ID: 968743475

View in Genome Browser
Species Human (GRCh38)
Location 4:2343759-2343781
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 372
Summary {0: 2, 1: 0, 2: 1, 3: 39, 4: 330}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968743465_968743475 26 Left 968743465 4:2343710-2343732 CCCAGGTGGCACAGCTTGCCCAA 0: 2
1: 0
2: 2
3: 13
4: 189
Right 968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG 0: 2
1: 0
2: 1
3: 39
4: 330
968743470_968743475 7 Left 968743470 4:2343729-2343751 CCAAGGCTGAGGAGCTTTTAGTG 0: 1
1: 0
2: 1
3: 34
4: 1064
Right 968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG 0: 2
1: 0
2: 1
3: 39
4: 330
968743466_968743475 25 Left 968743466 4:2343711-2343733 CCAGGTGGCACAGCTTGCCCAAG 0: 2
1: 0
2: 2
3: 17
4: 156
Right 968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG 0: 2
1: 0
2: 1
3: 39
4: 330
968743469_968743475 8 Left 968743469 4:2343728-2343750 CCCAAGGCTGAGGAGCTTTTAGT 0: 1
1: 0
2: 0
3: 16
4: 225
Right 968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG 0: 2
1: 0
2: 1
3: 39
4: 330

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900429834 1:2596321-2596343 CAGGTGGTACAAGTTGCCCCTGG - Intronic
901260782 1:7869140-7869162 CAGATGGCAGAGGCTGCCCAAGG + Intergenic
901425345 1:9179115-9179137 CAGGTGCCACTGCCTGCCCCAGG + Intergenic
901768153 1:11516855-11516877 GAGGTCACACAGCCTGCCCAAGG - Intronic
902225698 1:14995208-14995230 CAGGTGGAACAGGATGGCCAGGG - Intronic
902606279 1:17571125-17571147 CAGGTGACCCAGGTGGCCCAGGG + Intronic
903063808 1:20687330-20687352 GAGCAGGCAGAGCTTGCCCAGGG - Intronic
903212810 1:21828235-21828257 AAGGTGGGAAAGCCTGCCCAGGG - Exonic
904702428 1:32365906-32365928 CAGGTGGCACAGCTGGGCTAAGG + Intronic
907852097 1:58265220-58265242 GAGGTGGCACGGCTTACCCAAGG + Intronic
908783092 1:67709409-67709431 CTAGTGGCACAAATTGCCCAGGG - Intronic
910052950 1:82997621-82997643 CAGCTGGGACAGTTTGACCAAGG - Intergenic
910206292 1:84752086-84752108 CAGGTGGCACTTCTTATCCATGG - Intergenic
910546743 1:88426485-88426507 CAGGTGGCTCAGCATGAACAAGG + Intergenic
912048132 1:105486599-105486621 CAGGAGGCAGAGCTGGACCAGGG - Intergenic
912134434 1:106642746-106642768 CAGGTTAAACAACTTGCCCAAGG - Intergenic
912771186 1:112465386-112465408 CAGGGAGCAGAGCTTTCCCATGG - Intergenic
913369135 1:118077493-118077515 CAGGTGGCAAAAGTTGCCTAAGG + Intronic
914893293 1:151647720-151647742 CAGGTAGCACAGCTGAGCCAGGG - Intronic
916428469 1:164704329-164704351 CTGGTTGCACAGCTTTCCCAGGG + Intronic
917188669 1:172390328-172390350 GAGGTTAAACAGCTTGCCCAAGG + Intronic
917645458 1:177024830-177024852 CAGTTGGCAAAACTAGCCCATGG + Intronic
917994496 1:180421135-180421157 CAGGTGGAACAGCTAGCTAATGG - Intronic
918303785 1:183227704-183227726 CAGGTGGCAGAGCAGACCCATGG - Intronic
920972312 1:210753442-210753464 CAAGTAGCCCAGCTTCCCCATGG + Intronic
922847704 1:228702424-228702446 CAGGAGGCAAAGCTGGGCCAGGG + Intergenic
1063320496 10:5047304-5047326 CTGGTGTTACAGCTTGACCAAGG + Intronic
1063372453 10:5530652-5530674 CATGTGGCCCTGCTGGCCCATGG + Intergenic
1064324239 10:14333700-14333722 CAAGTGGCTCAATTTGCCCAGGG + Intronic
1069359661 10:67627184-67627206 CAGGAGGCAGAGCTGGACCAGGG - Intronic
1069399448 10:68026923-68026945 CAGGAGGCACAGCTTGCCATGGG + Intronic
1070133563 10:73672178-73672200 CAGGTAGCACAGCTGAGCCAGGG - Intergenic
1070171301 10:73934855-73934877 CTAGGGGCACAGCTAGCCCAGGG + Intergenic
1070798770 10:79232828-79232850 AAAGTGGCACATCTTGCACAGGG - Intronic
1072158764 10:92747297-92747319 GAGGTGACAGAGCTCGCCCAAGG + Intergenic
1072603335 10:96953913-96953935 CATGTGGCAAAACATGCCCAAGG - Intronic
1072717897 10:97763528-97763550 GAGGTCACACAGCTTGCACATGG - Intergenic
1073784531 10:106873949-106873971 GAGGTTGGGCAGCTTGCCCAAGG - Intronic
1074314507 10:112349506-112349528 GAGGTGCCAAAACTTGCCCAAGG - Intergenic
1075209147 10:120476196-120476218 CAGGGGGCACAGCTGGCCCCAGG - Intronic
1075333356 10:121591331-121591353 CACCTGGCACAGCCAGCCCACGG + Intronic
1075670372 10:124260323-124260345 CAGGTGACACAGGTAGCTCAAGG - Intergenic
1076214207 10:128679792-128679814 CAGGTGGCAGAGCCAGCCCAGGG + Intergenic
1076300228 10:129419956-129419978 CAGGTAGCACAGCTGACCCTGGG - Intergenic
1076413673 10:130269858-130269880 CTGCTGGAACAGCTTGTCCAGGG + Intergenic
1076693534 10:132236205-132236227 CAGGTGGCAGAGCCTGCGCACGG + Intronic
1077417800 11:2432924-2432946 CCACTGGCAGAGCTTGCCCATGG - Intergenic
1077988230 11:7376877-7376899 GAGGTTGAACAGCTTGCCCATGG - Intronic
1078362605 11:10680702-10680724 AAGATGAAACAGCTTGCCCAAGG - Intronic
1078680113 11:13467853-13467875 CAGGAGGCATAGCTTGGCCAGGG + Intergenic
1079365061 11:19801759-19801781 CAGGTGACGTAACTTGCCCAAGG - Intronic
1081330512 11:41794278-41794300 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1081496509 11:43616634-43616656 GAGATGGCATAACTTGCCCAAGG + Intronic
1083203252 11:61132453-61132475 CAGGTGGGACAGCATCCTCATGG + Exonic
1083756262 11:64793295-64793317 CAGGTTGCACAGACTGCACACGG + Intronic
1083844012 11:65320768-65320790 CAGGTGCCAGAGCTCGCCAACGG - Exonic
1084021845 11:66422448-66422470 CAGGTGGACCTGGTTGCCCAGGG + Exonic
1084275556 11:68049452-68049474 CAGGTGGCACAACTGGCACTGGG + Intronic
1084312916 11:68327058-68327080 CGGGCGGCACAGCTTGGCCAGGG - Intronic
1084392488 11:68887147-68887169 CAGGAGGCAGAGCTGGGCCAGGG + Intergenic
1084438301 11:69156818-69156840 GAGGTTGCACAACTTGCCCGAGG + Intergenic
1084901596 11:72314194-72314216 GAGGTGGCAGAGCTTCCCCAGGG + Intronic
1085197838 11:74683140-74683162 GAGGTTGAACACCTTGCCCAAGG - Intergenic
1088259209 11:107928621-107928643 CAGGAGGCAGGACTTGCCCACGG - Exonic
1088358739 11:108969465-108969487 CAGATGGCACAGGGTCCCCAGGG + Intergenic
1089081752 11:115781973-115781995 CATGTGGCAGAGCATGTCCATGG - Intergenic
1090242923 11:125196657-125196679 GAGGTGAGGCAGCTTGCCCAAGG - Intronic
1090421851 11:126580684-126580706 CACGTGGCCCTGCTTGTCCAGGG - Intronic
1090820167 11:130334977-130334999 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091141545 11:133239477-133239499 CAGGGAGCACAGCTCCCCCAAGG - Intronic
1091466854 12:692255-692277 CAGGAGGCACAGCTGGGCCAGGG + Intergenic
1091781505 12:3216947-3216969 CAGGAGGCTCAGCTTCCCCCAGG - Intronic
1092170006 12:6368645-6368667 CAGTTGGCACAGCTAGCAAATGG + Intronic
1092249364 12:6884062-6884084 CATGTGGCTCAGCCAGCCCATGG + Intronic
1092901451 12:13063254-13063276 CAGGCTCCACGGCTTGCCCAAGG - Intronic
1095946649 12:47757764-47757786 CTGGTGGCCCAGCTTGCTCTGGG - Intronic
1098951780 12:76646785-76646807 GAGGTTGAATAGCTTGCCCAAGG + Intergenic
1099971627 12:89506245-89506267 GAGGTGGAATAACTTGCCCAAGG - Intronic
1101442633 12:104715023-104715045 CAGGAGCCAGAACTTGCCCATGG - Intronic
1103375980 12:120456325-120456347 TTGGTGGCACATCTTGCTCAAGG + Intronic
1103839331 12:123850023-123850045 CAGATGGCCCAGATGGCCCAGGG - Intronic
1103915815 12:124375111-124375133 CAGGTTAATCAGCTTGCCCAAGG + Intronic
1104750310 12:131234233-131234255 CAGGTGGTACAGATTGGGCATGG + Intergenic
1104933997 12:132354980-132355002 ATGGCGGCACAGCTTGCTCAAGG + Intergenic
1106193475 13:27474158-27474180 CAGGTGACACTGCTTGCCAATGG + Intergenic
1106770561 13:32957480-32957502 CAGGTGGCTCAGCTTGCAGCTGG + Intergenic
1107499361 13:40957244-40957266 CAGGTAGCACAGCTGAGCCAGGG - Intronic
1107631263 13:42344802-42344824 CGGGTGCCACAGCTCTCCCATGG - Intergenic
1108340769 13:49496320-49496342 CAGGTGGCTCTGACTGCCCATGG + Intronic
1108531406 13:51330557-51330579 AAGGTGGGACATTTTGCCCAAGG + Intergenic
1108869986 13:54973019-54973041 CAAGAGGCACAGCTGGGCCAGGG + Intergenic
1109624621 13:64958620-64958642 CAGGCGGCACTGCTTGTGCAGGG + Intergenic
1110434611 13:75465136-75465158 CAGGTGCCAGAACTTGCGCAGGG + Intronic
1113533813 13:111048599-111048621 AAGGTGCCAGAGCTAGCCCACGG - Intergenic
1113586347 13:111468524-111468546 AAAGTGGCTCAGCATGCCCATGG - Intergenic
1113656049 13:112068277-112068299 CAGGAGGCGCAGCTGGCCTACGG + Exonic
1113972547 13:114200805-114200827 GAGGTGGCAGAACTTGGCCAAGG + Intergenic
1115175888 14:30560982-30561004 GAGGTTAAACAGCTTGCCCAGGG - Intronic
1115332454 14:32212886-32212908 CAAGTGGCTAAGCTTACCCAAGG - Intergenic
1116310352 14:43317693-43317715 CTGGTGGCACTTGTTGCCCATGG + Intergenic
1120870891 14:89336572-89336594 CAGGTCACACAGCTTGCAGATGG - Intronic
1121079964 14:91099794-91099816 AAGGTGGCACAGCAAGTCCAAGG - Intronic
1121282850 14:92711707-92711729 CAGGTGGTACTGCTTGTGCAGGG + Exonic
1122040258 14:98982671-98982693 GAGGTGGAATGGCTTGCCCAAGG + Intergenic
1122435286 14:101691181-101691203 CAGGTGGCAGAGATTTGCCAGGG - Intergenic
1122452273 14:101819277-101819299 CAGGGGCCACAGGCTGCCCAGGG - Intronic
1123449081 15:20349252-20349274 CATGTGGCTCAGCATGGCCAGGG + Intergenic
1123824832 15:24070581-24070603 TAGATGGCACAACTTGCTCATGG + Intergenic
1124136875 15:27042746-27042768 CAGGTGGCTGAGCATTCCCATGG - Intronic
1124186010 15:27530173-27530195 CAATTGGAACAGCTTGCCCCAGG - Intronic
1124239443 15:28017695-28017717 CAGGTGACACAGCCTGTGCATGG + Intronic
1124306040 15:28579955-28579977 CAGGAGGCACAGCTTGCAGTGGG - Intergenic
1125739788 15:41954224-41954246 CAGCAGGCACAGGGTGCCCAGGG - Intronic
1127358713 15:58226414-58226436 CAGCTGGCAGAGCATCCCCAGGG - Intronic
1127378594 15:58408023-58408045 CAGGTGGGAGAGCTGGGCCAAGG - Intronic
1128310640 15:66630023-66630045 CAGGGGGCACAGCTGTTCCAGGG - Intronic
1129188683 15:73925486-73925508 CAGGTGCCACGGCTTACCAATGG - Intergenic
1129230498 15:74194553-74194575 AAGGTGGCACTGTTTCCCCAAGG + Intronic
1129367423 15:75064895-75064917 CAGTTGGTTCAGCTTCCCCATGG - Intronic
1129671311 15:77609382-77609404 CTGGTGGCAGAACTTCCCCAGGG + Intergenic
1131174921 15:90203420-90203442 GAGCTGGCCCAGCTTTCCCAAGG - Intronic
1132495712 16:262347-262369 CATGTGGCACTGCGTGCCCCTGG + Intronic
1132777598 16:1604412-1604434 CAGGTGGCACAGCATGTGCAGGG + Intronic
1134108453 16:11499902-11499924 GAGGTAGGGCAGCTTGCCCAAGG - Intronic
1134388448 16:13795808-13795830 GAGGTGGAGTAGCTTGCCCAAGG - Intergenic
1134393631 16:13842578-13842600 GAGGTGTCATAGCTTGCCCAAGG - Intergenic
1135642892 16:24136420-24136442 CAGGTGGCACTTCTTGCCTCTGG - Intronic
1136143485 16:28301853-28301875 CAGGTGGCACAAACTGCCCAAGG + Intronic
1136746714 16:32597373-32597395 CTGGTGGAGCAGCTGGCCCATGG - Intergenic
1137451440 16:48578192-48578214 CAGGTGGCCCAGCTTGGTAATGG + Intronic
1138516321 16:57536970-57536992 TCGGTGGCAGAGCTGGCCCAGGG - Intergenic
1138602402 16:58063824-58063846 AAGGGGCGACAGCTTGCCCAAGG + Intergenic
1139044291 16:63038058-63038080 CAGGTGGCAGAGATTGTTCAGGG - Intergenic
1141070231 16:80947831-80947853 CATGTTGCCCTGCTTGCCCATGG - Intergenic
1141126394 16:81403919-81403941 GAGGCGGCGCAGCTTCCCCAAGG - Intergenic
1141168774 16:81678097-81678119 CTGGGTGCACGGCTTGCCCAAGG - Intronic
1141681993 16:85550294-85550316 GAGGTCGAGCAGCTTGCCCAAGG - Intergenic
1141997371 16:87644193-87644215 GAGGGGGCACAGCCTGGCCACGG - Intronic
1141998553 16:87649848-87649870 CAGGAGGCATAGCTTTCACATGG - Intronic
1203048843 16_KI270728v1_random:856577-856599 CTGGTGGAGCAGCTGGCCCATGG - Intergenic
1142496102 17:307056-307078 CAGGTGCCGCAGCTCACCCATGG + Intronic
1142517614 17:443086-443108 AAGGTCGCCCAGCTTGGCCAGGG + Exonic
1143090085 17:4444958-4444980 CAGATGGCCCAGCAGGCCCAGGG - Intronic
1143264514 17:5626045-5626067 CAGGTGAAACAGCTTGGCAAAGG - Intergenic
1143625932 17:8110116-8110138 CAGCTGGCGCAGCGTGGCCATGG + Exonic
1144767143 17:17739021-17739043 CAGTGGGAACAGCCTGCCCAAGG + Intronic
1144892425 17:18501563-18501585 CAGCTGGTACAGTTTGCGCATGG - Intergenic
1145139789 17:20442725-20442747 CAGCTGGTACAGTTTGCGCATGG + Intergenic
1145784632 17:27586010-27586032 CAGATGGCACCGCCTTCCCAGGG - Intronic
1145796071 17:27655953-27655975 CAGCTGGTACAGTTTGCACATGG - Intergenic
1145810521 17:27761272-27761294 CAGCTGGTACAGTTTGCGCATGG - Intronic
1145822435 17:27849742-27849764 CAGGTGACGCTGCTGGCCCAGGG - Intronic
1146952496 17:36916584-36916606 CAGGTGGGACAGCTCCCCCAAGG - Intergenic
1147580025 17:41622910-41622932 CAGCTGGCCCAGGCTGCCCAAGG + Intronic
1148088683 17:45009666-45009688 CAGGGCACAAAGCTTGCCCATGG - Intergenic
1149470827 17:56913968-56913990 CAGGGGGCACAGCTCTGCCATGG + Exonic
1151222354 17:72622512-72622534 GAGGTTGAACAGCTTGCCCTGGG - Intergenic
1151479665 17:74362526-74362548 CACCTGGCTCAGCTTGCCCCTGG - Intergenic
1151807395 17:76414655-76414677 CTGGAGGCACAGCCTGCCCGAGG + Intronic
1152099014 17:78290282-78290304 CAGGTGGCCCGGCTTGCCAAAGG + Intergenic
1152237527 17:79146347-79146369 CAGGAGGGAGAGCTTCCCCAGGG + Intronic
1152381035 17:79942348-79942370 GAGGCGGTGCAGCTTGCCCAGGG - Intronic
1152439058 17:80294225-80294247 CAGCTGGCACAGATGGCCCTTGG - Intronic
1152545553 17:80998518-80998540 CAGGCAGCAGGGCTTGCCCACGG - Intronic
1152569560 17:81115707-81115729 CAGGTGGCACAATTCACCCATGG + Intronic
1155619989 18:27767678-27767700 CAGGTAGCACAGCTTGTACAAGG + Intergenic
1155960786 18:31993197-31993219 CAGTGGGCTCAGCTTGCCCATGG + Intergenic
1156442309 18:37203686-37203708 CAGGAGGCACAGCCAGGCCAGGG + Intronic
1156497975 18:37538302-37538324 GAGGTTGGACAGCTTGCCCAGGG - Intronic
1156692170 18:39721297-39721319 CAGGTGAAATAGCTTGACCAAGG + Intergenic
1157585078 18:48795869-48795891 CAGGTGGCTCGGCTTTCCCAGGG - Intronic
1157676136 18:49569927-49569949 GAGGTGAGACAACTTGCCCAGGG + Intronic
1157685643 18:49640533-49640555 CAGGTGGCACAGCCAGGGCAGGG - Intergenic
1158163985 18:54518287-54518309 CAGGTGTCAGAACTTGCCCAAGG - Intergenic
1159018470 18:63122536-63122558 ATGGTGGCACAGCCTTCCCAAGG - Intergenic
1160066818 18:75583274-75583296 CAGGTGGCACGCCCTGCTCAGGG + Intergenic
1160382906 18:78474425-78474447 CAGGTGGCACACTATGCACATGG + Intergenic
1161195058 19:2982067-2982089 GAGGTAGAGCAGCTTGCCCAGGG + Intronic
1161687817 19:5712071-5712093 CTGGTGGCACAGGTGGTCCAAGG + Intronic
1162600285 19:11663718-11663740 CAGCTGGAACATCTTACCCAAGG - Intergenic
1162864301 19:13532629-13532651 GAGGTTGAGCAGCTTGCCCAAGG - Intronic
1164685683 19:30165208-30165230 CAGGTGGTACAGTCTGCCCAGGG - Intergenic
1166425505 19:42675092-42675114 CAGGTAGCACAGCTGAGCCAGGG + Intronic
1166733394 19:45071009-45071031 CAGCTGGCTCTGCTGGCCCATGG - Intergenic
1167035371 19:46992256-46992278 GAGGTGATACAGCCTGCCCAGGG + Intronic
926000688 2:9329758-9329780 CTGGTGGCACAGCCTGCTCTGGG - Intronic
926250253 2:11151707-11151729 CAGGAGGCACAGGTTGCACTGGG - Intergenic
927871495 2:26627164-26627186 CAGGTGCCACAGAGGGCCCAAGG - Intronic
928411794 2:31060132-31060154 AAGGTTGCATAGCCTGCCCAGGG + Intronic
929226286 2:39514743-39514765 AAGGTGGAACCTCTTGCCCAGGG - Intergenic
929797791 2:45073278-45073300 CAGGTTGATCAGTTTGCCCAAGG - Intergenic
929961196 2:46497631-46497653 CAAGGGGCATAGCTTGGCCAGGG - Intronic
931665289 2:64606185-64606207 GAGGTTGAACAACTTGCCCAAGG + Intergenic
932321853 2:70828348-70828370 CAGGTGTCCCAGCTTCCTCAAGG + Intergenic
933729907 2:85448621-85448643 CTGGTAGCACTGCTTGCCCCTGG - Intergenic
933735405 2:85489745-85489767 CAGGTAGCACAGCTGAGCCAGGG - Intergenic
936138703 2:109919618-109919640 CACATGCCACTGCTTGCCCATGG - Intergenic
936205993 2:110451867-110451889 CACATGCCACTGCTTGCCCATGG + Exonic
937232086 2:120404147-120404169 CAGGTGACAGAGCCTGCCCCTGG + Intergenic
937278040 2:120698635-120698657 CAAGTGTCACAGGTGGCCCATGG + Intergenic
938630463 2:133161015-133161037 CAGGTGGCAATGCTTGCTCTTGG - Intronic
940501592 2:154500906-154500928 CAGGTGGCACAGCTGGCTTTTGG + Intergenic
940534000 2:154915116-154915138 GAGGTTACAGAGCTTGCCCAAGG - Intergenic
941284518 2:163592917-163592939 AAGGTCACACAGCTTGTCCATGG + Intergenic
941413953 2:165195292-165195314 CAGGTGGCACACCTGGCACACGG - Intronic
942171943 2:173297814-173297836 CAGGTGGCCCAGCTTGGTGACGG - Intergenic
942172261 2:173299844-173299866 CAGGGGCCAGAGCTTGTCCAGGG + Intergenic
943703726 2:191013849-191013871 CAGGTGGCACTGCTCGCACTTGG + Intronic
944409102 2:199419575-199419597 CAGGCGGCACTGCTTTCACATGG - Intronic
946634166 2:221706255-221706277 CAGGTGGCACAGCCACCCAAAGG - Intergenic
947675799 2:231978719-231978741 GAGGTGTCTCAGCCTGCCCAAGG - Intronic
948364342 2:237444888-237444910 CAGGTGCCCCAGATTCCCCAAGG - Intergenic
948565349 2:238882900-238882922 CAGGGGGCACACCTGGACCACGG - Intronic
1168849262 20:965424-965446 CAGATGGGACAGATTGCCCAGGG + Intronic
1169802097 20:9521014-9521036 CAGGTGACACTGCTGGCCCATGG + Intronic
1170627528 20:18041062-18041084 AAGGTGGCTCACCTGGCCCAAGG + Intronic
1171267379 20:23782759-23782781 CAGGTAGCCCAGGTAGCCCAGGG - Intergenic
1172336704 20:34122600-34122622 CAGGTGGCCCAGCTTGGTGACGG - Intergenic
1172799700 20:37567213-37567235 AAGGTCACACAGCTTGCACATGG + Intergenic
1173672561 20:44809153-44809175 GAGGTGGCATGACTTGCCCAAGG + Intronic
1173866505 20:46315969-46315991 CAGGTGACATGACTTGCCCAAGG - Intergenic
1174066084 20:47867142-47867164 CAGGTAGCACAGCTGAGCCAGGG + Intergenic
1174734676 20:52954831-52954853 CAGGTGGCAGACCTGGCCCCGGG + Intergenic
1175146135 20:56897780-56897802 CAGCTGGCATAGGTGGCCCAGGG + Intergenic
1175372196 20:58499583-58499605 AAGGAGCCACAGCTTGTCCAAGG - Intronic
1175419332 20:58821456-58821478 CAGGTCAGATAGCTTGCCCAAGG - Intergenic
1175575636 20:60058526-60058548 CAGGAGGATCAGGTTGCCCAGGG + Intronic
1178104499 21:29302521-29302543 CAGGTAGAAGAGCTTGCCCAAGG - Intronic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1178629187 21:34244375-34244397 CATGTGGCACAGGTGGCCAAGGG + Intergenic
1178775918 21:35550637-35550659 CAGGTGTCTCAGCCTGCACATGG - Intronic
1179302895 21:40128404-40128426 CACATGGCACAACCTGCCCATGG - Intronic
1179508850 21:41859045-41859067 CAGGTGGCACAGCCTCCCCCAGG + Exonic
1181038561 22:20181471-20181493 CGGCTGGCCCAGCCTGCCCAGGG + Intergenic
1181731080 22:24847301-24847323 CAGGGGGCATAGCTTGACCAAGG - Intronic
1182087284 22:27569857-27569879 AAGGTTGCACAGCTAGCCAACGG + Intergenic
1183014116 22:34971915-34971937 CAGGTCACACAGCTGGCTCATGG - Intergenic
1183161183 22:36114402-36114424 CCTGTGTCACAGCCTGCCCAGGG - Intergenic
1183472526 22:38017132-38017154 TGGGTGGCACAGCAAGCCCAGGG - Intronic
1183494057 22:38132513-38132535 CAGGTGACATGGCTTGCTCAGGG + Intronic
1183568935 22:38637659-38637681 AAGGTGGCACAGCCAGCACATGG - Intronic
1183619680 22:38965188-38965210 CAGGGGGCACAGCAATCCCAGGG + Intronic
1185088507 22:48753345-48753367 CTGGTGGCTCAGCTGGCCCAGGG - Intronic
1185291939 22:50031623-50031645 CAGGTGGCAAAGCATCCACATGG + Intronic
1185404070 22:50635880-50635902 CGGGGGGCACAGCTGGGCCAGGG - Intergenic
950132093 3:10554241-10554263 AAGGGGAGACAGCTTGCCCAAGG + Intronic
950577274 3:13839790-13839812 GAGGTGCCACATGTTGCCCAGGG + Intronic
950921017 3:16694974-16694996 CAGGAGGCATAGCTGGGCCAGGG - Intergenic
951685787 3:25342797-25342819 TAGGTAGCACAGCTTGGCCTGGG + Intronic
955224835 3:57052160-57052182 ACGGAGGCACACCTTGCCCAAGG + Intronic
955795050 3:62627413-62627435 AAGGCAGAACAGCTTGCCCATGG - Intronic
957718888 3:83969179-83969201 CATGTGGGACAGCTTTTCCAGGG + Intergenic
958946832 3:100371858-100371880 CAGGTGGTGATGCTTGCCCAAGG + Intronic
960162471 3:114365435-114365457 CAGCAGGCAGAGCTGGCCCAGGG - Intronic
960399871 3:117183277-117183299 CAGGAGGGACAGCTGCCCCATGG - Intergenic
961280606 3:125763620-125763642 CAGGAGGCAGAGGTTGCACAGGG - Intergenic
961501828 3:127341791-127341813 CAGTTGGCACACCATGTCCAAGG - Intergenic
961913853 3:130349336-130349358 GAGTTAGCATAGCTTGCCCAAGG - Intronic
962990399 3:140572617-140572639 CAGGTGATGCAGCTGGCCCAGGG - Exonic
963405182 3:144854209-144854231 CTGGTGGTACCGCTTGACCAAGG + Intergenic
964682006 3:159351852-159351874 CAGGTCACACAGCTTGTCTAGGG + Intronic
965310124 3:167116554-167116576 GAGGAGGCACAGCTGGGCCAGGG - Intergenic
967524505 3:190474890-190474912 CAGGTAGCACAGCTGAGCCAGGG - Intergenic
967658730 3:192079325-192079347 CAGGTGCCACAGTTTGCCACTGG - Intergenic
967936121 3:194729120-194729142 GTGGTGGAACAGCTTGCCCAAGG + Intergenic
968008167 3:195256838-195256860 CAGGCTGAAGAGCTTGCCCAGGG + Intronic
968126276 3:196162832-196162854 AAGGTGAGGCAGCTTGCCCAGGG + Intergenic
968743462 4:2343674-2343696 CAGGTGGCACAGCTTGTCTAAGG + Intronic
968743467 4:2343712-2343734 CAGGTGGCACAGCTTGCCCAAGG + Intronic
968743475 4:2343759-2343781 CAGGTGGCACAGCTTGCCCAAGG + Intronic
968923908 4:3537134-3537156 CAGGTAGCACAGCTGAGCCAGGG + Intergenic
969269199 4:6087283-6087305 GAGGTGGCCCAACCTGCCCATGG - Intronic
969722157 4:8898127-8898149 GAGGTGGCAGATTTTGCCCAAGG - Intergenic
969875571 4:10133487-10133509 CAGGTGCCCCAGCTCTCCCAGGG - Intergenic
971073928 4:23126351-23126373 CAGGGGTCACAGTTTTCCCAGGG + Intergenic
971570466 4:28204941-28204963 CAGATGGTACAGCTTCCACATGG - Intergenic
972171104 4:36346546-36346568 CAAGTGGCACAGATTACACATGG - Intergenic
972767704 4:42166935-42166957 CAGAGGTCACAGCTTGCCTAGGG - Intergenic
974819440 4:67046877-67046899 CAGGTGGCATCCCTGGCCCAAGG - Intergenic
979776274 4:124592235-124592257 CAGTTGGCACTGCTGGTCCATGG - Intergenic
981585761 4:146300504-146300526 GAGGTGGCACTGCCTGCCCTGGG + Intronic
981722439 4:147815234-147815256 CAGGTTACCCAACTTGCCCAAGG - Intronic
982289269 4:153763604-153763626 TAGGTGGCACCACTGGCCCAAGG - Intergenic
984612481 4:181856703-181856725 CAGGAGGAGCAGCCTGCCCAGGG - Intergenic
987323431 5:16791221-16791243 CAGGGGGCAGATCATGCCCAAGG + Intronic
989506272 5:42230420-42230442 CAGGTAGCCCATCCTGCCCAGGG + Intergenic
989588355 5:43090682-43090704 CAGGAGGCACAGCTGGACTAGGG + Intronic
989716946 5:44475343-44475365 CAAGTGGCAAAGTTTGTCCAGGG + Intergenic
991408514 5:66324570-66324592 CAGGTGGCAGAGCTCTCCCCAGG - Intergenic
993110775 5:83654842-83654864 GAGGCTGCACAACTTGCCCAAGG - Intronic
993369159 5:87070854-87070876 CAGGTGGCACAGCTGGCAAATGG + Intergenic
997202457 5:132019676-132019698 GAGCTGACATAGCTTGCCCAAGG + Intergenic
997366214 5:133326881-133326903 CAGGTGCTGCAGCCTGCCCATGG + Intronic
997474343 5:134133978-134134000 CAGGTGGCAAAGCTGGACCTGGG + Intronic
999180737 5:149668815-149668837 CAGGTAGCACAGCTGAGCCAGGG + Intergenic
1001514683 5:172347078-172347100 CAGGTGAAACAGTTTGCCCGCGG - Intronic
1001692464 5:173643287-173643309 CACGTGACTCAACTTGCCCAGGG + Intergenic
1001759765 5:174197693-174197715 CAGGTGAAGCACCTTGCCCAGGG - Intronic
1002174138 5:177391856-177391878 GAGGTGGCATGGCTTACCCAGGG + Intronic
1007655967 6:43451125-43451147 CAGGTGGCACCGTTAGCACAAGG + Exonic
1007820169 6:44555180-44555202 CTGGTGGCACAGCTTCCTTAGGG - Intergenic
1007896919 6:45372187-45372209 GAGGTGGCATAACTTGCCCAAGG - Intronic
1010768769 6:79805163-79805185 CATGTGGCTCAGCTTGCTCTAGG - Intergenic
1011862816 6:91782031-91782053 CAGATGGCACAGCCTACCCGGGG - Intergenic
1012442108 6:99270423-99270445 CTGGTGGCACAGCTTGGGAAGGG - Intergenic
1013163858 6:107572036-107572058 CAGGTTGCACAGCTGACTCAGGG + Intronic
1013290427 6:108714753-108714775 CAGATGACACAGCTTGCCGGGGG + Intergenic
1016667377 6:146657695-146657717 CAGGAGGCAGTGCTAGCCCATGG + Intronic
1019528082 7:1489749-1489771 CAGGTGGCAAAGCTGGGGCAGGG + Intronic
1019717574 7:2547046-2547068 CAGCTGTCTGAGCTTGCCCACGG - Intronic
1020546990 7:9544604-9544626 CTTGTGCCACAGCTTCCCCAGGG + Intergenic
1022497469 7:30862099-30862121 CAGGCAGCACAGGCTGCCCAAGG - Intronic
1022506997 7:30913646-30913668 CAGCTGGCTCAGCCTGGCCATGG + Intronic
1022528783 7:31054155-31054177 CAGTTGGAAGAGCTGGCCCAGGG - Intronic
1022871840 7:34487988-34488010 AAGGTGGCACAGCATGAACATGG - Intergenic
1023102063 7:36727666-36727688 AAGGTGGAGCAGCTTACCCAGGG - Intergenic
1030009392 7:105151316-105151338 CAGCTTAAACAGCTTGCCCAGGG - Intronic
1030071531 7:105702262-105702284 AAGGTGGGGCAACTTGCCCAAGG + Intronic
1031402623 7:121343725-121343747 CACGTGGCACAGCATGACAAGGG + Intergenic
1031979592 7:128116114-128116136 CAGGTTGAGTAGCTTGCCCAAGG + Intergenic
1032470431 7:132174656-132174678 GAGGGGACACAACTTGCCCAAGG - Intronic
1032601761 7:133304434-133304456 CAGAGGGCAGAGCTGGCCCAGGG + Intronic
1032884109 7:136119410-136119432 CAGCTTGCACAGCTTGCCTGTGG + Intergenic
1034102641 7:148464052-148464074 CAGGTGGGAAAGCTTCCCTAGGG - Intergenic
1034265273 7:149777683-149777705 CAGGAGGCACAGGTGGCCGAGGG - Intergenic
1034282256 7:149862502-149862524 CACGTGGCAGAGCTCCCCCAAGG + Intronic
1034394769 7:150813825-150813847 CAGTTGGCAAAGCTGTCCCAAGG + Intergenic
1038406102 8:27324205-27324227 CAGGTGGGAGAACTTGGCCAGGG - Intronic
1038445281 8:27599565-27599587 GAGGTTCCACAGCTTGGCCAAGG - Intronic
1038658563 8:29476574-29476596 AAGGAGGCAAGGCTTGCCCAAGG + Intergenic
1040981980 8:53253123-53253145 CAGGTGGCTCAGGTTGCCAGGGG + Intergenic
1042502930 8:69529136-69529158 CAGGTGTCACAGCTAGCAAAGGG + Intronic
1043450207 8:80358847-80358869 CAGGTAGCACAGCTGAGCCAGGG - Intergenic
1045470959 8:102511699-102511721 CAGGATGAACAGCTTGCTCAGGG - Intergenic
1046054969 8:109068442-109068464 CAGGTTGAGCAACTTGCCCAAGG + Intergenic
1047761378 8:127957157-127957179 CAGGTTGCACAGCTTGGGGATGG + Intergenic
1048342776 8:133553769-133553791 AAGGTGGCACAGGTTGCCTGTGG - Intronic
1048882960 8:138885333-138885355 CAGGTCACATAACTTGCCCAAGG + Intronic
1049375211 8:142286120-142286142 GAGGTGGCCAGGCTTGCCCAGGG - Intronic
1049683452 8:143930020-143930042 CTGGTGCCACAGCGTGACCAGGG + Exonic
1050913643 9:11104812-11104834 CAGGAGGCACACCTGGGCCAGGG - Intergenic
1051325708 9:15965463-15965485 CAGGTTGCACAGCTTGCTAATGG - Intronic
1052406484 9:28067522-28067544 GAGGTCACACAGCTTGCCAAAGG - Intronic
1055370234 9:75590607-75590629 CAGGTGATACAGTTGGCCCATGG - Intergenic
1055790418 9:79917425-79917447 CAGGTGTCACTGCTTTCTCAGGG + Intergenic
1056596383 9:88011188-88011210 CAGGTGGATCTGCTTGCCCAAGG + Intergenic
1056738970 9:89236361-89236383 AAGGTGGCAAAGCTTAGCCATGG - Intergenic
1057194120 9:93107294-93107316 CAGGTGGCTCAGAATGCCCAGGG - Intronic
1057200537 9:93137498-93137520 AAGGTGGCGCAGCATGCCCGAGG + Intergenic
1057261663 9:93587920-93587942 CAGGTGGCACAGACGGCCAATGG - Intronic
1059418767 9:114178296-114178318 CAGGTAGCCCAGGTAGCCCAGGG - Exonic
1059522836 9:114959879-114959901 CAGGTTAAACAGCTTGACCAAGG - Intergenic
1061193264 9:129094386-129094408 CAGCAGGCTCAGCTTGCCCCAGG - Intergenic
1061483520 9:130908868-130908890 TGGGTGGCAGATCTTGCCCAGGG + Intronic
1061674104 9:132206009-132206031 CAGGTTAGACAACTTGCCCAGGG - Intronic
1062214617 9:135382505-135382527 CAGGTAGCACAGCCAGGCCAGGG + Intergenic
1062340700 9:136092794-136092816 CAGGTGGCACCCCTTACCCCAGG - Intronic
1062416135 9:136451236-136451258 AAGGTAGTACAGCCTGCCCACGG - Exonic
1187460863 X:19485629-19485651 CAGGAGGCAAAGCTTTCCCCTGG - Intronic
1188284797 X:28314491-28314513 CAGGAGGCAGAGCTAGACCAGGG - Intergenic
1188434341 X:30143336-30143358 GAGGTGGCACAGCTAGCGAATGG - Intergenic
1192231596 X:69269161-69269183 CAGGGGGCACAGCTAGCATATGG + Intergenic
1194385130 X:93243102-93243124 CACGTGACTCAGCTTGCCCCAGG - Intergenic
1195529016 X:105930884-105930906 GAGGTGGCACACCTTTGCCAGGG + Intronic
1195781208 X:108466744-108466766 CAGGTGGCACCACATGGCCAAGG + Intronic
1196075470 X:111570921-111570943 CAGGAGGCACAGCTGGGTCAGGG - Intergenic
1199442193 X:147881013-147881035 CAGGAGGCAGAGCTGGGCCAGGG - Intergenic
1200684132 Y:6245042-6245064 CAGCGGGCACAGCTTGGCCCTGG - Intergenic
1201048503 Y:9909344-9909366 CAGCGGGCACAGCTTGGCCCTGG + Intergenic
1201647855 Y:16255047-16255069 CAGGAAGCACAGATTCCCCATGG - Intergenic
1201654955 Y:16330254-16330276 CAGGAAGCACAGATTCCCCATGG + Intergenic
1202115877 Y:21468425-21468447 CAGCGGGCACAGCTTGGCCCTGG + Intergenic