ID: 968746625

View in Genome Browser
Species Human (GRCh38)
Location 4:2363841-2363863
Sequence GGCTGTTCCCCAATTTACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968746623_968746625 -7 Left 968746623 4:2363825-2363847 CCCAGAGGAGGTAAGGGGCTGTT 0: 1
1: 1
2: 2
3: 15
4: 198
Right 968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG No data
968746615_968746625 2 Left 968746615 4:2363816-2363838 CCCCACCACCCCAGAGGAGGTAA 0: 1
1: 0
2: 2
3: 14
4: 208
Right 968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG No data
968746622_968746625 -6 Left 968746622 4:2363824-2363846 CCCCAGAGGAGGTAAGGGGCTGT 0: 1
1: 0
2: 1
3: 19
4: 218
Right 968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG No data
968746621_968746625 -3 Left 968746621 4:2363821-2363843 CCACCCCAGAGGAGGTAAGGGGC 0: 1
1: 0
2: 3
3: 16
4: 168
Right 968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG No data
968746617_968746625 0 Left 968746617 4:2363818-2363840 CCACCACCCCAGAGGAGGTAAGG 0: 1
1: 0
2: 5
3: 28
4: 231
Right 968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG No data
968746616_968746625 1 Left 968746616 4:2363817-2363839 CCCACCACCCCAGAGGAGGTAAG 0: 1
1: 0
2: 1
3: 13
4: 169
Right 968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG No data
968746624_968746625 -8 Left 968746624 4:2363826-2363848 CCAGAGGAGGTAAGGGGCTGTTC 0: 1
1: 0
2: 0
3: 15
4: 169
Right 968746625 4:2363841-2363863 GGCTGTTCCCCAATTTACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968746625 Original CRISPR GGCTGTTCCCCAATTTACAG AGG Intronic
No off target data available for this crispr