ID: 968746464

View in Genome Browser
Species Human (GRCh38)
Location 4:2362992-2363014
Sequence GGTTGAGGGGACCACGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 295}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968746464_968746476 17 Left 968746464 4:2362992-2363014 CCATCCCCGTGGTCCCCTCAACC 0: 1
1: 0
2: 1
3: 17
4: 295
Right 968746476 4:2363032-2363054 TCCCCAGCACAGCCTGACCAGGG 0: 1
1: 1
2: 4
3: 37
4: 331
968746464_968746475 16 Left 968746464 4:2362992-2363014 CCATCCCCGTGGTCCCCTCAACC 0: 1
1: 0
2: 1
3: 17
4: 295
Right 968746475 4:2363031-2363053 GTCCCCAGCACAGCCTGACCAGG 0: 1
1: 0
2: 3
3: 28
4: 312

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968746464 Original CRISPR GGTTGAGGGGACCACGGGGA TGG (reversed) Intronic
900127402 1:1074623-1074645 GGTTGTGGGGGGCTCGGGGAGGG - Intergenic
900951079 1:5858601-5858623 GTCTGAGGGGAGCAGGGGGATGG - Intergenic
901080357 1:6580442-6580464 GGGTGAGGGGTGCACGCGGAGGG - Intronic
903138719 1:21326059-21326081 GGGTGTGGGGACCAGGGGGCTGG + Intronic
903232402 1:21929934-21929956 TGTGGAGAGGAGCACGGGGAGGG - Intronic
904307373 1:29598900-29598922 GGTTGTGAGGGCCACGGGGGTGG + Intergenic
904396369 1:30225052-30225074 GGTTGTGAGGGCCACGGGGGTGG - Intergenic
906229080 1:44145469-44145491 GGTTGGGGGGAAAAGGGGGAGGG + Intergenic
907183407 1:52590313-52590335 GGGGGAGGGGACCGGGGGGAAGG + Intergenic
907299399 1:53477213-53477235 GGGTGAGGGGAGCATGGGGTGGG - Intergenic
908195601 1:61743054-61743076 GGGTGAGGGGACAAAGAGGAGGG + Intronic
908516175 1:64894835-64894857 GGTTGAGGGGGCCAAGTGTAGGG - Intronic
911838367 1:102650167-102650189 GGTGGAGGGGATCTAGGGGAGGG - Intergenic
914753869 1:150552381-150552403 GGGAAAGGGGACCACTGGGAGGG + Intronic
915343370 1:155188124-155188146 GCTTCAGGGGAGCATGGGGAAGG + Intronic
915840569 1:159209434-159209456 GGGTGTGGGGAACACAGGGAGGG + Intergenic
917279391 1:173366487-173366509 GGTTGAAGGAAACAGGGGGATGG + Intergenic
918382422 1:183969387-183969409 GGTGGAGTGGACCATGGGGACGG + Exonic
919158280 1:193795890-193795912 GGTGGTGGGGCCCAAGGGGAGGG - Intergenic
920494089 1:206441827-206441849 GGATTGGGGGACAACGGGGAGGG - Intronic
920494195 1:206442477-206442499 GGATGAGGGGAAAACAGGGAGGG + Intronic
922532687 1:226356468-226356490 AGTTAAGGGGACTACAGGGAGGG + Intergenic
923086174 1:230705075-230705097 GGTTGCCGGGGCCAAGGGGAAGG + Intronic
923522574 1:234747033-234747055 GTTTGAGGAGAGCGCGGGGAGGG + Intergenic
923523734 1:234756693-234756715 GGTTGAGGGGAGCAGAGGGGAGG - Intergenic
924735222 1:246749576-246749598 GGTTCAGCTGACCATGGGGAGGG + Intronic
1062864546 10:840360-840382 GGTTCAGAGGAGCACGGAGATGG - Intronic
1067144140 10:43681527-43681549 GGTTGAGAGGACCATGGTGGAGG - Intergenic
1068647602 10:59485412-59485434 GGCAGAGGGGAGCAGGGGGAGGG - Intergenic
1069652464 10:70059763-70059785 GGTGCGGTGGACCACGGGGAGGG - Intronic
1069928168 10:71865577-71865599 GGGTGAGGCAACCATGGGGATGG - Intergenic
1070052916 10:72906428-72906450 GGTTGAGGAGATCAGGTGGATGG + Intronic
1071435901 10:85648002-85648024 GGTTGAGGAGGTCATGGGGAGGG - Intronic
1071545328 10:86524545-86524567 GGTTGAGGTGGCCAGGGGGATGG - Intergenic
1071783270 10:88871057-88871079 GGGGGAGGGGAGCAAGGGGAGGG - Intergenic
1071943430 10:90613745-90613767 GGTAGAGAGGACTACAGGGATGG + Intergenic
1072341820 10:94459593-94459615 GGTTGGGGGGAGCTCGGGCATGG + Intronic
1073073104 10:100807277-100807299 GGGTGAGGGGAGCAGGTGGATGG - Intronic
1073250933 10:102120023-102120045 GGGTGAGGGGTCCGCAGGGACGG + Intronic
1073322993 10:102626935-102626957 GGGTCAGGGGACAATGGGGAGGG - Intronic
1074703386 10:116111406-116111428 GGCTGTGGGGACCACTGGAAGGG - Intronic
1075031816 10:119029370-119029392 GATTGGTGGGAACACGGGGAGGG - Intergenic
1075189850 10:120297132-120297154 AGGTGATTGGACCACGGGGACGG - Intergenic
1077244335 11:1528837-1528859 GGTAGAGGGAACCGCGGGCAGGG - Intergenic
1077337567 11:2012210-2012232 GGTTGAGGTGGCCCTGGGGAGGG + Intergenic
1077404020 11:2374751-2374773 GGATGAGGGGAGAAAGGGGAGGG - Intergenic
1077890064 11:6412099-6412121 GGCTGAGGGGCCCAGGGGAAAGG - Intronic
1079267617 11:18949322-18949344 GGTGGTGGGGATCAAGGGGAGGG + Intergenic
1080463855 11:32478953-32478975 GGTTGAGGGGAGCTGGGGAAAGG + Intergenic
1080576729 11:33606758-33606780 GGTGGGGGGCACCATGGGGAGGG - Exonic
1081263866 11:40994878-40994900 TGTGGAGGGGACAATGGGGAAGG - Intronic
1083252152 11:61475281-61475303 AGGTGAGGGGCCCAGGGGGAGGG + Intronic
1084000313 11:66292299-66292321 GGATGAGGGGACGCCGGGGGCGG - Intronic
1084793415 11:71489369-71489391 GGAAGTGGGGACCATGGGGATGG - Intronic
1085312891 11:75526316-75526338 GATTGCGGGGGTCACGGGGAAGG + Intergenic
1085947681 11:81291603-81291625 GGTGGATAGGACCACAGGGAAGG + Intergenic
1086987577 11:93267054-93267076 GGTTCAGCTGACCATGGGGATGG - Intergenic
1087962957 11:104374686-104374708 ACTGGAGGGGACCACGGGAAAGG + Intergenic
1088119720 11:106353579-106353601 GATTGGGGAGACCACGGGCAAGG - Intergenic
1089262650 11:117232914-117232936 GGGTGGGGGGACCGAGGGGAAGG + Intronic
1090155665 11:124435938-124435960 TGATGAGGGGACCAGGGTGATGG + Intergenic
1202820551 11_KI270721v1_random:67392-67414 GGTTGAGGTGGCCCTGGGGAGGG + Intergenic
1091768988 12:3139360-3139382 GGGTGAGGGGAGGAGGGGGAGGG - Intronic
1092239515 12:6828483-6828505 GGCTCAGGGGACCCCGGGGGAGG - Exonic
1094218327 12:27969342-27969364 GGTTGGGGAGGCCAGGGGGAGGG - Intronic
1094579057 12:31717098-31717120 GGTTGGGGGGAGCAAGGGAAAGG - Intronic
1095806644 12:46327167-46327189 GGTTGAGGAGAAAAAGGGGAAGG - Intergenic
1097054192 12:56240112-56240134 GGCTCAGGGGGCCACGGGGCAGG + Exonic
1097157848 12:57025791-57025813 GGGTGCGGGGAACAAGGGGATGG + Intronic
1098419243 12:70274595-70274617 GGATGAGGGGAACATGGGGAAGG + Intronic
1099018335 12:77372541-77372563 GGTTGGGGGGACAAAGGAGATGG - Intergenic
1099070735 12:78043073-78043095 GGGTGGGGGGATCAAGGGGAGGG - Intronic
1101376762 12:104177994-104178016 AGTTGAGGGGAACATGGGGGTGG - Intergenic
1101724598 12:107378562-107378584 GGTGGAGGGGACTAAGAGGATGG - Intronic
1104847328 12:131853043-131853065 GGACGTGGGGACCACGGGGCTGG - Intergenic
1106414321 13:29533659-29533681 GGCTGAGGGGAGAACGAGGAGGG - Intronic
1106832764 13:33602871-33602893 GGGTTGGGGGACCAGGGGGATGG - Intergenic
1111114723 13:83760102-83760124 GGTGGTGGAGACCAAGGGGAGGG + Intergenic
1113900587 13:113794561-113794583 TGGTCAGGGGTCCACGGGGATGG + Intronic
1115453419 14:33574583-33574605 GGATGGAGGGACCAAGGGGAGGG + Intronic
1115850666 14:37587907-37587929 GGGGGAGGGGTCCCCGGGGAGGG - Intergenic
1116702511 14:48259528-48259550 GACTGAGGGGACCAGTGGGAGGG + Intergenic
1119165430 14:72488740-72488762 GGCTGAGGGGACAATAGGGAAGG - Intronic
1119966545 14:78922699-78922721 GGTGGAGGGGAGCAGGGGGAGGG + Intronic
1122290846 14:100679696-100679718 GGTTGAGAGGGCCTCGGGAAGGG - Intergenic
1122922067 14:104884383-104884405 GGTCGGGGGGCCCACGGGGCTGG - Exonic
1123048684 14:105530475-105530497 GGTTGAGGGGAGCAGGGGCCAGG - Intergenic
1123977035 15:25563491-25563513 GGTTGGGGTGACCAGGGGGCAGG - Intergenic
1124830608 15:33145595-33145617 GGTAGCGGCTACCACGGGGAGGG - Intronic
1125448664 15:39784946-39784968 GGTTGAGGGGACAGAGGGTAGGG - Intergenic
1125929848 15:43592878-43592900 AGCAGAGGGGACCACGAGGAAGG + Intergenic
1125933491 15:43616170-43616192 GGGTGAGGGGAACAGGGGGCAGG + Exonic
1125943015 15:43692710-43692732 AGCAGAGGGGACCACGAGGAAGG + Intergenic
1125946589 15:43715632-43715654 GGGTGAGGGGAACAGGGGGCAGG + Intergenic
1127316219 15:57796750-57796772 GGATGAGGGTACCAGGGTGAGGG - Intergenic
1127715756 15:61647785-61647807 GGTCAAGGGGAACACAGGGATGG + Intergenic
1128082397 15:64864465-64864487 GGTTGTGGGGACCCTGGGTATGG + Intronic
1128448296 15:67784467-67784489 GGTGGAAGGGACCATAGGGAGGG - Intronic
1128542529 15:68545784-68545806 GGCTGGGGGTACCCCGGGGATGG + Intergenic
1128672661 15:69586186-69586208 GGAAGAGGGAACCAGGGGGAAGG - Intergenic
1129393691 15:75233208-75233230 GGCTCCAGGGACCACGGGGAAGG - Intergenic
1132480284 16:163644-163666 TGAGGAGGGGACCATGGGGAGGG + Intronic
1132480311 16:163728-163750 TGAGGAGGGGACCATGGGGAGGG + Intronic
1132836212 16:1954607-1954629 GGTTGGTGGGACCAGGGTGAGGG - Exonic
1132994224 16:2814715-2814737 GGTTGAGGGGACTTGGTGGAAGG + Intergenic
1133110621 16:3545974-3545996 GGTGGAGGCTACCACAGGGATGG + Intronic
1133223124 16:4327747-4327769 GGCCGCGGGGACCACCGGGACGG - Intronic
1134088054 16:11372146-11372168 GCTTCAGGGGACCCTGGGGAGGG - Exonic
1135108080 16:19668372-19668394 GGTGGAGGGGAAGACGGAGAGGG - Intronic
1135117722 16:19737749-19737771 GGTGGAGGGTACCATCGGGAAGG - Intronic
1135547141 16:23373997-23374019 GGTTGGGGTGTCCATGGGGATGG - Intronic
1135809742 16:25576372-25576394 GGTGGAGGGTACTAGGGGGAGGG + Intergenic
1136578709 16:31139453-31139475 GGGGGAGGGGACCAAGAGGAAGG - Intronic
1137776881 16:51062732-51062754 TGCTGTGGGGACCAAGGGGATGG - Intergenic
1138293445 16:55867500-55867522 AGTGGAGGGGACCCAGGGGAAGG - Intronic
1138531588 16:57637463-57637485 GGTTCAGGGGACCTGGGGGGAGG - Intronic
1139514395 16:67444860-67444882 GCTTGAGAGGAACATGGGGAGGG - Intronic
1139963151 16:70729439-70729461 AGTTGAGGGCACCCTGGGGATGG - Intronic
1140228468 16:73097731-73097753 GGCTGGAGGGGCCACGGGGACGG - Intergenic
1140281447 16:73558603-73558625 GGCTGGAGGGACCACGGTGAAGG + Intergenic
1142194895 16:88734816-88734838 GGTGGTGAGGACCGCGGGGAGGG + Intronic
1142466962 17:141604-141626 TGGTGAGGGGAACACGGTGAGGG + Intergenic
1143283054 17:5769106-5769128 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1143571222 17:7759937-7759959 GGGTGAGTGGGCAACGGGGAGGG + Exonic
1143620536 17:8077670-8077692 GCTTGGGGGGACCTCTGGGAAGG + Intronic
1145971772 17:28960458-28960480 GGGTGGCGGGTCCACGGGGATGG - Intronic
1145992856 17:29089654-29089676 GGTTGAGGGGAACAGGCGGGGGG + Intronic
1147875340 17:43616969-43616991 GGGTGAGGAGTCCACAGGGAAGG + Intergenic
1148178455 17:45586558-45586580 GGCTGTGGGGACCACAAGGAGGG - Intergenic
1148216728 17:45837418-45837440 GGGTGAGGGGAAGACAGGGAAGG + Intergenic
1148239951 17:45993784-45993806 GGTCGAGGGGCCCAAGGGGGAGG - Intronic
1148549890 17:48544035-48544057 AATTGAGGGGTCCACTGGGAGGG - Intronic
1148579844 17:48735968-48735990 GGTTGAGGGGACAGTGAGGAGGG - Intergenic
1148864285 17:50620530-50620552 TGGTGAGGGGATCAAGGGGAGGG - Intronic
1149366491 17:55950593-55950615 GGGGGTGGGGACCAAGGGGAGGG + Intergenic
1151556550 17:74849724-74849746 GGCAGAGGGGCCCACGAGGAGGG - Intronic
1152347679 17:79763446-79763468 GGTTGCGAGGAACAGGGGGAAGG + Intergenic
1152471729 17:80493251-80493273 AGGTGAGGGGAGCACGGAGAAGG + Intergenic
1153522159 18:5963441-5963463 GGTGGAGGCCACCACGGGGCAGG - Intronic
1156252039 18:35360465-35360487 GACTGAGGGGACCAGTGGGAGGG + Intergenic
1156513925 18:37663849-37663871 GGTGGAGGGCAACACCGGGAAGG - Intergenic
1159467969 18:68810831-68810853 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
1160592727 18:79952834-79952856 GGTTGAGGGGTCCACGCTGAGGG + Intergenic
1160733491 19:651590-651612 GGGTGAGGGGGCCCCGGGGGTGG - Exonic
1160819048 19:1049554-1049576 GGTGGGGGGGCTCACGGGGAGGG - Intronic
1160819082 19:1049630-1049652 GGTGGGGGGGCTCACGGGGAGGG - Intronic
1160819105 19:1049681-1049703 GGTGGGGGGGCTCACGGGGAGGG - Intronic
1160819140 19:1049758-1049780 GGTGGGGGGGCTCACGGGGAGGG - Intronic
1160819163 19:1049809-1049831 GGTGGGGGGGCTCACGGGGAGGG - Intronic
1160819185 19:1049861-1049883 GGTGGGGGGGCTCACGGGGAGGG - Intronic
1160987271 19:1844851-1844873 GGCTGAGGGCACCACGTTGAGGG - Intronic
1161206154 19:3042257-3042279 GGTGGAGGGGACCCTGTGGAGGG + Intronic
1161213334 19:3079792-3079814 GGAGGAGGGGAGGACGGGGAGGG + Intergenic
1161488295 19:4547783-4547805 GGAGGAGGGGAGGACGGGGAGGG - Intronic
1161607363 19:5222464-5222486 GGGGGAGGGGAGCAAGGGGAGGG + Intronic
1161939609 19:7394596-7394618 GGTTGGGGGGACCCCGAGGGAGG - Intronic
1161964286 19:7539871-7539893 GGGTGAGGGGGGCACGGAGAAGG - Intronic
1161979206 19:7621766-7621788 GGTTGTGGGGTCCAGGGGGTGGG - Intronic
1162292929 19:9792633-9792655 CGGTGAGGGGACGACGGGGGCGG - Intronic
1162455986 19:10785112-10785134 GGTTGAGGGGAAGGCCGGGATGG - Intronic
1162927708 19:13938416-13938438 GTTGGGGGGGACCAAGGGGACGG - Exonic
1162968245 19:14165767-14165789 GGGAGAGGGGAAGACGGGGAGGG + Intronic
1163433563 19:17282316-17282338 GGTTTAGGGGATCTTGGGGAGGG + Intronic
1165389338 19:35529425-35529447 GGTTGAGGCAGCCACGGGGAGGG + Intergenic
1166104207 19:40589517-40589539 GGATGGGGGGACCAGGGGGAGGG + Intronic
1166109352 19:40613090-40613112 GGCCGTGGGGACCACAGGGAGGG - Exonic
1166254430 19:41592268-41592290 GGTTGAGGTGACCTTGGTGAGGG - Intronic
1167621695 19:50564359-50564381 GGGAGAGGGAGCCACGGGGAAGG + Intronic
1167719332 19:51167919-51167941 GGTTATGGGGGCCACTGGGAAGG + Intergenic
1168347698 19:55659013-55659035 CCATGAGGGGACCAGGGGGACGG - Intronic
925807926 2:7671015-7671037 GGTTGAGAGCACAAGGGGGAGGG - Intergenic
927698366 2:25252307-25252329 GGCGGAGGGGGCCACTGGGAGGG + Intronic
928953612 2:36838177-36838199 GGTGGAAGGGACCACGTGCAAGG + Intergenic
929331020 2:40681265-40681287 GGGTGTGGGGACCTAGGGGAGGG - Intergenic
929817561 2:45246945-45246967 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
931442397 2:62299458-62299480 GGAGGAGGGGACCATGGGGTAGG + Intergenic
933003041 2:76951772-76951794 GGGGGAGGGGAGCAAGGGGAGGG - Intronic
934855169 2:97724921-97724943 TGGGGAGGGGACCACGGAGATGG + Intronic
937991283 2:127663825-127663847 GGTTGGGAGGGGCACGGGGATGG - Intronic
938444542 2:131366969-131366991 ATTTGAGGGGACCCCAGGGACGG + Intergenic
939503989 2:143021726-143021748 AGTTGATTGGACCATGGGGATGG - Intronic
943677438 2:190729796-190729818 GGTAGAAGGGACCAAAGGGAAGG + Intergenic
944256547 2:197628341-197628363 GGTGGAGGGGGTCACGGAGACGG - Intronic
946177394 2:217929893-217929915 GGTGGAGGGGACAAGGCGGAGGG - Intronic
946192789 2:218016224-218016246 GGTTGAGAGGCACAAGGGGAGGG + Intergenic
948855242 2:240727293-240727315 GGATGTGGGGAACACAGGGAAGG + Intronic
949039928 2:241843550-241843572 AGTCGAGGGGGCCACGGCGATGG + Intergenic
1170136005 20:13074225-13074247 GGATGAGGTGACCAAGGAGATGG - Intronic
1174317301 20:49713192-49713214 GTTCGAGGAGACCCCGGGGAAGG + Intronic
1174547303 20:51334923-51334945 GGTCGGGGTGACCACGTGGATGG + Intergenic
1178518269 21:33266513-33266535 AGGTGAGGGGTCCGCGGGGAGGG + Exonic
1179574747 21:42301132-42301154 GGTGGAGAGGACCAAAGGGAAGG - Intergenic
1179816079 21:43907159-43907181 GGTAGCTGGGACCACGGGCATGG + Intronic
1179927115 21:44540799-44540821 GTCTGAGTGGACCTCGGGGAAGG - Intronic
1179938878 21:44625613-44625635 GTCTGAGTGGACCTCGGGGAAGG + Intronic
1180969789 22:19809210-19809232 CGTTGAGGGGAGCACGGTGGTGG + Intronic
1181026753 22:20131554-20131576 GGTGGTGGGCACCACGGCGAAGG - Intronic
1181331394 22:22094861-22094883 GGTTGGGGGGAAGAAGGGGAAGG + Intergenic
1181406595 22:22689364-22689386 GGTTGAGGGGATCCCAGGGTAGG - Intergenic
1181414564 22:22750021-22750043 GGTTGAGGGGATCCCAGGGTAGG - Intronic
1181440910 22:22934796-22934818 GGTAGAGGGGCCCATGTGGAGGG + Intergenic
1183392371 22:37552740-37552762 GGCTGTGAGGCCCACGGGGAGGG - Intergenic
1183578303 22:38706325-38706347 GGGTGCGGGGACCATGGGGACGG - Intronic
1184114530 22:42414689-42414711 GGTCGAGGGGGCCACAGGGTAGG - Intronic
1184173640 22:42773477-42773499 GGTTGGGGGGACCCTGGGGAGGG + Intergenic
1184645687 22:45893400-45893422 GCTTGAGGGGAACCCTGGGATGG + Intergenic
1184777839 22:46632181-46632203 GCTTGAGGGGCCCACGAGGCTGG + Intronic
1185132159 22:49045370-49045392 GGTGGCCGTGACCACGGGGACGG - Intergenic
1185285742 22:49999378-49999400 GGGTGAGGGGAGCACAGGGATGG - Intronic
1185366197 22:50438043-50438065 GCTGGAGGGGAGGACGGGGAGGG - Intronic
1185402337 22:50625551-50625573 GGGGGAGGGATCCACGGGGAGGG + Intronic
950042851 3:9931271-9931293 GGGTGAGGGGCTCAGGGGGAAGG + Intronic
950558798 3:13710283-13710305 CATTGAGGGGACCACGTGGAGGG + Intergenic
950559915 3:13715372-13715394 CATTGATGGGACCACGTGGAGGG + Intergenic
950588572 3:13917056-13917078 GGTTGAGGGGAACTGGGGAATGG + Intergenic
951139691 3:19146831-19146853 GATTGAGGGGAGGACAGGGACGG + Intergenic
953951369 3:47192959-47192981 GGTTGAGGGGAGAACAGGGGGGG - Intergenic
954675193 3:52311753-52311775 GGTTGCTGGGACCCAGGGGAGGG + Intergenic
954950236 3:54465998-54466020 GGTGGAGGGGACCACATGCAAGG - Intronic
959920142 3:111860036-111860058 GGTTGAGGGGATCCCGGGGAGGG + Intronic
960465856 3:117996521-117996543 GGGGGAGGGGGACACGGGGAGGG - Intergenic
963745982 3:149125537-149125559 AGATGATTGGACCACGGGGATGG + Intergenic
964376328 3:156052133-156052155 GGTTGTGGGGGGCAGGGGGAGGG - Intronic
968672195 4:1857601-1857623 GGCAGAGGGGACCCTGGGGAGGG - Intergenic
968712202 4:2127138-2127160 GGGTGAGGGGGCCATAGGGAGGG + Intronic
968746464 4:2362992-2363014 GGTTGAGGGGACCACGGGGATGG - Intronic
968785750 4:2621190-2621212 GGTGGAGGGTACTACAGGGACGG - Intronic
969618703 4:8268331-8268353 GGTTGAAGGGTCCCAGGGGACGG - Intergenic
969694468 4:8726747-8726769 TGGTGGGGGGACCACTGGGAGGG - Intergenic
970776647 4:19682559-19682581 GGAAGAGGGGACAACGAGGATGG + Intergenic
974036437 4:56821898-56821920 GGGGGAGGGGGCCATGGGGAAGG + Intergenic
974772767 4:66437052-66437074 GGGGGTGGGGACCAAGGGGAGGG + Intergenic
974928314 4:68329230-68329252 GGTTGTGGGGAGCAGTGGGAGGG - Intronic
975424396 4:74209333-74209355 GGTGGTGGGGAGCAAGGGGAGGG - Intronic
976438344 4:85044180-85044202 GGGTCAGAGGACCTCGGGGAAGG + Intergenic
976569686 4:86594197-86594219 GGTCGAGGGGAGCTCGGGGTGGG + Intergenic
977354422 4:95927083-95927105 GGCTGTGGGGAGCAAGGGGAGGG - Intergenic
982626395 4:157771816-157771838 GGGGGTGGGGACCAAGGGGAGGG + Intergenic
983586607 4:169362337-169362359 GGTTGAGGGGGAAACGTGGATGG + Intergenic
984691774 4:182734274-182734296 TGTAGAGGGGACAATGGGGAAGG + Intronic
986029282 5:3880475-3880497 GGCTGAGGGGAAAGCGGGGAAGG - Intergenic
986061079 5:4191862-4191884 GGCTGGGGGCAGCACGGGGAGGG + Intergenic
986074957 5:4326899-4326921 GGTTGAGGGCAGCAGGTGGAGGG - Intergenic
988512601 5:31878327-31878349 GGTTGATGGGAGCACTGGGAAGG - Intronic
988664842 5:33314921-33314943 GGTTGAGGGGATCACCATGAGGG + Intergenic
992379003 5:76218604-76218626 GGTTGAGGGAGGCAAGGGGAGGG + Intronic
992782893 5:80144009-80144031 GGCTGAGGGGGCCATGGGGAAGG - Intronic
992789038 5:80197475-80197497 GCTTGAGGGGAAGATGGGGAGGG + Intronic
996262458 5:121490465-121490487 GGAGGAGGGGGCCACGGGGATGG - Intergenic
998225891 5:140325959-140325981 GGTGGAGGGGACTACCGAGAAGG - Intergenic
999322641 5:150624809-150624831 GGTGGCGGGGACCTCGGGGCGGG + Intronic
1002651343 5:180698057-180698079 GGCTGAGGGGACCGAGAGGACGG - Intergenic
1002724162 5:181283459-181283481 GGTTGTGGCGGCCACGGTGATGG + Intergenic
1003757741 6:9140926-9140948 GTTTGAGGGGACTATGGGGAGGG - Intergenic
1004742230 6:18473112-18473134 GATGGAGGGGGCCACGTGGAAGG - Intergenic
1006088845 6:31615993-31616015 GGTGGAGGAGACAACGTGGAAGG - Intronic
1006136161 6:31897469-31897491 GGATGAGGGGACCAGGGTGTGGG - Intronic
1006412363 6:33881707-33881729 GGTTGAGGGGAACAGGGGCAGGG + Intergenic
1007074061 6:39055702-39055724 GTCAGAGGGGAGCACGGGGAGGG + Intronic
1007238779 6:40410323-40410345 GGGTGATGGGAGCACGGGGGAGG + Intronic
1007350732 6:41271875-41271897 GGAAGAGGGGACCAGGGAGAGGG - Intronic
1007781573 6:44257547-44257569 GGCGGAGGGGGCCGCGGGGAGGG - Exonic
1008022035 6:46589789-46589811 GGTTGGGGGCAGCACAGGGATGG + Intronic
1010858587 6:80876138-80876160 GGTAGTGGGGAGCAAGGGGAGGG - Intergenic
1011304775 6:85914097-85914119 GGCTGTGGGGGCCATGGGGAAGG - Intergenic
1013490829 6:110644785-110644807 GGTGAAGGGGGCCAGGGGGAGGG + Intronic
1015924696 6:138296949-138296971 GGTGGAGGTGAGCACTGGGAAGG + Exonic
1016537086 6:145119615-145119637 GGTGGAGGGGATGACTGGGATGG - Intergenic
1018069206 6:160146987-160147009 GGTCGAGGGCTCCTCGGGGATGG - Intronic
1018744166 6:166749724-166749746 GGAAGAGGGGCCCAAGGGGATGG - Intronic
1018798893 6:167207639-167207661 GGCTGAGGGTGCCAGGGGGAGGG + Intergenic
1019475340 7:1241588-1241610 GGCAGAGGGGCCCACGAGGAAGG - Intergenic
1019542543 7:1558081-1558103 GGGTGATGGGACAGCGGGGATGG - Intronic
1025200070 7:56956606-56956628 GGCTGATGGGACCACGGGCTGGG - Intergenic
1026187768 7:68095690-68095712 GGTGGTGGGGAGCAAGGGGAGGG + Intergenic
1026866876 7:73829558-73829580 GACTGAGGGGACCTCTGGGAAGG - Exonic
1026899250 7:74028033-74028055 GGGGGAGGGGGCCGCGGGGAGGG - Intronic
1027189448 7:75988807-75988829 GGTGGAGGGGAAGGCGGGGAGGG + Intronic
1028320195 7:89450177-89450199 TGTTGTGGGGAGCAGGGGGAGGG + Intergenic
1029362888 7:100100358-100100380 GTGTGAGGGGCCAACGGGGAAGG - Intronic
1030152215 7:106419041-106419063 GGTGGAGGTTACCAGGGGGAGGG + Intergenic
1031977070 7:128100970-128100992 GGCTGAGTGGACCATGGGCAGGG + Intergenic
1032283800 7:130526525-130526547 GGTGGAGGGGCCCCCAGGGAAGG + Intronic
1032284533 7:130530772-130530794 GGTGGAGGGGCCCCCAGGGAAGG + Intronic
1032286135 7:130539735-130539757 GGTGGAGGGGCCCCCAGGGAAGG + Intronic
1032529625 7:132609475-132609497 GGTGGAAGGGACTAAGGGGAAGG - Intronic
1034423281 7:151000138-151000160 GGGTGAGGGGGGCATGGGGATGG + Intronic
1035569121 8:660405-660427 GGTTGGAGGGGCCACGGGGCTGG + Intronic
1036752736 8:11453659-11453681 GTTTGAGTAGACCATGGGGAGGG - Intronic
1040581994 8:48705744-48705766 GTTTGGGGGCAGCACGGGGAGGG - Intergenic
1049537626 8:143189594-143189616 GTTGGAGGGGTCCACGGGGGTGG - Intergenic
1049575356 8:143387258-143387280 GGGTGAGGGGACCACCGCCATGG - Intergenic
1049796726 8:144500404-144500426 GGGTGAGGGGCACACGGGGCTGG + Intronic
1053303025 9:36965066-36965088 GGTTGAGTGGAGCAAGGAGAAGG - Intronic
1057541702 9:95979323-95979345 GGTTGAGGGGGCCAATGGGGAGG + Intronic
1059354478 9:113688109-113688131 GGGTGAGGGGAGGACGGGAAGGG - Intergenic
1061374492 9:130215939-130215961 GGTTGAGGGGAGGAGGAGGATGG - Intronic
1061887989 9:133602435-133602457 GGTGGAGGGAAGCAGGGGGAGGG - Intergenic
1062000176 9:134211921-134211943 GGTTGAGGTCAGAACGGGGAGGG + Intergenic
1062348110 9:136124797-136124819 GGCTGAGGGGACCGCAGGGAGGG - Intergenic
1062500245 9:136849017-136849039 GGCGGTGGGGGCCACGGGGAGGG + Intronic
1062607634 9:137355235-137355257 GCCTGAGGGGGCCCCGGGGAGGG + Intronic
1062633960 9:137480296-137480318 GGGCGAGGTGAGCACGGGGAGGG - Exonic
1187046787 X:15655169-15655191 GGTGGAGGGGAGCACAGGCAGGG - Intronic
1187053016 X:15713364-15713386 GGTGGAGGGGAGCACAGGCAGGG - Intronic
1187464259 X:19514616-19514638 GGGAGAGGGGACTAAGGGGAGGG + Intronic
1188020182 X:25148716-25148738 TGTTGCGGGGAGCAAGGGGAGGG - Intergenic
1188337954 X:28961490-28961512 GGTGGTGGGGACCAAGGGGTGGG - Intronic
1190880870 X:54491892-54491914 AGTTGAGGGGGGCAAGGGGAGGG - Intronic
1195541042 X:106063384-106063406 GGTTGTGGGGTGCAGGGGGAGGG - Intergenic
1196941300 X:120778687-120778709 TGTTGGGGGGAACAGGGGGAGGG + Intergenic
1198402146 X:136278632-136278654 GGCTGAGGGGACCCAAGGGAGGG - Intergenic
1202348946 Y:23966199-23966221 GGGTGAGGGGAGGAGGGGGAGGG + Intergenic
1202521829 Y:25703905-25703927 GGGTGAGGGGAGGAGGGGGAGGG - Intergenic