ID: 968743379

View in Genome Browser
Species Human (GRCh38)
Location 4:2342839-2342861
Sequence CAATGGGAAAGGAGAGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 752
Summary {0: 1, 1: 1, 2: 10, 3: 68, 4: 672}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968743373_968743379 -6 Left 968743373 4:2342822-2342844 CCTAGGAAAACTGGAACCAATGG 0: 1
1: 0
2: 1
3: 18
4: 240
Right 968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG 0: 1
1: 1
2: 10
3: 68
4: 672

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968743379 Original CRISPR CAATGGGAAAGGAGAGAAGT GGG Intronic
900434176 1:2619963-2619985 AAATGGAAAAGGAGAGAAAAGGG + Intronic
902154740 1:14475944-14475966 GAAGGGGAAAGAAGAGAAGGAGG + Intergenic
902212299 1:14912852-14912874 CGAGGGTAAAAGAGAGAAGTAGG - Intronic
902435397 1:16395319-16395341 CAGTGGGAAGGGGGAGAAGGGGG - Exonic
902700261 1:18167572-18167594 CGGTGGGAAAGGAGGGAACTTGG - Intronic
902995857 1:20224147-20224169 GAATGGGAAGGGAGAGAGGTGGG - Intergenic
904871719 1:33623515-33623537 GAAAGGGAAAGCAGAGAAGGAGG - Intronic
905291006 1:36921915-36921937 CCTGGGGAAAGGAGAGAGGTGGG - Intronic
905544358 1:38785994-38786016 CAATGGGAATGGAGAGGAAAGGG + Intergenic
905776382 1:40669985-40670007 CAAGAGGGATGGAGAGAAGTGGG - Intergenic
905928002 1:41765765-41765787 CAATGGGATAGGAAAGATGGAGG - Intronic
905971965 1:42148674-42148696 CTATGAGAAAGAAGAGAATTAGG + Intergenic
906063312 1:42962315-42962337 CAAGGGGAAAGGGGAGCAGGAGG + Intergenic
906822156 1:48940966-48940988 AATTGGGAAAGGAGGGGAGTGGG + Intronic
907022234 1:51079475-51079497 CACAGGGAAAAGAGAGAAGAAGG - Intergenic
907775144 1:57506903-57506925 CAGTGGGAATGGAGAGGAGAGGG - Intronic
908083768 1:60608711-60608733 AAAAGGGCAAGGAGACAAGTTGG - Intergenic
908262443 1:62349503-62349525 GAAGGGGAAAGGAGAGGAGGGGG + Intergenic
908615328 1:65914364-65914386 CAATGGAAAAGGAGTGTATTTGG - Intronic
908717887 1:67089355-67089377 CAATGAGAAACAAGAGGAGTGGG + Intergenic
908771903 1:67605127-67605149 CAATGAGCCAGGAGAGAAGGAGG - Intergenic
909008023 1:70300185-70300207 AAATGAGAATGAAGAGAAGTTGG + Intronic
909314310 1:74196756-74196778 CAGTGGGAATGGTGAGAAGTTGG - Intronic
909837134 1:80270433-80270455 TAATGGGAAAGGAGGCAAGAGGG - Intergenic
910288269 1:85577336-85577358 AAATGGTAGAGGAGAGAAATGGG + Intronic
910734196 1:90434185-90434207 GAAGAGGAAAGGAGAGATGTTGG - Intergenic
911948294 1:104138770-104138792 GAAAGGGAAAGGAGAGAAAGAGG - Intergenic
912552733 1:110494570-110494592 CAATGAGAAAGTGGAGGAGTGGG - Intergenic
912776856 1:112510807-112510829 GAAAGGGAAAGGGGAGAAGGGGG + Intronic
913079873 1:115373600-115373622 CAATGAAAAAAGAGAGAAATGGG - Intergenic
913165170 1:116178437-116178459 TAATTGGCAAGGAGAGAGGTAGG - Intergenic
913240396 1:116825237-116825259 CATTGGGAAAGGAGGAAAGGGGG - Intergenic
914191912 1:145419221-145419243 AAGTAGGGAAGGAGAGAAGTAGG + Intergenic
914721548 1:150293541-150293563 CGATGGAAAACAAGAGAAGTAGG - Intergenic
915178902 1:154041270-154041292 AACTGGGATAGGAGAGAAGTAGG - Intronic
915566360 1:156715604-156715626 AAGTGGGGAAGGAGAGAAGTGGG - Intergenic
915899601 1:159836834-159836856 GAAGGTGATAGGAGAGAAGTGGG - Exonic
917081644 1:171261878-171261900 CACTGGGGAAGGAGAGAGGGTGG + Intronic
917161928 1:172067336-172067358 CAATGGAAATGGAGAAAAGTGGG - Intronic
917299038 1:173553954-173553976 CAAGGGGAGAGGAGAAAACTGGG - Intronic
917537236 1:175883306-175883328 CAGAGGGAAAGAAGAGAAGAGGG - Intergenic
919536277 1:198791682-198791704 CACTGGGTCAGGAGCGAAGTGGG - Intergenic
919786520 1:201261740-201261762 CATTGAGAGAGGAGAGAGGTAGG + Intergenic
919812776 1:201419635-201419657 CAAAGGGAAAGGAGAGAATTAGG - Intronic
920010461 1:202863510-202863532 TAATGGCAAAGGAGTTAAGTAGG - Intergenic
920598490 1:207297730-207297752 CAATTGGAAAGTAGTGGAGTAGG - Intergenic
920669831 1:207994984-207995006 CAAAGGGAAGGGAGAGCATTAGG + Intergenic
920963910 1:210686588-210686610 AAAAGGGGAAGGAGAGAAATGGG + Intronic
921196599 1:212763174-212763196 CAAAGGGAGTGGAGAGTAGTGGG - Intronic
921726109 1:218525414-218525436 CAATGGGAAGGAAGAGCAATTGG - Intergenic
921761407 1:218919398-218919420 CCAGGAGAAAGGAGAGAAGTGGG - Intergenic
921869782 1:220127403-220127425 TAAAGAGAAAGGAGAGACGTTGG + Intronic
922088179 1:222370609-222370631 CCATGGGAAAGGAGAGAAGGAGG + Intergenic
922247359 1:223813540-223813562 CAGTGGGACAGGGGAGAAGAGGG - Intronic
922896839 1:229107395-229107417 CAATGGGTAAGGAGTGCAATGGG + Intergenic
923736138 1:236609693-236609715 CAATGGTGAAGTAGAGAACTGGG + Intergenic
923831800 1:237566411-237566433 AAATGGGAAAGAAGATAAGAAGG + Intronic
923994050 1:239471632-239471654 CAGTGGGAGAGGAGAGAAGGGGG - Intronic
924397945 1:243643603-243643625 CAATTGGAAAGGAAGGATGTTGG - Intronic
1063638636 10:7809950-7809972 CAAAAGGAGAGGACAGAAGTTGG - Intergenic
1064800623 10:19066695-19066717 TAATGAGAAAGAAGAAAAGTTGG - Intronic
1064826580 10:19409516-19409538 AAATGGGATAGGAGAAAAGCAGG + Intronic
1065085570 10:22172270-22172292 AGAGGGGAAAGGAGAGAAATGGG - Intergenic
1065612752 10:27488504-27488526 CAGGGGGAAAGAAGAGAAGGGGG - Intergenic
1066270259 10:33815666-33815688 GAATTGGGAAGGGGAGAAGTAGG + Intergenic
1067208933 10:44242517-44242539 CAAGGGCAAGGGAGAGTAGTTGG - Intergenic
1068164113 10:53305781-53305803 CAAAAGGAAAGAAGAGAAGGAGG - Intergenic
1069583951 10:69584575-69584597 CAATGGGAATGGAGTGAAGTGGG + Intergenic
1069765731 10:70857221-70857243 GGATAGGAAAGGAGAGAAGAAGG + Intronic
1070179710 10:74001543-74001565 CTATGGGAAGGGAGACAAATTGG + Intronic
1070513404 10:77181298-77181320 CGATGGGGAAGGGGAGAGGTGGG - Intronic
1070555293 10:77522658-77522680 CAAGGGGAAAGGCCAGAAGCAGG - Intronic
1070735790 10:78862808-78862830 CAAATGGAAAGAAGAGAATTTGG + Intergenic
1070753365 10:78976796-78976818 CAGAGGGAAAGAAGAGATGTTGG - Intergenic
1070854178 10:79593472-79593494 CAGTGTTACAGGAGAGAAGTGGG + Intergenic
1071010862 10:80938712-80938734 CAATGGGAATTGATACAAGTTGG - Intergenic
1071229738 10:83571621-83571643 AATTGGGAGAAGAGAGAAGTTGG + Intergenic
1071332091 10:84570875-84570897 CAATGGGCTGGGAGAGAAGCGGG + Intergenic
1071517885 10:86311048-86311070 CAAGGAGAAAGGAGAGAGGGAGG + Intronic
1071916963 10:90303703-90303725 CTATGAGAAAAGAGAGAAATGGG - Intergenic
1072001498 10:91199892-91199914 CAACAGGAAAGTAGAGAAGTGGG + Intronic
1073086230 10:100891082-100891104 AGATGGGAGAGGAGAGAAGGAGG + Intergenic
1073821792 10:107272678-107272700 GACTGGGAAAGGAGAGAAGTTGG - Intergenic
1074056494 10:109926854-109926876 AATGGGGAAAGGAGGGAAGTAGG - Intergenic
1074300904 10:112232577-112232599 CAGAGGGAATGGAGATAAGTAGG + Intergenic
1074313895 10:112344791-112344813 TGAAAGGAAAGGAGAGAAGTTGG + Intergenic
1074580837 10:114717909-114717931 CAAAAGGAGAGGAGAGAAGGGGG + Intergenic
1074933282 10:118151506-118151528 CAATGTTAAAGGAGAGCAGATGG - Intergenic
1074968539 10:118516009-118516031 CAAAGTGAAAGAAGAGAAGTTGG + Intergenic
1075878487 10:125828105-125828127 CAATGGAGAGGGAGAGAAGTGGG + Intronic
1077147056 11:1051038-1051060 CACTGAGAAGGGAGAGAAGCTGG - Intergenic
1077704409 11:4470804-4470826 GAATGGGGTAGGAGAGGAGTTGG - Intergenic
1078416772 11:11172458-11172480 CAGTGGAGAAGGAGAGAAGTGGG + Intergenic
1078464463 11:11539985-11540007 CAATGGGAAATGAGGGGAGACGG + Intronic
1078676237 11:13417199-13417221 CAATGAGAAAGGAGAGTATGAGG - Exonic
1078689261 11:13562612-13562634 CAGTGGGGAAGTAGGGAAGTGGG - Intergenic
1078867165 11:15308544-15308566 CAGAGGGAAAGGAGAAAAGGTGG - Intergenic
1078921325 11:15833399-15833421 CAATGGGAGAGAAGATGAGTTGG + Intergenic
1078968557 11:16376878-16376900 GGAAGGGAAAGGAGAGAATTGGG + Intronic
1080274031 11:30483484-30483506 CAAAGGAAAAGAAGAAAAGTGGG + Intronic
1080435482 11:32237538-32237560 CAATGGAAAAGTAGGCAAGTGGG + Intergenic
1081477508 11:43449002-43449024 CAATGGGGATGGAGAAAAGTAGG - Intronic
1082651783 11:55803167-55803189 TAATGGGAAAGGAAAGGAATAGG - Intergenic
1082800456 11:57410336-57410358 CAGTGGGGTTGGAGAGAAGTGGG - Intronic
1083576145 11:63793252-63793274 CAAAGGGGAAGGAGAGAAGAAGG - Intergenic
1084273382 11:68040389-68040411 GCCTGGGAAAGGAGAGAAGGAGG - Intronic
1085079678 11:73623907-73623929 AAATGAGCAAGCAGAGAAGTAGG - Intergenic
1086126246 11:83351375-83351397 GAAAGGGAAAGGAGAAAAGGGGG + Intergenic
1087104691 11:94398002-94398024 CAATGTGAAGGGTGAGAAGTTGG - Intronic
1087196079 11:95305472-95305494 CCAGGTGAAAGAAGAGAAGTGGG + Intergenic
1088908871 11:114175693-114175715 CAGTGGGAAATGAGAGAGGCAGG + Intronic
1089175164 11:116543450-116543472 CACTGGGACAGGAAAGAAGCAGG + Intergenic
1089872900 11:121692639-121692661 CATGGGGAAAGGAGTGAAGCAGG - Intergenic
1090511027 11:127375287-127375309 AAAAGAGAAATGAGAGAAGTAGG - Intergenic
1090642223 11:128739545-128739567 CCTTGGGAATGGAGAGTAGTGGG - Intronic
1090699694 11:129282538-129282560 GATAGGGAAAGGAGAGAAGATGG - Intergenic
1090965349 11:131593199-131593221 CACTGGGGAAGGAGAGGTGTAGG - Intronic
1091569180 12:1669626-1669648 GAATGGGAATGGGGAGAAGTAGG + Intergenic
1091614264 12:2036975-2036997 CAAGGGGAAATGAGTGAACTTGG - Intronic
1092016732 12:5165563-5165585 CAAGGGGAAAGAAGAACAGTTGG - Intergenic
1092173975 12:6390566-6390588 CCAGGGGAAAGGCGAGAAGAAGG + Intronic
1092392907 12:8097227-8097249 CAGAGGGAAAGGAAAGTAGTGGG - Exonic
1092974963 12:13736035-13736057 CAAAGGTAAAAGTGAGAAGTGGG - Intronic
1093303751 12:17485991-17486013 AAATGTGAAAGGAGAGTAATTGG - Intergenic
1093554595 12:20455734-20455756 CAAAAGAAAAGGAGAGAAATAGG - Intronic
1094711080 12:32963320-32963342 GAATGGAAAAGGAAATAAGTGGG - Intergenic
1095559161 12:43545109-43545131 CAGTGGGGAAGGAGAAGAGTGGG - Intronic
1095754594 12:45750225-45750247 CAAGGAGAAGGGAGAGAAATGGG + Intronic
1095790948 12:46166390-46166412 CAATGGAAAGGAAGAGAAATGGG + Intergenic
1096239730 12:49953425-49953447 CCTTGGGTAAGGAGAGAACTCGG - Intronic
1096319497 12:50598895-50598917 CAATGGGAAAGGATAGGAGAGGG - Intronic
1096586531 12:52625999-52626021 CAGTGTCACAGGAGAGAAGTGGG + Intergenic
1096670087 12:53193372-53193394 GGAAGGCAAAGGAGAGAAGTAGG + Exonic
1096807409 12:54149018-54149040 CACTGGGGAAGGAGAGGTGTGGG - Intergenic
1097107552 12:56634552-56634574 CTACGGGGAAGGAGAGGAGTTGG + Intronic
1097478283 12:60086676-60086698 GAAAGAGAAAGGAGAGAAGAAGG + Intergenic
1097745016 12:63291968-63291990 CAATGGTAAAGGAGGGGACTTGG - Intergenic
1097762580 12:63484952-63484974 CAAGGGGAAGGGAGAGCACTAGG + Intergenic
1097800826 12:63912060-63912082 CACTGGGGAAGAAGAGAAGGGGG + Intronic
1097822922 12:64145800-64145822 CACAGGGAAACGAGAGAAGAAGG + Exonic
1098040680 12:66351468-66351490 TAATGGGAAATGAGAGAATAAGG + Intronic
1098386264 12:69922041-69922063 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1098456934 12:70685114-70685136 CATAGGGAAAGGAGAGAGATGGG - Intronic
1098469398 12:70826309-70826331 TAGTGGGAAAGGTGAGAAGAGGG + Intronic
1099039959 12:77640409-77640431 GGATGGAAATGGAGAGAAGTAGG - Intergenic
1099262482 12:80400597-80400619 CCTTGGGAAGGGAGAGGAGTGGG - Intergenic
1099427342 12:82539805-82539827 CGTTGGGGAAGGAGAGATGTTGG - Intergenic
1099461369 12:82925762-82925784 CCATGGAAAGGGAGAGAAATTGG - Intronic
1099490159 12:83278962-83278984 CAAAGAGAAAGGAGAGATGAGGG + Intergenic
1099614286 12:84914477-84914499 CAATGCCAATGAAGAGAAGTAGG + Intergenic
1100292110 12:93225744-93225766 CTCTGGGGAAGGAGAGAAATGGG - Intergenic
1100371867 12:93975996-93976018 CCATGGGAATGAAGAGGAGTAGG - Intergenic
1100784172 12:98061660-98061682 CAATGGGAAAGGAGAGACAAAGG + Intergenic
1101207606 12:102504467-102504489 GACTGGGAAAAGAGAGAAGTTGG + Intergenic
1101544070 12:105694170-105694192 CAGGGGGAAGGGTGAGAAGTGGG - Intergenic
1103844292 12:123890726-123890748 CACTGGGGACAGAGAGAAGTGGG + Intronic
1104411687 12:128563374-128563396 CAACTGCAAAGGACAGAAGTGGG + Intronic
1104607663 12:130201978-130202000 CAATGACATAGGAGAGAATTTGG + Intergenic
1106155536 13:27152011-27152033 CAATGGGGATGCAGAGAAATGGG + Intronic
1106412176 13:29518144-29518166 CAAAAGGGAAGGAGAGAAATAGG + Intronic
1107124265 13:36829281-36829303 TAATGGGAAAGGAGGGAAATGGG + Intergenic
1108616181 13:52134483-52134505 CAATGGGGAGGAAGAAAAGTAGG + Intronic
1108860336 13:54850457-54850479 CAAAGGGGAAAAAGAGAAGTAGG + Intergenic
1108878079 13:55073135-55073157 CAGAGGGAAAGGAGAGCAGGAGG + Intergenic
1109269300 13:60236617-60236639 AAATGGGAAAGGGTAGAAATTGG - Intergenic
1110100505 13:71595491-71595513 TAATGGAGAAGGAAAGAAGTAGG + Intronic
1110270580 13:73585099-73585121 CAGTGGGGATGGTGAGAAGTGGG + Intergenic
1110592018 13:77274483-77274505 GAAAGGGAAGGGAGAGAAGGAGG + Intronic
1110926533 13:81161149-81161171 GAAAGGGAAAGGAAAGAGGTGGG + Intergenic
1111024171 13:82497602-82497624 CAATGAGAATGGGGAGAAATTGG - Intergenic
1111111156 13:83711460-83711482 CAAGGGAAAAAGAGAGAAGAAGG + Intergenic
1111122713 13:83875754-83875776 CAATGGAAAAGGAGGAAAGAAGG - Intergenic
1111133941 13:84014123-84014145 AAATGGGAAAGGACAAGAGTGGG + Intergenic
1111276596 13:85956090-85956112 CATTGGGAAGGCTGAGAAGTAGG + Intergenic
1112494155 13:99892822-99892844 CTGTGGGAATTGAGAGAAGTGGG - Exonic
1112820095 13:103323259-103323281 CAAAGGTAAAAGAGAGAAATCGG - Intergenic
1114038291 14:18650244-18650266 TAATGGGAAAGGAGAGAGGCGGG - Intergenic
1114120330 14:19664798-19664820 TAATGGGAAAGGAGAGAGGCGGG + Intergenic
1114484925 14:23056814-23056836 CTAGGAGAAAGGAGAGCAGTGGG - Intronic
1114834716 14:26190193-26190215 CGTTAGGAAAGGAGAGAATTAGG - Intergenic
1115097615 14:29656907-29656929 CAATGGGAAAAGAAAGAAAAAGG + Intronic
1115292398 14:31786996-31787018 CAGTGGAGAAAGAGAGAAGTGGG + Intronic
1115886425 14:37976679-37976701 CAGTGAGGATGGAGAGAAGTGGG + Intronic
1117002684 14:51387025-51387047 GAAAGGGAAGGGAGAGAAGGAGG - Intergenic
1117052776 14:51878435-51878457 AATGGGGAAAGAAGAGAAGTAGG - Intronic
1117171927 14:53109162-53109184 CAAGAGGAAAGGAAGGAAGTGGG - Intronic
1118057741 14:62099318-62099340 CACTGGGGATGGAAAGAAGTGGG + Intronic
1118159920 14:63277836-63277858 CAGAGAGAAAAGAGAGAAGTGGG + Intronic
1118474686 14:66105635-66105657 CATTCAGAAAGGAGATAAGTGGG + Intergenic
1118888080 14:69883264-69883286 GAGAGGGAAAGGAGAGAGGTTGG - Intronic
1118906165 14:70024972-70024994 TAAGGGGAATGGAGAGAAGTGGG + Intronic
1119359035 14:74032443-74032465 CAATGTGATAGGTGAGAAATGGG + Intronic
1119609339 14:76048513-76048535 CAAAAGAAAAGGAAAGAAGTAGG - Intronic
1119690870 14:76671467-76671489 CAATCGGAACACAGAGAAGTGGG + Intergenic
1120074726 14:80142621-80142643 AAATGGGCAAGAAGAGAAGCAGG - Intergenic
1120711880 14:87801183-87801205 CAAAGGGAAAGGAGTGCAGGAGG + Intergenic
1120747409 14:88164852-88164874 AAATGGGAAATGAGATAATTGGG - Intergenic
1120806454 14:88756162-88756184 CAATGGGAGAGAAGATGAGTGGG + Intronic
1120859570 14:89242701-89242723 AAAAGGCAAAGGAGAAAAGTAGG + Intronic
1121463069 14:94096936-94096958 CCATGGGAAAGGAGAGTGGATGG + Exonic
1121822757 14:96984617-96984639 CCATGGTAATGGAGAGAAGACGG + Intergenic
1121873101 14:97427192-97427214 CAAGCAGAAAGGAGAGATGTAGG + Intergenic
1122612450 14:102994821-102994843 CAAGGGGAACGGATGGAAGTGGG - Intronic
1122857473 14:104566802-104566824 CAATTCAAAGGGAGAGAAGTTGG - Intronic
1124292153 15:28463139-28463161 CAGTGGAAAAGGAGAGAACTTGG + Intergenic
1124998965 15:34752313-34752335 CAATGGGAAAGGAGGAAAAGTGG - Exonic
1125282995 15:38063031-38063053 GAGTGGGTAGGGAGAGAAGTGGG - Intergenic
1125294688 15:38190102-38190124 CCCTGGTAAAGGAGAGAAGGCGG - Intergenic
1125472996 15:40022710-40022732 CAATGGAAAGGGAGAGTAGAGGG - Intronic
1126069871 15:44856617-44856639 CAATGGGAAATGGGTGTAGTTGG - Intergenic
1126088659 15:45032545-45032567 CAATGGGAAATGGGTGTAGTTGG + Intronic
1126405599 15:48319620-48319642 TAAAGGGGAAGGAGAGAAGAGGG + Intergenic
1127013279 15:54653876-54653898 TAATGGGAAAGAAGGGAAGAAGG - Intergenic
1127182212 15:56433271-56433293 CAAGGGGAAGGGAGAGCATTAGG + Intronic
1127569666 15:60229748-60229770 CAGAGGGAGAGGAGAGGAGTCGG - Intergenic
1127577255 15:60303732-60303754 CAATGGGTAGTGGGAGAAGTGGG - Intergenic
1127807375 15:62533759-62533781 CTTTGGCTAAGGAGAGAAGTTGG + Intronic
1128035192 15:64518679-64518701 TAATAGGAAAGGAGCAAAGTGGG + Intronic
1128311119 15:66632238-66632260 GAAGGGGGAAGGAGAGAAGGAGG + Intronic
1128571264 15:68734915-68734937 CAATGGGAAAGGTAACCAGTTGG - Intergenic
1129275586 15:74443187-74443209 CAGTGGGGAAGGAGAGGAGGAGG - Intergenic
1129890102 15:79066291-79066313 CAGCGGGAAAGCAGAGAAGCTGG + Intronic
1130416235 15:83697195-83697217 TAATGGGAAGAGAGAGAAGCAGG - Intronic
1130684670 15:86026203-86026225 CCGTGGGAAAGGAGAAAAATGGG + Intergenic
1130938139 15:88487445-88487467 CAGTGGGGATGGAGAGAAGTTGG + Intergenic
1131208972 15:90476764-90476786 CAAGGAGAAGAGAGAGAAGTTGG + Exonic
1131500844 15:92964486-92964508 CTATTGTAAAGGAGAGAATTAGG + Intronic
1131501862 15:92975523-92975545 CCATGGGATTTGAGAGAAGTGGG + Intronic
1132212729 15:100036327-100036349 TAATGGGAAAGGACAGAGGAAGG + Intronic
1132846184 16:2001914-2001936 CAGTGGGAAGGGAGAGGAGGAGG + Intronic
1133525743 16:6603690-6603712 CCATGGGAAAGAAGAGGATTGGG - Intronic
1133638111 16:7689681-7689703 GAATGGGAAAATACAGAAGTAGG + Intronic
1133853011 16:9523914-9523936 CAATGAGAAAAGAGAGGAGAAGG - Intergenic
1134047981 16:11115245-11115267 GAAAGGGAAAGGAGAGGAGGGGG + Intronic
1135205793 16:20482907-20482929 CAAGGGAAAAGGAGAAAACTGGG - Intronic
1136230727 16:28883785-28883807 GGATGGGACAGGAGAGAAGCGGG - Intronic
1136398051 16:30003803-30003825 CAGTGGGGAAGGAGAGGAGGTGG + Intronic
1137961402 16:52885385-52885407 GGATGGGAAAGGAGGGAAGCAGG - Intergenic
1138331397 16:56218640-56218662 CAATGGGCAAGGGAAGAAGCTGG - Intronic
1138771264 16:59666817-59666839 AAATGGGAAAGAAGAGGAGATGG + Intergenic
1138807854 16:60112451-60112473 GGATGGGAATGAAGAGAAGTGGG - Intergenic
1138852482 16:60645451-60645473 CAATGGGATGAGAGAGAATTCGG + Intergenic
1139278251 16:65748131-65748153 CAGTTGGAAAGGAGAAAAATTGG - Intergenic
1139482786 16:67239921-67239943 GAAGGGGAATGGAGAGAAGATGG + Intronic
1139820224 16:69715182-69715204 GAATGGGAAAGGTGTGAAGAGGG - Intronic
1140089768 16:71828168-71828190 CAATCTGAAAGCAGAGCAGTGGG + Intergenic
1140153007 16:72391230-72391252 AAATGAGGAAGGAGAGAATTAGG + Intergenic
1140858031 16:78994999-78995021 TAATGGGAAAGGAGAGAGGCTGG - Intronic
1140917324 16:79505989-79506011 GAAGGGGAAAGGAGAAAAGGAGG + Intergenic
1141265567 16:82493877-82493899 CAAAGAGGAAGGAGAGAAGAGGG - Intergenic
1141743640 16:85911373-85911395 CAAAGTCAAAAGAGAGAAGTTGG - Intronic
1142134178 16:88444094-88444116 AAGTGGGGTAGGAGAGAAGTGGG + Intergenic
1143208318 17:5162780-5162802 CAAGAGGAAAGCAGAAAAGTAGG + Intronic
1143916117 17:10294704-10294726 CAGGAGGAAAAGAGAGAAGTGGG + Intergenic
1144264245 17:13552834-13552856 CAATGGAAAATGTGAAAAGTGGG - Intronic
1144396156 17:14845153-14845175 GAAAGGGAAAGGAGAGAAAAAGG + Intergenic
1145029255 17:19492133-19492155 CAATGAAAAAAGAGACAAGTAGG + Intergenic
1145888783 17:28400328-28400350 AAATGGGAATGGAGGGAAATAGG + Exonic
1145923032 17:28625717-28625739 CAGTGGGAATGGAGATAAGATGG - Intronic
1147412386 17:40263068-40263090 GATTGGGAAAGGGGAGATGTTGG + Intronic
1147685936 17:42286991-42287013 GAGTGGGAAAGGAGAGGAGAGGG + Intergenic
1148109814 17:45138012-45138034 CCACGGGAAAGGGCAGAAGTGGG - Intronic
1148218014 17:45844560-45844582 CCATGGGTAAGGAGAAAAGTTGG + Intergenic
1148432742 17:47655770-47655792 AAATGGCAAAGGAGAGAGATGGG - Intronic
1148562985 17:48616807-48616829 CAAGGCGAAAGGAGAGAAAATGG - Intronic
1148583764 17:48762186-48762208 TAATGGGAAAGGAGGGTTGTGGG - Intergenic
1149030482 17:52077432-52077454 CAATGGCAAAGTGGAGCAGTTGG - Intronic
1149630257 17:58116216-58116238 CAGTGGGGTAGCAGAGAAGTTGG + Intergenic
1149871948 17:60190765-60190787 CAAGAGGAAAGCAGAAAAGTAGG - Intronic
1151532347 17:74714764-74714786 TGATGGGAAAGGAGAGATGGGGG - Intronic
1151547338 17:74801156-74801178 GAAAAGGAAAGGAGAGAAGATGG - Intronic
1151601056 17:75106350-75106372 GAATGGAAAAGGAGGGAGGTGGG + Intergenic
1151655904 17:75495876-75495898 CCATGGGACAGGAGAGCAGGAGG - Intronic
1151687012 17:75653355-75653377 GAATGGGCAAGGAAGGAAGTTGG - Intronic
1152297536 17:79476863-79476885 GAATGAGAAAGGAAAGAAGTAGG + Intronic
1152507192 17:80757797-80757819 CCGTGGGAAAGGACAGAGGTGGG - Intronic
1153184828 18:2474334-2474356 AGATTGGAAAGGAGAGAGGTGGG + Intergenic
1155079668 18:22396323-22396345 AAATGAGAAAGAAGAGAGGTTGG - Intergenic
1155254431 18:23982362-23982384 CAAGGAGCAAGGTGAGAAGTGGG - Intergenic
1155550995 18:26964899-26964921 CACAGGGAAAGGAGCGAAGATGG + Intronic
1156458849 18:37310052-37310074 CCATGGGAAAAGAGAGGAGGTGG - Intronic
1156708243 18:39910206-39910228 CAATAGGAAAGGGGACAAATAGG - Intergenic
1156788810 18:40947712-40947734 CACTAGGACATGAGAGAAGTGGG + Intergenic
1156829220 18:41470263-41470285 GTAAGGGAAAGGAGAGCAGTGGG - Intergenic
1159054977 18:63454368-63454390 CTGTGGGAAAGGAGTAAAGTTGG - Intergenic
1159425105 18:68275152-68275174 CAATGGGGACGGAGAGACATCGG - Intergenic
1159553048 18:69917029-69917051 AAGTGGGAAAGCAGAGAAGTAGG - Intronic
1159602417 18:70441279-70441301 AAATGTGAGAAGAGAGAAGTGGG - Intergenic
1159756909 18:72376917-72376939 CAATGGGTAAGTTGACAAGTTGG + Intergenic
1159882417 18:73871108-73871130 CAATAGGAAAGGAATGAAGAAGG + Intergenic
1161579453 19:5072837-5072859 CACTGGAAAAGGCGGGAAGTGGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161803619 19:6429830-6429852 CACTGGGAGAGGAGAGAGGAGGG + Exonic
1162450485 19:10751347-10751369 CAAAGGGAGAGGAGAGGAGTAGG + Intronic
1162708608 19:12574681-12574703 AAATGCGAAAGAAGAGAAGGTGG - Intronic
1162794193 19:13078248-13078270 CATTGGGAAAGGAGTGCAGGAGG - Intronic
1164145954 19:22512714-22512736 CCAGGGGAAAGCAGAGAAGCAGG + Intronic
1165335314 19:35165811-35165833 CACTGGGAAGGGAGTGAAGGAGG + Intronic
1167320272 19:48793359-48793381 CAATGGGAAATGAGAGGATGTGG + Intergenic
1167623445 19:50571126-50571148 CAATTAGGGAGGAGAGAAGTTGG + Intergenic
1168470747 19:56638760-56638782 CAATGGGGATGGAGAGCAGTGGG - Intergenic
925212002 2:2057367-2057389 GAAAGGGAAAGGAGTGAACTTGG - Intronic
925549236 2:5052148-5052170 GAAAGGAAAAGGAGAGAAGCTGG + Intergenic
926024153 2:9525329-9525351 GAAAGGGAAGGGAAAGAAGTTGG + Intronic
926043829 2:9695033-9695055 CAAAGGAAAAGGAGAAAAGAGGG - Intergenic
926681309 2:15665914-15665936 CACTGGGCTAGGAGAAAAGTGGG + Intergenic
927082000 2:19639717-19639739 CAAGGGGATATGAGAGATGTTGG - Intergenic
927280567 2:21302024-21302046 CAATGGAATAGGATAGAAGATGG - Intergenic
927959939 2:27234847-27234869 TAATGGGAGGGAAGAGAAGTTGG + Intronic
928602355 2:32915942-32915964 GAAGGAGAAAGGAGAGAAGAAGG - Intergenic
928814007 2:35267545-35267567 CAGGGGAAAGGGAGAGAAGTTGG - Intergenic
929096452 2:38267294-38267316 GGATGAGAAAGAAGAGAAGTTGG - Intergenic
929803102 2:45121107-45121129 CAAAGGGAGATGGGAGAAGTTGG + Intergenic
932326301 2:70864267-70864289 CCATGTGGATGGAGAGAAGTAGG - Intergenic
932575517 2:72960423-72960445 CAGTGGGCATGGAGAGAAGTGGG - Intronic
933046059 2:77538931-77538953 CAAGAGGAAGAGAGAGAAGTGGG - Intronic
933158702 2:79001390-79001412 CAATAGGAATGAAGAGAAGAGGG - Intergenic
933188189 2:79302223-79302245 GAATGGGAAATGTGAGAGGTAGG - Intronic
933483693 2:82891323-82891345 GAAAGGGAAAGGAGAGAGGAAGG - Intergenic
935287833 2:101580916-101580938 CCAAGGGAAAGAAGAGATGTAGG + Intergenic
936278051 2:111117578-111117600 CAATGGGACAGGTCAGATGTTGG - Intronic
936766872 2:115861534-115861556 CAGTGGAGATGGAGAGAAGTAGG + Intergenic
936859148 2:116995019-116995041 CAATGGGAAGGGGAAGAAGAGGG + Intergenic
937254423 2:120545049-120545071 TAATGGGAAACTAGAGAATTAGG - Intergenic
937268885 2:120634553-120634575 CATGGGGAAACCAGAGAAGTCGG + Intergenic
938272671 2:129988856-129988878 TAATGGGAAAGGAGAGAGGCAGG + Intergenic
938329330 2:130438891-130438913 CCATGGGAAAGAAGATAAGGTGG + Intergenic
938360617 2:130682612-130682634 CCATGGGAAAGAAGATAAGGTGG - Intergenic
938443565 2:131357259-131357281 TAATGGGAAAGGAGAGAGGCGGG - Intergenic
938578641 2:132626587-132626609 TAAAGAGAAAGGAGAGAAATAGG + Intronic
938580089 2:132637914-132637936 TAATGGGAAGGGAGAGGTGTGGG + Intronic
939424660 2:142019558-142019580 CAATGGGGAAGGATAGAAGTGGG - Intronic
939431374 2:142113184-142113206 CACTGGGAACCAAGAGAAGTGGG - Intronic
939488534 2:142848185-142848207 GAATGGGATAGGAGAGAAAGGGG + Intergenic
939765192 2:146239619-146239641 CAAAGGGCAAGGAAAGAATTTGG - Intergenic
941293054 2:163700028-163700050 AAATTGGAAAGGAAAGAAGGAGG + Intronic
941469314 2:165864731-165864753 CAATGAGAAAGGGTAGCAGTTGG + Intronic
941801336 2:169663179-169663201 CCATGGGCAAGGAGACAACTTGG - Intronic
941860011 2:170269376-170269398 CATTGGGAAAGGAGGGATTTAGG - Intronic
942314535 2:174685283-174685305 AAATTGGAAGGGAGAGAAGCAGG - Intergenic
942481176 2:176390066-176390088 CAATGCTAAGGCAGAGAAGTTGG - Intergenic
943182688 2:184563005-184563027 AATTGGGCAAAGAGAGAAGTTGG + Intergenic
943456528 2:188114982-188115004 CAATGGGAAAGGTTAGAGGTAGG - Intergenic
943748385 2:191486106-191486128 CAAGGGAAATGGAGAGGAGTGGG - Intergenic
945043299 2:205760615-205760637 GAAGGAGAAAGGAGAGAAGAGGG + Intronic
945044532 2:205770483-205770505 GAATGGGAAAGGAGAGAAGGGGG - Intronic
945507164 2:210656154-210656176 CACTGGGAAAGAAAAGAAGGTGG - Intronic
945526654 2:210896288-210896310 CAAGGGGAATGAAGAGAATTGGG + Intergenic
946141662 2:217696261-217696283 CAATGTGAAAGGAGAGTACATGG - Intronic
946207973 2:218124516-218124538 CACTGGGAAAGGAGTGAAGCTGG - Intergenic
946950699 2:224871398-224871420 CAAGGGAGAAGGAGAGAAATGGG - Intronic
947220323 2:227785601-227785623 CAAGGATAAAGGAAAGAAGTGGG + Intergenic
947330892 2:229028063-229028085 CAGTGGGAAAGGACAGGAGGAGG + Intronic
947937550 2:234021154-234021176 CAATGGGAGAGGTGAGAACTTGG - Intergenic
948100408 2:235368446-235368468 CAGTAGCAAAGGAGACAAGTTGG + Intergenic
948551600 2:238776244-238776266 CAGTGGGGAAGGGGAGATGTCGG + Intergenic
948766898 2:240227041-240227063 CAGTTGGAAAGGAGTGAGGTAGG + Intergenic
948840114 2:240644686-240644708 GAAGGGGAGAGGAGAGAAGAGGG - Intergenic
1168948417 20:1780305-1780327 CAATGGGAAGGGACAGAGGAAGG + Intergenic
1169439568 20:5622818-5622840 CAATGTGCATGGAGAGAAGGTGG + Intergenic
1169803755 20:9538444-9538466 CAAAGGGAGAGGAGAGAACAGGG - Exonic
1170813908 20:19696928-19696950 CAATGGGGAAGGAGGGAGGGAGG + Intronic
1170906058 20:20516064-20516086 CAATGGGAGTGGAGAGTAGCAGG - Intronic
1171360854 20:24585384-24585406 TAATGAGAGAGGAGAAAAGTAGG + Intronic
1171396223 20:24835464-24835486 CAGTGAGACAGGAGAGAGGTTGG + Intergenic
1172166677 20:32903811-32903833 CCATGGGAGTGGAGGGAAGTAGG + Intronic
1172682391 20:36726809-36726831 GAAAGGGAAAGGAGAAAAGGTGG + Intronic
1174298990 20:49568416-49568438 CAAGGGGAAAGGAGATAGATGGG + Intergenic
1174454917 20:50642074-50642096 CAAATGTAAAGGAGGGAAGTGGG - Intronic
1174471885 20:50767656-50767678 CAAATGTAAAGGAGGGAAGTGGG + Intergenic
1175238161 20:57526810-57526832 GAATGGGTAAGGAGGGAAGAAGG + Intergenic
1175338132 20:58209850-58209872 TAACGGGAAAGGAGAAAATTGGG + Intergenic
1176122692 20:63461341-63461363 TAATTGTAAAGGAGAGAAGCCGG + Intronic
1176698051 21:10004634-10004656 GAAAGGGAAAGGAGAGCATTAGG + Intergenic
1177864206 21:26493418-26493440 CAGTGGGACAGGAAAGAAGGTGG + Intronic
1177962406 21:27683794-27683816 CAGGGGGAAAGGAGAGCATTTGG - Intergenic
1178446421 21:32647675-32647697 CAATGGAAGAAGAGTGAAGTAGG - Intronic
1178492906 21:33064754-33064776 CAATGGGGAAGGAGTGAAACCGG + Intergenic
1178998416 21:37429509-37429531 CAGGAGGAAAAGAGAGAAGTGGG + Intronic
1179233044 21:39522760-39522782 CACTGGGACAGGAGTGAAGCTGG - Intergenic
1180462413 22:15577285-15577307 TAATGGGAAAGGAGAGAGGCAGG - Intergenic
1181292027 22:21802506-21802528 CAAATGCAAAGGAGAGAGGTGGG - Intronic
1181664140 22:24379672-24379694 AAATGAGAAAGCAGAGAATTGGG - Intronic
1182249647 22:28990013-28990035 GAATGGAAAAGAAGAGAAGGAGG - Intronic
1182280322 22:29214606-29214628 AAGTTGGAGAGGAGAGAAGTTGG + Intronic
1182355977 22:29722397-29722419 GAAGGGGACAGGAGAGAAGCGGG - Intronic
1182457240 22:30459777-30459799 CAAGGGTAAAGGCAAGAAGTGGG - Exonic
1182592524 22:31392890-31392912 CAATGGGAAAGTAGCTATGTTGG - Intergenic
1182983171 22:34691755-34691777 AAAGGGAAATGGAGAGAAGTAGG - Intergenic
1183010056 22:34938505-34938527 AAAGGGGAAAGGGGAGAAGTTGG + Intergenic
1183739592 22:39662469-39662491 CGGTGGGATAGGACAGAAGTGGG + Intronic
1184049712 22:41995299-41995321 CCATGAGAAGGCAGAGAAGTAGG + Intronic
1184464947 22:44663478-44663500 CAATGGGAACAGAGAGAGATTGG - Intergenic
949144425 3:679975-679997 GCATGGGAAACGAGAGAAATGGG + Intergenic
949916876 3:8971965-8971987 CAGTGAGAAAGGAGGGAAGCTGG + Intergenic
950861659 3:16152768-16152790 CAATGGGAAAGGATATGAGCAGG - Intergenic
950863806 3:16173350-16173372 AGATGGGGAAGGAGAGAAGGTGG - Intergenic
951121068 3:18929774-18929796 CAATGGTGAAGGTGACAAGTTGG - Intergenic
951214917 3:20014740-20014762 CACTGGGGATGGAGACAAGTGGG - Intergenic
951543474 3:23805552-23805574 CTTTTGGAAAGGAGAGGAGTAGG - Intergenic
951763291 3:26168457-26168479 AAATTGGAGAGAAGAGAAGTTGG - Intergenic
951774089 3:26289136-26289158 CTAAAGGAAAGGAGAGAAATGGG + Intergenic
951843380 3:27059195-27059217 GAATGGGAAAGGAAACATGTAGG - Intergenic
951848176 3:27106969-27106991 CAAAAGGAAAGGAGAGAAAAAGG + Intergenic
952054931 3:29432820-29432842 GAATGGGAAGGGTGAAAAGTTGG + Intronic
952160112 3:30684868-30684890 CCATGGGGAATGAGAGAAGATGG - Intronic
952494122 3:33901230-33901252 GAATGGGGAAGGACAGAATTAGG - Intergenic
952520851 3:34155878-34155900 CAATGGGTAGGGAGAGCAGCGGG - Intergenic
952767776 3:36969793-36969815 GAATGGGGGAGAAGAGAAGTGGG + Intergenic
953135112 3:40175497-40175519 GAATGGGAAAGGAGGGCAGCAGG - Intronic
953215174 3:40911346-40911368 CAATGGGAAAGGTGAGACCCAGG + Intergenic
953606423 3:44415852-44415874 CAGTGGGACAGCAGAGAACTTGG + Intergenic
955159686 3:56452202-56452224 CAATGTGAAAGGAAATAAGATGG + Intronic
955852491 3:63235648-63235670 CATGGGGGAAGGAGAGAGGTAGG - Intronic
956388978 3:68751409-68751431 CAGTGGGGATGGAGAAAAGTGGG + Intronic
956531686 3:70226871-70226893 GGATGGAAAAGGAGAGAAGAGGG + Intergenic
957343095 3:78926385-78926407 CAAAGGAAATGGAGATAAGTGGG + Intronic
957626471 3:82659126-82659148 GAAAGGGAAGGGAGAGAAATAGG - Intergenic
957794188 3:84981671-84981693 GAATGGGAAGGGAGGGAAGGAGG - Intronic
957921681 3:86756992-86757014 CACTGGGACAGGAGTGAGGTTGG - Intergenic
958457239 3:94347334-94347356 CAGTGGGAAAGAACAGAAATTGG - Intergenic
958658539 3:97035358-97035380 AAATGGGACAGATGAGAAGTAGG + Intronic
958676187 3:97272067-97272089 CAGAGGAAAAAGAGAGAAGTAGG - Intronic
958733373 3:97982148-97982170 CACTGGGGAAGGATAGAGGTGGG - Intergenic
960119626 3:113934009-113934031 CAGTGGGAAATGAGAAATGTTGG + Intronic
960183622 3:114612078-114612100 ATATGGGAAAACAGAGAAGTAGG - Intronic
960580459 3:119274010-119274032 GAAAGAGAAGGGAGAGAAGTGGG - Intergenic
960727872 3:120689245-120689267 CATTTGCAAAGGAGAGAAGAGGG + Exonic
961448982 3:126993946-126993968 CAATGGGCAAGGAGAGGGCTGGG - Intronic
961632328 3:128310280-128310302 CAGAGGGAAAGGAGAGAAAAAGG - Intronic
962342713 3:134598620-134598642 TCGTGGGAAAGGAGAGAAGGTGG + Intronic
962386740 3:134938000-134938022 AAATGGGAAAGGAGGAAAGGGGG + Intronic
963289449 3:143473130-143473152 CAGTGGGAAATGAGAGGAGCTGG - Intronic
963473062 3:145768698-145768720 CACAGGGGAAGGAGATAAGTGGG - Intergenic
964004004 3:151808566-151808588 TAATGAGAGAGGAGAGAAGTGGG - Intergenic
964236428 3:154535889-154535911 ACAGGGGAAAGGAGAGAAGGAGG - Intergenic
964488243 3:157207853-157207875 GAATGGGAGAGGAAAGAAGTGGG + Intergenic
965347721 3:167572864-167572886 CAATGGCGAAGAAGAGAAGGAGG + Intronic
965610123 3:170535060-170535082 CCATGGAAAAGGAGAGGAGAAGG - Intronic
965739895 3:171863329-171863351 TGATGGGAAAGGAAAGAATTGGG + Intronic
966031265 3:175350645-175350667 AAATGGGAAAGGAGAGGAGTGGG + Intronic
966244780 3:177795043-177795065 AATTGGGAAAGGAGAAAAGGAGG - Intergenic
966591478 3:181688294-181688316 GTATGGGAAAGGAGAGAAATGGG + Intergenic
966706033 3:182914919-182914941 AAATGGGCAGGGAGAGATGTTGG + Intronic
966963471 3:184965836-184965858 CAGTGGCAATGGAGAGAAGAGGG + Intronic
967540325 3:190659665-190659687 CAAACAGATAGGAGAGAAGTAGG - Intergenic
967992641 3:195142856-195142878 CAAAGGGAAGAGAGAGAAGGAGG - Intronic
968743379 4:2342839-2342861 CAATGGGAAAGGAGAGAAGTGGG + Intronic
969120030 4:4901542-4901564 AATGGGGAAAGGAGAGATGTAGG - Intergenic
969164268 4:5292920-5292942 CAATGGGAACGGATAGCATTAGG - Intronic
970286255 4:14519745-14519767 CAATACAAAATGAGAGAAGTTGG - Intergenic
970534164 4:17012101-17012123 CATTGGAAAATGATAGAAGTTGG + Intergenic
970557372 4:17248263-17248285 CTATGAGAAATGAGAGAAATGGG - Intergenic
970670825 4:18394971-18394993 CTAAGGGAAAGGAGAGATGCTGG + Intergenic
970947554 4:21712960-21712982 AAATGGGGAAGGAAAGAAGATGG - Intronic
971129073 4:23785937-23785959 AAGTGGGAAAGAAGAAAAGTTGG + Intronic
972573548 4:40331512-40331534 CAATGGCAGAGAAGAGTAGTTGG + Intergenic
972798394 4:42446209-42446231 GAATGCGAAAGCAGAGCAGTGGG - Intronic
973807891 4:54543065-54543087 GGATGGGATAGGGGAGAAGTGGG + Intergenic
974384793 4:61190302-61190324 CATTGGCAAGAGAGAGAAGTGGG + Intergenic
975192924 4:71487321-71487343 CAAGGGAAAATGTGAGAAGTTGG + Intronic
976361306 4:84181808-84181830 CATTTGGAGAGTAGAGAAGTGGG + Intergenic
977268667 4:94887076-94887098 GAATGGGAAAGGAGAAAAGAAGG + Intronic
977916690 4:102601922-102601944 CAAATGGAAAGGTAAGAAGTGGG - Intronic
978124976 4:105124729-105124751 CAAGGGGAAAGGTGAGAAAATGG - Intergenic
978564450 4:110066896-110066918 CAATGGGGAGGGAGAGCATTAGG - Intronic
979754909 4:124328329-124328351 GAATGGGTAAGGATAGGAGTGGG + Intergenic
980140106 4:128905316-128905338 CAGTGGAGATGGAGAGAAGTGGG - Intronic
980164178 4:129204630-129204652 CAATGAGAAAGCAGAGTAGGAGG + Intergenic
980312375 4:131148110-131148132 CAATGAAAAATGAGAGAAGAGGG + Intergenic
980342054 4:131563482-131563504 CTATGGGGAAGGAGAGCATTAGG - Intergenic
980655326 4:135775483-135775505 AAATAAGAAAGGAGAGAAATTGG + Intergenic
980953284 4:139402927-139402949 ACATGGAAATGGAGAGAAGTTGG - Intronic
981567174 4:146113856-146113878 GAAAGGGAAAGGTGAGAAGAGGG + Intergenic
981658288 4:147137181-147137203 CAGTGGGGATGGAGAGAACTAGG - Intergenic
981804521 4:148698903-148698925 AAATTTGAAGGGAGAGAAGTTGG + Intergenic
981844401 4:149151260-149151282 TAAAGTGAAAAGAGAGAAGTAGG + Intergenic
982602248 4:157467476-157467498 CAATGGGAAAAGAGAGAGGGAGG - Intergenic
982662005 4:158218517-158218539 CAAGAGGAAAGGAGAAAAGAAGG - Intronic
983245955 4:165286887-165286909 CACTGGGGAAGGAAAGTAGTTGG + Intronic
983284762 4:165725601-165725623 CTATGGGAAAGGGGAGAGCTAGG + Intergenic
983533864 4:168837011-168837033 AAATGGAAAAAGAGAGAAGGTGG - Intronic
983648118 4:170012219-170012241 CAGTGGGGAAGGAAAGAAGTTGG + Intronic
983991871 4:174129681-174129703 TAGTGGGAATGGAGAGAAGTGGG - Intergenic
984264290 4:177478021-177478043 CAAAGCAAAAGGAGAGAAGCAGG + Intergenic
984686126 4:182670366-182670388 CACTGGGAAAGAAGAGAGGAAGG + Intronic
985253406 4:188045083-188045105 CAGTGGCAGAGGAAAGAAGTGGG + Intergenic
985614067 5:909057-909079 GGGTGGGATAGGAGAGAAGTGGG - Intronic
986353436 5:6902195-6902217 GGATGGGAAAGGAGAAGAGTGGG + Intergenic
986362430 5:6993190-6993212 GAAGGGGGAAGGAGAGAAGACGG - Intergenic
987362646 5:17121125-17121147 CAAAGAGAATGGAGAGAAGGTGG + Intronic
988136936 5:27185441-27185463 CACTGGGGAAGGAAAAAAGTAGG + Intergenic
988395083 5:30687052-30687074 AAAAGGGAAAGTAGAAAAGTTGG - Intergenic
988724176 5:33909312-33909334 GACTGGGATAGGAGAGAGGTTGG + Intergenic
989189390 5:38655310-38655332 GAATGGGGAAGGAGAGAGGGAGG - Intergenic
989192590 5:38685852-38685874 CCAAGGGAAAGGAGAGACTTAGG - Intergenic
989436851 5:41424096-41424118 GAAGGGGAATGGAGAGATGTTGG - Intronic
990318491 5:54607161-54607183 AAATGGGAAATGAGAAGAGTGGG - Intergenic
991106249 5:62845578-62845600 GAAGGGGAATGGAGAAAAGTTGG - Intergenic
991350539 5:65716264-65716286 AAATGAGAAAGGGGAGGAGTAGG + Intronic
991470017 5:66957878-66957900 CCCTGGGCAAGGAGGGAAGTAGG - Intronic
991650557 5:68848153-68848175 GAATGGGCAAGGAGAGAAGCGGG + Intergenic
991662256 5:68962197-68962219 CAATGAGAATGGAGAGAAGTAGG + Intergenic
991936238 5:71803628-71803650 CCAAGGAGAAGGAGAGAAGTAGG + Intergenic
992035910 5:72775876-72775898 CTGTGGGACAGGAGAGGAGTAGG - Intergenic
992116347 5:73541749-73541771 CAAAAGGAAAAGAGAGAAGGAGG + Intergenic
992149935 5:73892886-73892908 GAATTGTAAAGGATAGAAGTGGG - Intronic
992467707 5:77023560-77023582 GAATGGGAGAGGAGAGAATAAGG - Intergenic
992736835 5:79730199-79730221 CAGTGTCAAAGGAGAGAAGGAGG + Exonic
992747854 5:79836628-79836650 CACTTGGAAGGAAGAGAAGTTGG + Intergenic
992846547 5:80755078-80755100 AAATGGGAAGGGAGAGTAGCAGG + Intronic
993351830 5:86858977-86858999 CAGGAGGAAAAGAGAGAAGTGGG - Intergenic
993355564 5:86902990-86903012 TAGTGGAAAAGGAGAAAAGTGGG - Intergenic
993477970 5:88388507-88388529 CAATGAGAAAGAAGGGAAGTGGG + Intergenic
993766165 5:91861416-91861438 TAAGGGGAAAGGAGAGCATTAGG + Intergenic
993893447 5:93502989-93503011 CTATGGGAAAGGAGAGAAAAGGG + Intergenic
994016703 5:94975175-94975197 CAAAGGGAAAGGGGTGAAGAGGG + Intronic
994638952 5:102381215-102381237 AAATGGGAAATGAGAGATATTGG - Intronic
995164421 5:109022383-109022405 GAATGGGAAGAGAGACAAGTAGG + Intronic
995245450 5:109930277-109930299 CAAAGGGAAAGAAGAGAATCAGG - Intergenic
995441775 5:112200162-112200184 CATTGGGAATGGAAAGAAGCAGG - Intronic
995815539 5:116163935-116163957 CAATGGGAAAGGGTAGAAAAAGG - Intronic
996813495 5:127546038-127546060 CAAAGAGAAGGGAGAGAAATGGG - Intronic
996853407 5:127977882-127977904 CATTGGGAAAGAAGTGAAGTGGG - Intergenic
996974899 5:129420083-129420105 AATGGGGAAAGGAGAGACGTTGG + Intergenic
997015471 5:129929118-129929140 AAATGGGAAAGAAAAGAGGTAGG + Intronic
997919562 5:137965525-137965547 CAAAGGTAAATGAGAGAAATGGG - Intronic
998583925 5:143405551-143405573 TGATGTGAAAGGAAAGAAGTAGG + Intronic
999041804 5:148421999-148422021 CAATGGGAAAGGAGAGATGTAGG - Intronic
999089305 5:148921359-148921381 GAATGTGGAAGGAGAGAAGGAGG + Intergenic
999513186 5:152274203-152274225 GACAGGGAAAGGAGAGATGTTGG - Intergenic
999772878 5:154788583-154788605 CAAAGTGATAGGGGAGAAGTCGG + Intronic
999837803 5:155393283-155393305 CGAAGGGAAAGGAGAGAGGAAGG + Intergenic
1000195296 5:158951335-158951357 CAATGGCAAAAGAGGGAACTTGG + Intronic
1000419582 5:161023041-161023063 GACTAGGAAAGGAGAGAAGAGGG + Intergenic
1000461683 5:161529429-161529451 AAATGGGATAGGAGAAAAATCGG + Intronic
1001009690 5:168086471-168086493 CCAGGGAAAAGGAGAGAACTGGG + Intronic
1001133015 5:169079928-169079950 CAAAGGGAAGAGAGAGAAGAGGG + Intronic
1001356094 5:171024430-171024452 TAATGGGAAAGTTGAGTAGTTGG + Intronic
1001840323 5:174870691-174870713 AACTGGGCAGGGAGAGAAGTAGG - Intergenic
1002816708 6:687781-687803 CACTGGGATGGGTGAGAAGTTGG + Intronic
1003156292 6:3598392-3598414 AAAGGGGAATGGAGAGACGTTGG - Intergenic
1003484870 6:6566970-6566992 CTGTGGCAAAGGAAAGAAGTCGG - Intergenic
1003511585 6:6785710-6785732 CAAGGGGAAGGGGGAGAAGAGGG + Intergenic
1003674740 6:8192784-8192806 AAAGGAGAAAGGAGAGAAGGTGG + Intergenic
1003944464 6:11061154-11061176 ATATGGGAAAGCAAAGAAGTTGG - Intergenic
1004271725 6:14201692-14201714 CAGTGAGAAAGGTGAGAACTAGG + Intergenic
1004723295 6:18287998-18288020 CATAGAGAAAGGAGAGAGGTGGG + Intergenic
1004964327 6:20830693-20830715 TAATAGGAGAGGAGAGAAGGAGG - Intronic
1005283717 6:24302436-24302458 GAATGGGAAAGGAAAGATGATGG - Intronic
1005672229 6:28118321-28118343 AAATGGGAAAGTGGAGAGGTAGG + Intergenic
1006364962 6:33609967-33609989 AAACAGGAAAGGAGAGAAGGGGG - Intergenic
1006863127 6:37187030-37187052 AAATAGGAAAGAAGAGAAGGAGG - Intergenic
1007031955 6:38636600-38636622 CAATGGGAATGGATAGATTTTGG - Intronic
1007816949 6:44531400-44531422 ATATGGGGAAGGAGAGAAGGGGG + Intergenic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1008555918 6:52672736-52672758 CAATGAGAATGGAGAGAAGGTGG - Intronic
1008695913 6:54036846-54036868 GCATGGGAAATGAGAGAAGTTGG + Intronic
1009588198 6:65633866-65633888 CAATGGCAAAGGTAAGTAGTTGG + Intronic
1009618130 6:66037595-66037617 CAGTTGCAAAAGAGAGAAGTGGG + Intergenic
1009670640 6:66744906-66744928 CAAGGGGAAAGGGGAGAGTTGGG - Intergenic
1010306449 6:74328765-74328787 CAATGGGAATGAAGAGAAGTTGG - Intergenic
1010330258 6:74615393-74615415 CACAGTGAAGGGAGAGAAGTAGG + Intergenic
1010625374 6:78131761-78131783 CCTTGGGAAAAGAGAGGAGTGGG + Intergenic
1011293682 6:85804940-85804962 CACTGTGAACTGAGAGAAGTAGG - Intergenic
1011731813 6:90272791-90272813 CATTAGGAAAGAAGAGAAGAGGG - Intronic
1011935292 6:92769652-92769674 AAATGAGAAAGGAGAGAAAAGGG + Intergenic
1012171075 6:96016641-96016663 CTTTGGGAAAGGAGAGAAGGTGG - Intronic
1012668291 6:102007262-102007284 TAATTGAAAAGGAGAGAAATGGG + Intronic
1013270556 6:108542010-108542032 GAAAGGGAAAAGAGAGAAGGAGG - Intergenic
1013434688 6:110091310-110091332 CAATTGGAAAGGAGGGAAAAAGG - Intergenic
1013895176 6:115079389-115079411 CAGTGAGAAAGCAGACAAGTAGG + Intergenic
1014203490 6:118629849-118629871 TGATTAGAAAGGAGAGAAGTGGG - Intronic
1014418318 6:121211461-121211483 CAATGGGAAAGGATAGGAGAGGG - Intronic
1015062664 6:128985703-128985725 CAGTGGGAAAGGAGAACAGTTGG - Intronic
1015837512 6:137437179-137437201 AAATTGGAAAGGGGAGAAGGGGG - Intergenic
1015857460 6:137640587-137640609 CAAAGGGAATAGAGAGAAGAGGG - Intergenic
1016099636 6:140082744-140082766 CAATGGAAATGGTGAGAAGAAGG + Intergenic
1016979618 6:149842536-149842558 GACTGGGAAAGGAGAGACGCTGG - Intronic
1017882988 6:158574361-158574383 TAACGGGAAAGAAAAGAAGTTGG - Intronic
1018328418 6:162700098-162700120 CATAGGGAAAGGAGAGAGGAGGG - Intronic
1018498590 6:164378000-164378022 CAAGGGCAAAGGAGAGAAGCTGG - Intergenic
1018512271 6:164537873-164537895 CCATCTGAAAAGAGAGAAGTAGG - Intergenic
1018651845 6:165998908-165998930 CACTGGGAATGGAGAGAAGGAGG - Intergenic
1018715710 6:166530948-166530970 CATTGGGAAAGCAGAGCAGCAGG - Intronic
1019436388 7:1024420-1024442 CCATGGGACAGGAGAGACGCAGG + Intronic
1019532720 7:1511687-1511709 CACTGCGGGAGGAGAGAAGTGGG - Intergenic
1019727828 7:2612674-2612696 CCATGGGAAAGGTGAGCTGTGGG + Exonic
1020029105 7:4920529-4920551 GAAAGGGAAAGGAGAGAGGGAGG - Intronic
1020382820 7:7565670-7565692 GAGTGGGCATGGAGAGAAGTGGG - Intergenic
1020581315 7:10005911-10005933 AGTTGGGAAAGTAGAGAAGTGGG - Intergenic
1022045319 7:26617967-26617989 CAAGGGGAAAGAAAAGAAGGAGG + Intergenic
1023001226 7:35809922-35809944 CAATGGGAAAGGACATGAGGGGG + Intronic
1023300441 7:38764750-38764772 CAATGGAAAAGGACTGAATTTGG + Intronic
1024146639 7:46523529-46523551 AAAAGGGAAAGGAGAGAAAGAGG - Intergenic
1024208462 7:47183652-47183674 CAGTGGGAGTAGAGAGAAGTGGG + Intergenic
1024215938 7:47248060-47248082 CCATGGCAAAGGTGAGAATTTGG - Intergenic
1024287790 7:47774345-47774367 CACTGGGAAAGGACAGGGGTAGG - Intronic
1024437364 7:49374834-49374856 CACATTGAAAGGAGAGAAGTGGG - Intergenic
1024507008 7:50170363-50170385 GAAAGGGAAAGGAGAGAAGGAGG + Intergenic
1024677017 7:51646122-51646144 CAATGGGAAATGAGAGACAGAGG + Intergenic
1024777323 7:52802649-52802671 CAGTGGAATAGGAGAGAAGATGG - Intergenic
1024858975 7:53815548-53815570 CTATGGGAAAGAAGGGAAGATGG - Intergenic
1025035562 7:55590882-55590904 CCCTGGGGAAGGAGAGAAGCAGG - Intergenic
1025061860 7:55816205-55816227 GATTGGGGAGGGAGAGAAGTGGG + Intronic
1025986643 7:66458715-66458737 CAATGGGAAGGGAAAGATGACGG + Intergenic
1026019661 7:66697437-66697459 CACTGTGAAGGGAGAGACGTCGG - Intronic
1026215284 7:68342966-68342988 CAATGGGAGTGATGAGAAGTGGG + Intergenic
1026880723 7:73905143-73905165 CACTGTGAAGGGAGAGACGTCGG + Intergenic
1027416560 7:77980586-77980608 GAATGGGAAAGAAAAGAAGGAGG - Intergenic
1027529783 7:79315897-79315919 GAGTGGGAAAGGAGCTAAGTTGG + Intronic
1028465478 7:91146753-91146775 GAATGGCAAAGGACAAAAGTGGG - Intronic
1028469259 7:91186484-91186506 CAATGATAATGGGGAGAAGTTGG - Intronic
1028600301 7:92593512-92593534 GAGTGGGAAGGGAGGGAAGTGGG - Intergenic
1028879335 7:95861993-95862015 CACTGGCAAAAGAGTGAAGTTGG + Intronic
1029026585 7:97423276-97423298 GAATGGGAAGAGAGAGGAGTAGG - Intergenic
1029424117 7:100485975-100485997 CAATGGGAGAGAAGAGGAGAAGG - Intronic
1030290233 7:107864754-107864776 GGCTGGCAAAGGAGAGAAGTGGG + Intergenic
1030308990 7:108050063-108050085 CAATGGCAGAGGTGAGTAGTTGG - Intronic
1031378170 7:121052623-121052645 CAATGGAGAAGGTGAGAAGGGGG + Intronic
1031383144 7:121112938-121112960 CAAGGGAAAACAAGAGAAGTGGG + Intronic
1031813500 7:126402686-126402708 CCATGGAAAAGCAGAGAAATAGG + Intergenic
1031868994 7:127071992-127072014 CAAAGGGAATGGAGAGAAACTGG - Intronic
1031965459 7:128025008-128025030 CTAAGGGGAAGGAGTGAAGTAGG - Intronic
1032228435 7:130052754-130052776 CAATGGGCAAAGAGGAAAGTGGG + Intergenic
1032318650 7:130864771-130864793 CAGGGGGAATGAAGAGAAGTTGG + Intergenic
1032777895 7:135134075-135134097 GGATGGGAAAGGAGGGAAGCAGG + Intronic
1032804584 7:135341448-135341470 CAAGGGCAAAGGAGAGAAAAGGG + Intergenic
1032849588 7:135782658-135782680 GGATGGGAAAGGAGGGAAGTGGG - Intergenic
1032920491 7:136540035-136540057 CAAGGGGAAGGGAGAGCATTAGG + Intergenic
1033462918 7:141563616-141563638 CAATGAGAAGGGGGTGAAGTTGG - Intronic
1033982610 7:147184702-147184724 AAAGGGAAAAAGAGAGAAGTTGG + Intronic
1034453791 7:151153075-151153097 GACTGGGGAAGGAAAGAAGTGGG + Intronic
1034783938 7:153907889-153907911 CACTAGGAAAGCAGAGATGTGGG + Intronic
1034889727 7:154829387-154829409 AAAAAGGAAAGGAGAGAAGAGGG + Intronic
1035114606 7:156514195-156514217 CAAAGGGACAGGAGGGAATTTGG + Intergenic
1035699797 8:1630012-1630034 CAATGGTTAAGCAGACAAGTTGG + Intronic
1035849084 8:2896326-2896348 GAATGCGTAAGGAGGGAAGTGGG + Intergenic
1035947103 8:3977303-3977325 CATTGGGAAAGGAATGAAATGGG - Intronic
1036118234 8:5985004-5985026 CAATGAGAATGTAGAGAAATTGG + Intergenic
1036134519 8:6148019-6148041 CCTTGGGAAAGGAGAGGGGTTGG + Intergenic
1036215759 8:6878442-6878464 TAGTGGGAAAAGAGAAAAGTTGG - Intergenic
1036962574 8:13261351-13261373 GAATGGGAAAGGATAGAAGAAGG + Intronic
1037689926 8:21172959-21172981 AAATGGGAACAGAGAGGAGTGGG + Intergenic
1037801999 8:22040957-22040979 CAGGGGGAAAGCAGAGAGGTGGG + Intergenic
1038207248 8:25478308-25478330 GAATGCAAAAGGTGAGAAGTGGG - Intronic
1039080197 8:33726533-33726555 CAAGAGGAAAGGAGAAAACTGGG + Intergenic
1039267687 8:35843624-35843646 CAAGGGGAAGGGAGAGCATTAGG - Intergenic
1039846576 8:41329901-41329923 CAAGGGGAAAGGTGGGAAGGTGG - Intergenic
1040512371 8:48106349-48106371 GAAAGGGAAGGGAGAGAAGTTGG - Intergenic
1041608127 8:59809539-59809561 AAATGGGAAAAGAGGAAAGTAGG - Intergenic
1042086192 8:65111909-65111931 AAATGGGAAAGAAGTGGAGTGGG - Intergenic
1042472135 8:69202580-69202602 CAATAGAAAAGGAGACATGTTGG + Intergenic
1043506035 8:80903929-80903951 GAATGGGGGAGGGGAGAAGTGGG + Intergenic
1044080016 8:87872326-87872348 CAGTGGGAGAGGAGAGGAGGGGG - Exonic
1044415802 8:91938048-91938070 GAATGGGAAAGGAGAACAGATGG - Intergenic
1044839457 8:96325588-96325610 CAGTGGGAATGGAGAGGAGATGG - Intronic
1045252101 8:100490822-100490844 GAATGAGGAAGGAGAGAACTGGG - Intergenic
1045322199 8:101090801-101090823 CAGTGGGGATGGAGAGAATTGGG + Intergenic
1045863622 8:106840256-106840278 CAATGAGGATGGAGAGAAGATGG - Intergenic
1046393363 8:113606601-113606623 AATTGGGAGAGGAGTGAAGTAGG + Intronic
1046790761 8:118319333-118319355 CAGGGTGAAGGGAGAGAAGTGGG - Intronic
1046964338 8:120147030-120147052 GAAAGGGAAAGGAAAGAAGGAGG - Intronic
1047805319 8:128353396-128353418 CACTTGGAAAGGTGACAAGTGGG - Intergenic
1047937599 8:129797734-129797756 CAGTGGGAAGAGAGAGAAGGGGG + Intergenic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1048466274 8:134667145-134667167 GAAAGGGAAAGGAGAGCATTAGG + Intronic
1048598310 8:135890496-135890518 CAATGGGAAAGACAAGAAATAGG - Intergenic
1048598921 8:135897760-135897782 CAATGTGCAAGGACAGAAGAGGG + Intergenic
1049062504 8:140286910-140286932 AGATGGGGAAGGAAAGAAGTGGG + Intronic
1049152043 8:141041275-141041297 CACTGGGACAGCAGTGAAGTAGG + Intergenic
1049688789 8:143949859-143949881 CACTGGGACAGGAGAGGAGGCGG + Intronic
1050014487 9:1219498-1219520 GAAGGGGAAAGGGGAGATGTTGG + Intergenic
1050098538 9:2093702-2093724 GAATGGGAAAAGAGACAAGATGG - Intronic
1051624629 9:19087213-19087235 CAAAGGGAAAATAGAGAAGTGGG - Intronic
1051626022 9:19100931-19100953 GAAAGGAAAAGGAGAGAAGGAGG + Intronic
1051828788 9:21252388-21252410 AAATGGAAGAGGAGAGAAATTGG - Intergenic
1051834286 9:21317574-21317596 AAATGGGAGAGGAGAGAAACTGG - Intergenic
1051834291 9:21317598-21317620 AAATGGGAGAGGAGAGAAACTGG - Intergenic
1051900373 9:22032320-22032342 AAAGGGGAAAGGAGAAAAATGGG - Intronic
1053437553 9:38086550-38086572 CCAGGGGAGAGAAGAGAAGTGGG + Intergenic
1054914484 9:70483298-70483320 CCATGGGAAAGGTGAGAGGCTGG + Intergenic
1055318413 9:75057240-75057262 CAGTGGGAAGGGGGAGAAGAGGG + Intergenic
1055418896 9:76114964-76114986 GAATGGGGACAGAGAGAAGTGGG + Intronic
1055625414 9:78172292-78172314 GATGGGGAAAGGAGAGAGGTTGG + Intergenic
1056554598 9:87678046-87678068 CAAAGGGAAAGGAAAGGACTGGG - Intronic
1056923722 9:90814585-90814607 AACTGGGAAAGGGGAGAGGTGGG - Intronic
1057961263 9:99459536-99459558 GAATGGCAGAGCAGAGAAGTGGG + Intergenic
1059353535 9:113682940-113682962 CACTGGGAAGGGAGGGAAGGGGG + Intergenic
1060051997 9:120384307-120384329 CAATGGGAAAAGAGGGGACTTGG + Intergenic
1060446131 9:123690002-123690024 GAAAGGGAAAGGAGGGAAGGAGG + Intronic
1060814488 9:126627450-126627472 CCAAGGGAAAGCAGAGAAGGAGG + Intronic
1061156570 9:128865736-128865758 CAATGGGAAATGAGAGAATTTGG + Intronic
1062356058 9:136163224-136163246 AACTGGGAAAGGAGAGAATGGGG - Intergenic
1185833833 X:3327112-3327134 CAATGGGAACGGGCAGAAGTAGG - Intronic
1186307385 X:8277049-8277071 CACTGGGAAGAGAGAGAAGTGGG + Intergenic
1186313946 X:8348940-8348962 CATAGGGAAGGGTGAGAAGTTGG - Intergenic
1186631225 X:11351109-11351131 CAGGAGGAAATGAGAGAAGTGGG - Intronic
1187027067 X:15446664-15446686 TAATGGGAAAGCAGAGGAGGAGG - Intronic
1187092847 X:16115566-16115588 CATATGGAAAGTAGAGAAGTGGG - Intergenic
1187350571 X:18511756-18511778 TAATGGGAAAAGAGAAAAGGTGG + Intronic
1187380415 X:18796688-18796710 CAATGAGGAGAGAGAGAAGTGGG + Intronic
1187711672 X:22060598-22060620 GAATGGGAAAGCAGACAAGGGGG + Intronic
1187718717 X:22130138-22130160 CAATGGGGAGGGAAAGAAGTGGG - Intronic
1187970034 X:24649731-24649753 CAATGGGACAGGGGAGGATTAGG - Intronic
1187974362 X:24690607-24690629 CTCTGGGAAAGGTGAGAAGGAGG - Intergenic
1188483493 X:30657802-30657824 GAAGGGGAAATGAGAGAAGGGGG + Intronic
1188580034 X:31700366-31700388 CAATGTGTATGGAGAGGAGTTGG + Intronic
1189198991 X:39175595-39175617 CAGTGGGGAAGGAGAGAGGAGGG + Intergenic
1189286120 X:39853658-39853680 AAAGAGGAAAGGAGAGAAGGGGG + Intergenic
1189331809 X:40148770-40148792 CATTGGCAAAGGAGGGAAATGGG + Intronic
1190146156 X:47893318-47893340 CAATGGGAAGGGAGAGGTTTTGG + Intronic
1190335464 X:49259073-49259095 CAGTGGAGAAGGCGAGAAGTGGG + Intronic
1191960767 X:66699342-66699364 CAGTGGGAAAGGATGGAAATGGG - Intergenic
1192248650 X:69392974-69392996 AAATGGGAAAGACCAGAAGTTGG - Intergenic
1193344828 X:80393377-80393399 CAATGGGAGGGGAGAGAAACGGG - Intronic
1193703984 X:84798060-84798082 CAAAGGGAAAGGAGAGGGGAAGG - Intergenic
1193740033 X:85205892-85205914 CAATGGAGATAGAGAGAAGTGGG + Intergenic
1193948893 X:87774025-87774047 AAATGGGAAAAGGGAAAAGTGGG + Intergenic
1194656158 X:96576242-96576264 CAATGGGAAAAGAGAGTTGAGGG + Intergenic
1195348776 X:103977494-103977516 CAATGGAAAAGGAAAGCAATGGG - Intergenic
1195356145 X:104041595-104041617 CAATGGAAAAGGAAAGCAATGGG - Exonic
1195358666 X:104061345-104061367 CAATGGAAAAGGAAAGCAATGGG + Intergenic
1195408561 X:104544056-104544078 CAGTGGAGATGGAGAGAAGTAGG - Intergenic
1195573024 X:106417615-106417637 CAAGGGGCAAGGACAGAAGTAGG + Intergenic
1195923005 X:110001878-110001900 TCAGGAGAAAGGAGAGAAGTGGG + Intergenic
1196009458 X:110871568-110871590 CAATAAGAAAGAAGAAAAGTAGG - Intergenic
1196149348 X:112355336-112355358 CAAAAGGAAAGGAGGGAAGAAGG + Intergenic
1196169264 X:112569463-112569485 CAAAGATAAATGAGAGAAGTGGG + Intergenic
1196978951 X:121190653-121190675 CAGTGGGCAAGGAGTGAAGGTGG - Intergenic
1197319710 X:125012195-125012217 CCATGGGGAAGGAGAGCATTAGG + Intergenic
1197501382 X:127245784-127245806 CAATAGGAAGAGAGAGCAGTAGG - Intergenic
1198112031 X:133510248-133510270 CATTGGGCAAGGAGAGATGAGGG - Intergenic
1198160916 X:134007320-134007342 CAATGGGAGAAGAAAGAAGATGG + Intergenic
1198191771 X:134314482-134314504 CAATGGGGAAGTGGAGAAATTGG + Intergenic
1198613197 X:138424990-138425012 TAATGAGAAAAGAGAGATGTTGG - Intergenic
1198740750 X:139839714-139839736 CAATGGGAAACGATTCAAGTGGG - Intronic
1198835274 X:140797965-140797987 CAATGGAAAAGGAGAAAAACTGG - Intergenic
1199598803 X:149528418-149528440 GAATGGGAAAGGAGAGGAGAGGG - Intronic
1199598822 X:149528507-149528529 GAAGGGGAAAGGAGAGGAGAGGG - Intronic
1199598872 X:149528715-149528737 GAAGGGGAAAGGAGAGGAGAGGG - Intronic
1199878637 X:151955088-151955110 AAATGGACAAGGAAAGAAGTGGG + Intronic
1200122534 X:153797946-153797968 GAAAAGGAAAGGAGAGAAATGGG - Intronic
1200760783 Y:7036881-7036903 CTTTGGAAAAGGAGAGCAGTAGG + Intronic
1201116054 Y:10836190-10836212 CAAATGGAAAGGAGTGAAATGGG - Intergenic
1201575931 Y:15461245-15461267 CAATAGGGAAAGAGAGAAGGAGG - Intergenic
1201650538 Y:16280004-16280026 AAATGGGAATGGAGGGAAGGAGG - Intergenic
1201904907 Y:19077856-19077878 CACTGGGCAAGGAGAGCAGTGGG + Intergenic
1201924696 Y:19271746-19271768 CAATGTGAAAGCAAAGAGGTAGG - Intergenic
1201938475 Y:19433185-19433207 CAGTGCAAAAGGAGAGAATTAGG + Intergenic
1202344484 Y:23907022-23907044 CACTGGAAAAGGAGAGATGGGGG - Intergenic
1202526284 Y:25763061-25763083 CACTGGAAAAGGAGAGATGGGGG + Intergenic