGGG - Intergenic
1061854280 9:133433129-133433151 CATGGATCCCCCAGACCCACAGG - Intronic
1061920091 9:133777988-133778010 AAGGGAGCCCCAAGACCCACAGG - Intronic
1062102330 9:134734729-134734751 CAGGAAGCCCCCAGACTCAGTGG + Intronic
1062165029 9:135103388-135103410 CAGGTGGCCTCCAGCCCCAAGGG + Intronic
1062240369 9:135534425-135534447 CAGCCAGCCCCCACACCCCAGGG + Intergenic
1062489631 9:136799000-136799022 CAGGGAGGCCCCAGGCCCCAGGG - Intronic
1062563967 9:137155733-137155755 CAGAGAGGCCCCAGCCCCAGAGG + Intronic
1186878109 X:13837460-13837482 CAGGCAGCCCGCAGACCCAGGGG + Intronic
1187500084 X:19832506-19832528 AAGGAAGCCCCCAGACCTGAAGG + Intronic
1189350009 X:40269131-40269153 CAAGGAGTCCCAAGACCTAAAGG + Intergenic
1193524488 X:82572632-82572654 CGGGGAGCCCACTGCCCCAAAGG - Intergenic
1194981980 X:100450359-100450381 CAGGAAGCACCCAGACACCAGGG + Intergenic
1195323960 X:103743175-103743197 CAGGGAGTCCCCAAAACCCAGGG - Intergenic
1195331631 X:103807746-103807768 CAGGGAGTCCCCAAAACCCAGGG + Intergenic
1197034679 X:121859492-121859514 CACAGAGCCCACAGTCCCAAAGG + Intergenic
1197763269 X:130042571-130042593 CAGGGGGCCCTTAGGCCCAAAGG + Intronic
1198219938 X:134589746-134589768 CAGTGGACCCCCAGACTCAAAGG + Intronic
1199948271 X:152684403-152684425 GAGGAAACCCCCTGACCCAAAGG + Intergenic
1199961408 X:152784051-152784073 GAGGAAACCCCCTGACCCAAAGG - Intergenic
1199996655 X:153030440-153030462 TGAGGAGCCCCCCGACCCAAGGG + Intergenic
1200696658 Y:6366955-6366977 CAGAGAGCCCAGAGAGCCAAGGG - Intergenic
1200873500 Y:8127914-8127936 CAGGGAGACCACAAACCCACTGG - Intergenic
1201037455 Y:9797744-9797766 CAGAGAGCCCAGAGAGCCAAGGG + Intergenic