ID: 968747654

View in Genome Browser
Species Human (GRCh38)
Location 4:2369160-2369182
Sequence TCACCAGGAGGAAGGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 349}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968747654_968747662 16 Left 968747654 4:2369160-2369182 CCTGCCATCCTTCCTCCTGGTGA 0: 1
1: 0
2: 0
3: 33
4: 349
Right 968747662 4:2369199-2369221 GTGTGGAACGCCGCACTCTGTGG 0: 1
1: 0
2: 1
3: 4
4: 109
968747654_968747660 -6 Left 968747654 4:2369160-2369182 CCTGCCATCCTTCCTCCTGGTGA 0: 1
1: 0
2: 0
3: 33
4: 349
Right 968747660 4:2369177-2369199 TGGTGACATCTGTGAGTCAAGGG 0: 1
1: 0
2: 0
3: 15
4: 186
968747654_968747659 -7 Left 968747654 4:2369160-2369182 CCTGCCATCCTTCCTCCTGGTGA 0: 1
1: 0
2: 0
3: 33
4: 349
Right 968747659 4:2369176-2369198 CTGGTGACATCTGTGAGTCAAGG 0: 1
1: 0
2: 1
3: 14
4: 209
968747654_968747661 -1 Left 968747654 4:2369160-2369182 CCTGCCATCCTTCCTCCTGGTGA 0: 1
1: 0
2: 0
3: 33
4: 349
Right 968747661 4:2369182-2369204 ACATCTGTGAGTCAAGGGTGTGG 0: 1
1: 0
2: 1
3: 16
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968747654 Original CRISPR TCACCAGGAGGAAGGATGGC AGG (reversed) Intronic
900528150 1:3139279-3139301 GCTCCAGGAGGAAGGAAGGCAGG - Intronic
900546390 1:3231610-3231632 GCACCAGAAGGAAGGAAGGTCGG + Intronic
900625987 1:3608828-3608850 CCACTATGAGGAAGGATGGCTGG - Intronic
900779594 1:4609115-4609137 GGACCAGGAGGGAGGATGGGAGG - Intergenic
901013101 1:6211916-6211938 TCCCCAGTAGGAAAGATGTCGGG + Exonic
901063997 1:6486121-6486143 TCTCCAGGAGGAAGGGAGGAGGG - Intronic
901125518 1:6925861-6925883 TCACCAGGAGGCAGGGTAGTAGG + Intronic
903301632 1:22383308-22383330 TCACCAGGCTGCAGGAAGGCTGG - Intergenic
903417964 1:23197314-23197336 TCACAATGGGGAAGGATAGCAGG - Intergenic
903667234 1:25015529-25015551 CCACCAGGGGGAATGGTGGCAGG + Intergenic
904774206 1:32896694-32896716 ACATCAGGAGGAAGGCTGGCTGG - Intronic
904842519 1:33382315-33382337 TCACCAGAGGGAAGGATGTAAGG - Intronic
908374203 1:63516837-63516859 TCAAAAGGAGGAAGTATGGGAGG + Intronic
911982092 1:104580727-104580749 TCCCCTTGAGGAAGGATGGAAGG - Intergenic
912315238 1:108661802-108661824 TCTCCAGAGGGAAGGATGGCAGG - Intergenic
912697462 1:111852225-111852247 TGACTTGGAGGAAGGTTGGCAGG + Intronic
914959056 1:152189876-152189898 GCAACAGGAGGAAGGAGGGTAGG - Intergenic
916618953 1:166474380-166474402 TCCCCAGAAGGAAGCATGGGTGG + Intergenic
916818361 1:168374648-168374670 TCCCCAGGAGGAAGCTGGGCTGG + Intergenic
917753928 1:178080437-178080459 TCACAAGAAGGAAGGAAGGAAGG - Intergenic
918253094 1:182722462-182722484 TCCTCAGGAGGGAGCATGGCAGG - Intergenic
918579061 1:186103577-186103599 TGACCTGGATGAAAGATGGCCGG + Exonic
918840758 1:189534929-189534951 TCAGCTGGAGGAAGGATGATTGG - Intergenic
919805699 1:201379965-201379987 TCCCCAGTAGGAACGAGGGCAGG + Intronic
920062828 1:203239759-203239781 TCACCAGGAGGAAGAATTTTTGG + Intronic
920256707 1:204660263-204660285 TAAACAGGAGGAAGGACAGCTGG - Intronic
920949175 1:210556555-210556577 TCAGCAGGAGGAAGGATGTTTGG - Intronic
921213753 1:212920629-212920651 TCATCCAGAGGAAGGATGGATGG - Intergenic
921744196 1:218719426-218719448 AGACCAGGAGGATGGATGACAGG - Intergenic
921887933 1:220325181-220325203 GCCCCAGCAGGAATGATGGCTGG + Intergenic
922798416 1:228352935-228352957 TCACCAGCTGCAAGGACGGCAGG - Exonic
924279517 1:242422200-242422222 TTACCATGAGGAGGGAGGGCAGG + Intronic
924425697 1:243948066-243948088 TCCCCAGGAGCCAGGATTGCAGG + Intergenic
924802208 1:247335726-247335748 TCGCCTGGAGGAGGGAGGGCTGG + Intergenic
1063073335 10:2689219-2689241 GCAACAGGTGGAAGGATGGGTGG - Intergenic
1063201415 10:3787558-3787580 TCAGAAGGGGGAAGTATGGCAGG + Intergenic
1063967840 10:11360581-11360603 TGACAAGAAGGAAGGATGGAAGG + Intergenic
1064444204 10:15379191-15379213 TCACTAGCAGGGAGGGTGGCAGG - Intergenic
1067029940 10:42873201-42873223 TCACCAGCAGGAGGGAGGGGCGG - Intergenic
1067542574 10:47166445-47166467 TAACCAGGAGGAAGGGTCACTGG + Intergenic
1068616529 10:59124366-59124388 TCACTAGAGGGAAGGATGGGTGG - Intergenic
1069273875 10:66565593-66565615 ACAGCAGGTTGAAGGATGGCAGG + Intronic
1069903279 10:71718166-71718188 TCAGGAGGAGGAAAGATGTCAGG + Intronic
1071142597 10:82528043-82528065 TCACAAGTGGGAAGGAAGGCTGG - Intronic
1071602086 10:86963256-86963278 GCACCCAGAGGAAGCATGGCAGG - Exonic
1071773693 10:88760126-88760148 TAACCAGGAGGCAGGTTGGAAGG + Intergenic
1072989676 10:100180119-100180141 TCACCAGGAGGAAGCAGTACTGG - Intronic
1073608409 10:104919135-104919157 TCACCATGAGGAAGGATAAATGG - Intronic
1073617459 10:105010983-105011005 TCAGGAGGAGGAGTGATGGCTGG + Intronic
1073888568 10:108070217-108070239 TCACAAGAAGGAAGGAAGGAGGG - Intergenic
1074625430 10:115178712-115178734 TCACATGGTGGAAGGATGGAAGG - Intronic
1074693656 10:116028992-116029014 TCTCCAAGAGGAAGGAAGTCCGG + Intergenic
1075634496 10:124021041-124021063 TGACCAGCAGGGAGGAAGGCAGG + Intronic
1075723245 10:124599211-124599233 TGGACAGGAGGATGGATGGCTGG - Intronic
1075973016 10:126671208-126671230 TTACCAGGAGGAAGACTGGAAGG + Intergenic
1076815113 10:132910788-132910810 TATCCAGAAGGAAGGATGGAGGG - Intronic
1077048653 11:556916-556938 TCACCTGCACGAAGGAAGGCAGG + Exonic
1077150372 11:1070451-1070473 TCAGCAGGTGGATGGATGGATGG - Intergenic
1078585686 11:12586463-12586485 GAACCAGGAGGAAGTTTGGCAGG - Intergenic
1078595842 11:12685993-12686015 TAACCAGGAGGAAGGCAGCCAGG - Intronic
1078741200 11:14067726-14067748 CCACCAGCAGCAAGGAAGGCTGG + Intronic
1078895287 11:15592028-15592050 TCACATGGAGGAAGGAGGGGTGG + Intergenic
1079084233 11:17433754-17433776 TCTCCTGGAGGATGTATGGCTGG + Intronic
1079992354 11:27259543-27259565 AGAACAGGAGGAAGGCTGGCAGG + Intergenic
1081770163 11:45645444-45645466 TCACCAGAAAGCAGGAAGGCTGG + Intergenic
1082012666 11:47460770-47460792 TCAGAAGGATGAGGGATGGCAGG + Intergenic
1082771930 11:57214454-57214476 TCAACAGGACAAAGGATGGTGGG + Intergenic
1083169685 11:60915664-60915686 TCACCAGGTGGCAGGAGGGGCGG - Intronic
1083290235 11:61685934-61685956 TCCCCAGGAGCCATGATGGCAGG + Intronic
1083653941 11:64220085-64220107 TCTCCAGGAGGAAACAGGGCCGG - Intronic
1083997554 11:66279612-66279634 GCACCGGGAGGAAGGAGGGAAGG - Intronic
1084119732 11:67062146-67062168 TCACCACCTGGAAGGATGGACGG + Intronic
1084742558 11:71149099-71149121 TCACAAGGAGCAAGGAAGGAGGG + Intronic
1085154072 11:74277241-74277263 TTGCCAGAAGGAAGGATGGAAGG + Intronic
1085620200 11:78032153-78032175 GCACTGGGAGGAAGTATGGCTGG + Intronic
1089162755 11:116452162-116452184 TCACCTGGAGGGAGGAAGACGGG - Intergenic
1089185810 11:116614041-116614063 TCAACAGCAGGAAGGATGCATGG + Intergenic
1090000333 11:122950861-122950883 TCCCCAGTTGGAAAGATGGCTGG - Intronic
1090276322 11:125422301-125422323 CTACCAGGAGGAAGGAGGTCAGG + Intronic
1090434958 11:126678838-126678860 TCAGCAAAAGGAAAGATGGCTGG + Intronic
1090988762 11:131796839-131796861 TCTCTAGGAGGAAGGAAGACAGG - Intronic
1091743613 12:2977004-2977026 TCATCAGGAGGGATGATGGAGGG - Intronic
1093977968 12:25443899-25443921 TCAGAAGGGGGAAGGATGGGAGG - Intronic
1094058800 12:26291971-26291993 GCACCAGGAGCTAGGATGGCAGG + Intronic
1095882908 12:47157464-47157486 TCCCCAGTAGGTAGGATTGCAGG - Intronic
1096189104 12:49603364-49603386 TCACCTGGAGAAGGGATGGGAGG + Exonic
1097218730 12:57434315-57434337 ACCCCAGGAGGGAGGATGGAGGG + Intergenic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1097579800 12:61441188-61441210 TTAACTGGAGGAAGGATGACAGG + Intergenic
1098209051 12:68143339-68143361 TCGCCACGGGGAAAGATGGCAGG + Intergenic
1100060373 12:90567401-90567423 CCACTAGGAAGAAGGGTGGCAGG + Intergenic
1100707594 12:97218871-97218893 TCACAAGGTGGAAGACTGGCTGG - Intergenic
1101062867 12:100989712-100989734 TCACCAGATGGATGGATGGGTGG + Intronic
1101062896 12:100989865-100989887 TCACCAGATGGATGGATGGATGG + Intronic
1101062917 12:100989970-100989992 TCACCAGATGGATGGATGGATGG + Intronic
1102504080 12:113372852-113372874 ACAACAGGAGACAGGATGGCTGG - Intronic
1104205934 12:126638424-126638446 AGAGCAGGAGGAAGGGTGGCAGG + Intergenic
1104223209 12:126806245-126806267 TCACCAGGAGTGAGGAAGGGAGG - Intergenic
1106618686 13:31353787-31353809 TCACCACCAGGAAGAAAGGCAGG - Intergenic
1107566908 13:41614277-41614299 TCACCATGAGGAGTGCTGGCAGG - Intronic
1107871310 13:44749078-44749100 TCACCTGAAGGAATGAGGGCTGG - Intergenic
1108574375 13:51778749-51778771 TCACCTGCAGGAGGGCTGGCTGG + Intronic
1110227853 13:73138777-73138799 GAACCAGGAGGAAGGAGGCCTGG - Intergenic
1112297816 13:98203779-98203801 TCACCAGGAGAAGGGTTTGCTGG + Intronic
1112479236 13:99758598-99758620 TCACCAGCAGGAAGGGAGGAGGG + Intronic
1113450377 13:110405258-110405280 TCACCAGGGTGAATTATGGCTGG + Intronic
1114644965 14:24250495-24250517 TCAGCAGGAGGAATGATGGGGGG - Intronic
1114651950 14:24290897-24290919 GCACACGGAGGAAGGAGGGCAGG + Exonic
1115349153 14:32374521-32374543 TCAGTAGGAGGATGGAAGGCTGG + Intronic
1115506419 14:34098117-34098139 TCACCAGGTTGAGGGATGACAGG - Intronic
1116867114 14:50040063-50040085 TCCCAGGGAGGAAGGGTGGCTGG - Intergenic
1117507469 14:56417485-56417507 TCATCAGAAGGAAGGAGAGCTGG + Intergenic
1118738927 14:68724178-68724200 CAACCAGGAGGGAGGATGGGAGG - Intronic
1121427357 14:93861962-93861984 GCTCCAGGAGGAAGGAGAGCTGG - Intergenic
1121533340 14:94673755-94673777 TGTCCAGGAGGAAGAAGGGCTGG + Intergenic
1124001404 15:25763408-25763430 TCACCAGGAGGAAGTGAGTCTGG - Intronic
1126065248 15:44821598-44821620 TCACCAGGAAGAAGTAAGGGTGG - Intergenic
1126094581 15:45078985-45079007 TCACCAGGAAGAAGTAAGGGTGG + Intergenic
1126166556 15:45658819-45658841 TTTCCAGGAGGAAGGGAGGCCGG - Intronic
1126917674 15:53483991-53484013 GCCCGAGGAGGAAGGATGGATGG + Intergenic
1127323323 15:57868360-57868382 CCACCAGAAGGAAGGAAGTCCGG - Intergenic
1127773787 15:62250470-62250492 GCACCAGGTTGAAGGATGACGGG + Intergenic
1127775318 15:62260070-62260092 GCACCAGGTTGAAGGATGACAGG + Intergenic
1128288225 15:66456430-66456452 TCACCAGGAGGTCGGAAGGCAGG + Intronic
1129063225 15:72878270-72878292 TCACATGGAGGAAGGGTGGAGGG + Intergenic
1129278201 15:74461367-74461389 TCACCAGGCTGAAGAATGACTGG - Intergenic
1129690883 15:77712654-77712676 TCACATGGAGGAAGGGAGGCAGG - Intronic
1132882401 16:2168209-2168231 CCCCCAGGAGGGAGGATGGGGGG - Intronic
1133303624 16:4797277-4797299 GTGCCAGGAGGAAGGAAGGCTGG - Exonic
1134692145 16:16197928-16197950 TCAGGAGGAGGAAGGGTGGGAGG + Intronic
1135422346 16:22313755-22313777 CCACCAGGATGAAGGCAGGCAGG - Intronic
1136103328 16:28011182-28011204 TCACCAGGATGAAGGAAGAAAGG + Intronic
1137586835 16:49668762-49668784 CCCCCAGGAGGAAGGAGGGGTGG + Intronic
1138131370 16:54482747-54482769 TCTCCAGGAGGAAAGACGGCAGG - Intergenic
1138211090 16:55164026-55164048 TGACCATGAGGAAGGAGGGGAGG - Intergenic
1138372735 16:56540215-56540237 TGACCATGAGGAAGGAGGCCAGG - Intergenic
1138406554 16:56799565-56799587 TCCCCAGGAAGGAGGCTGGCAGG + Intronic
1139513267 16:67439240-67439262 GCACCAGCAGGCAGGAGGGCGGG + Intronic
1141030391 16:80582639-80582661 TCAGAAGGAGGAAGGGTGGGAGG + Intergenic
1141079707 16:81039157-81039179 GAACCGGGAGGAAGGCTGGCTGG + Intronic
1141365391 16:83437954-83437976 TGGCCAGGAGGATGGATGGAGGG - Intronic
1141672328 16:85498838-85498860 TCTGCAGGGGGAAGGGTGGCTGG - Intergenic
1141677877 16:85527168-85527190 TCACGAGGGGGAAGCATGACAGG - Intergenic
1141964426 16:87432410-87432432 GCAGCAGGAGGAAGAAAGGCAGG - Intronic
1142012383 16:87722352-87722374 ACAGGAGGAGGAAGGAGGGCAGG + Intronic
1142901076 17:3011991-3012013 TCACCAGGGGCAAGGATGGATGG - Intronic
1143276127 17:5712234-5712256 TGAGCAGGAGGAGGGTTGGCAGG + Intergenic
1143612154 17:8025074-8025096 TCATCAGGGACAAGGATGGCTGG + Intergenic
1144378800 17:14672335-14672357 TCAACAGGAGTAATGATGGATGG + Intergenic
1145284693 17:21496472-21496494 CCACAGGGAGGAAGGATGGAGGG - Intergenic
1145998484 17:29117800-29117822 GCACCATGAGGAAGCATGGAGGG - Intronic
1147480085 17:40752480-40752502 CAACCAGGAGGAAAGAAGGCTGG - Intronic
1147536457 17:41325574-41325596 TCACCAGGTGGGAGGGTGGGAGG + Intergenic
1147862219 17:43530275-43530297 TCACCAGGAAGCAGGCTGGAAGG - Intronic
1148146091 17:45366047-45366069 TCAGAAGGAGGAAGGATGCTGGG + Intergenic
1148901906 17:50884809-50884831 TCTCCAGGAGGAAGGAAAGCAGG - Intergenic
1151297209 17:73194081-73194103 ACACAATGAGGAAGGATGGGAGG + Intronic
1151632508 17:75320496-75320518 TCCCCAGGAGGATGGAGAGCTGG - Exonic
1153622795 18:6995317-6995339 GGACCAGGAGGAAGGTTGGTTGG + Intronic
1155536949 18:26828478-26828500 TGACCAGGAGGCAGTAAGGCAGG - Intergenic
1155588568 18:27397935-27397957 TCTGCAGGATGTAGGATGGCAGG - Intergenic
1155772403 18:29718649-29718671 TCACGAAGAGGAAGGATGATAGG - Intergenic
1156489428 18:37487496-37487518 TGACCAGGAGGGAGGAGGACGGG - Intronic
1157103328 18:44749929-44749951 TCACAATGAAGAAGGATGGCTGG + Intronic
1158515493 18:58127113-58127135 CCGCCAGGAGGGAGGATGACAGG - Intronic
1159000621 18:62971637-62971659 TCCCCAGGAGGAAGCTGGGCGGG + Intronic
1159948403 18:74460455-74460477 TCTCCAGGTAGAAGGATTGCAGG + Intergenic
1160383562 18:78479331-78479353 TCAGCAGGAGGACGCATGGGAGG - Intergenic
1160435337 18:78847772-78847794 TCACAGGCAAGAAGGATGGCAGG + Intergenic
1160560346 18:79752052-79752074 GCACCAGGAGGGAGGGTGTCTGG + Intronic
1161042969 19:2119989-2120011 TCTCCAGGATGCAGGCTGGCTGG + Intronic
1161043840 19:2123966-2123988 TCGCCGGGAGGAGGGATGGGAGG + Intronic
1161322320 19:3646977-3646999 TCACAGGGAGGAAGGATGGGAGG + Intronic
1161932467 19:7350025-7350047 TCACCTGGAGGAAGGCTGCCTGG - Intronic
1161989799 19:7678216-7678238 TCACCATGATGAAGGCTGACAGG - Exonic
1163136394 19:15314521-15314543 TCTCCAGGAGGATGGATGTGAGG - Intronic
1163229448 19:15990298-15990320 TCACCAGGATGAAGATTGGAAGG - Intergenic
1163660334 19:18573271-18573293 TCTGCAGGAGGAAGGGAGGCAGG - Exonic
1163669297 19:18618072-18618094 TGACCAGGAGGGAGGAGGTCAGG - Intronic
1164399045 19:27890338-27890360 TCCCCAGCAGGAATGAGGGCAGG + Intergenic
1164669589 19:30064952-30064974 CCCCCAGGAGGGGGGATGGCAGG + Intergenic
1165392630 19:35547184-35547206 TCAGCAGGAGGACAGCTGGCCGG - Exonic
1165420619 19:35720337-35720359 TCAACATGAGGAAAGTTGGCAGG + Exonic
1165683097 19:37794136-37794158 TAACCAGAAGGAAGTATGGTAGG - Intronic
1166001174 19:39878233-39878255 TCACCTGGGGGAAGGAGGGAAGG + Exonic
1166003956 19:39894492-39894514 TCACCTGGGGGAAGGAGGGAAGG + Exonic
1166753028 19:45173775-45173797 TCCCCAGGAGGAAGGAGTGAGGG + Intronic
1167147811 19:47693704-47693726 CCAGCAGGAGGCAGGAGGGCCGG - Intronic
1167259707 19:48451394-48451416 TCAGCAAGAGGAAGGGTGGCGGG + Intronic
1167273222 19:48518311-48518333 TGACCAGGCTGCAGGATGGCGGG + Intergenic
1167919794 19:52773625-52773647 TCATTAGGAGGATGGATGGGTGG + Intronic
926871217 2:17419890-17419912 CCACCATAAGAAAGGATGGCAGG - Intergenic
927706898 2:25302027-25302049 TCAGCTGGAGGATGGATGGAGGG - Intronic
928170852 2:29002248-29002270 AGATCAGGAGGAAGCATGGCAGG - Intronic
929202028 2:39245511-39245533 CCACCAAGAGGAAGTATGTCCGG - Intergenic
929484106 2:42339533-42339555 AAACCAGGAGGAATGGTGGCAGG - Intronic
931236034 2:60413300-60413322 TCACCAGGAGCCAGTATGGAAGG - Intergenic
932909241 2:75788519-75788541 ACACAGGGAGGAAAGATGGCTGG + Intergenic
932909253 2:75788599-75788621 ACACAGGGAGGAACGATGGCTGG + Intergenic
933807651 2:86011896-86011918 TCCCAAGGATGAAGGAAGGCTGG - Intergenic
935989820 2:108709221-108709243 TCACAAGAAGGAAGGAAGGAAGG + Intergenic
936492752 2:112987018-112987040 TAGCCAGGAGGAGGGATGGGGGG - Intergenic
937797894 2:126046981-126047003 TCACCAGGTGGCAAGGTGGCAGG - Intergenic
938892640 2:135721240-135721262 TCATGAGGTGGAAGGATTGCTGG + Intronic
941271874 2:163440180-163440202 TTACAAGGATGAATGATGGCAGG - Intergenic
946189607 2:218001510-218001532 TCTGCAGCAAGAAGGATGGCAGG - Intronic
946716447 2:222558768-222558790 TCACCAGGAACAAGGAGGCCAGG + Exonic
946983530 2:225246408-225246430 TCTTCAGGATGAAGGGTGGCAGG - Intergenic
947142148 2:227029293-227029315 TCACCAAGAGGAAGGAGGAAGGG - Intronic
948146930 2:235715199-235715221 TGACAAGGAAGAAGGATGGGAGG - Intronic
1169366824 20:4999331-4999353 TCACCAAGTGGATGGATGGATGG + Intronic
1169732468 20:8801342-8801364 TAAACAGGAGAGAGGATGGCAGG - Intronic
1170003647 20:11642611-11642633 TCATCAGGGAGAAGGATGGGAGG - Intergenic
1170652656 20:18256960-18256982 TCACCAGCAGGATGAATAGCAGG + Intergenic
1171362727 20:24600458-24600480 CGATAAGGAGGAAGGATGGCTGG - Intronic
1172730392 20:37082203-37082225 TCACCAGCAGGGGGGATGGCTGG - Intronic
1175430488 20:58898798-58898820 TTGCCGGGAGGATGGATGGCTGG + Intronic
1176123875 20:63466485-63466507 AGGCCAGGAGGGAGGATGGCTGG - Intronic
1178160375 21:29905319-29905341 TCACCAGGAAGGAGGAAGGCTGG + Intronic
1178494862 21:33078036-33078058 TGACCAGGAGGAGGGAAGACAGG - Intergenic
1179323109 21:40312238-40312260 TCACCTGGCAGAAGGATGGCCGG - Exonic
1179344490 21:40544109-40544131 TCAGCAGGAGTCAGGAGGGCAGG + Intronic
1179487986 21:41722900-41722922 TGGCCTGGAGGAAGGATGGATGG + Intergenic
1179878848 21:44285182-44285204 GCACCTGGAGGAAGGAAGGAGGG + Intergenic
1180150261 21:45943715-45943737 TCACCTGGAGGAAGAACAGCAGG + Intergenic
1180176555 21:46093287-46093309 ACACCAGGAGGCAGTATAGCCGG + Intergenic
1181082453 22:20424331-20424353 TCACGGGGAGGAAGGTTGGGTGG - Intergenic
1181133267 22:20746902-20746924 TACCCAGGAGGAAGGGTGACAGG - Intronic
1181486211 22:23233290-23233312 CCACCAGGAGAAAGGCCGGCAGG - Intronic
1182796590 22:32995523-32995545 CCACGTGGAGGAAGGATGGGGGG - Intronic
1184350750 22:43942228-43942250 GCTCCAGGAGGGAAGATGGCAGG - Intronic
1184723379 22:46328985-46329007 GCCCCAGGATGAAGCATGGCAGG - Intronic
950096983 3:10336137-10336159 GCAGCAGGAGGAAGGCTGGTCGG + Intronic
950109149 3:10407436-10407458 TCAGCAGAAGGAAGGAAGGAGGG - Intronic
951590581 3:24260359-24260381 TCACCAGGAGGCAAGTAGGCTGG + Intronic
952462009 3:33537366-33537388 ACAACAGCAGGAAAGATGGCAGG + Intronic
952493799 3:33898202-33898224 CCACCAGCAGGAAGGAGGGAAGG + Intergenic
953275180 3:41488920-41488942 AGACCTGCAGGAAGGATGGCTGG - Intronic
953701364 3:45198416-45198438 TGGCCAGGAGGAGGGGTGGCTGG + Intergenic
954332082 3:49896505-49896527 TGGCCAGGAGGGAGGAAGGCTGG - Intronic
955618319 3:60833249-60833271 TCCCCAGGAGGAAGACTGGAGGG - Intronic
955665144 3:61342338-61342360 TCATCAGGAGGGAGGATCGTTGG - Intergenic
955790715 3:62586286-62586308 TCTCTAGGTGCAAGGATGGCAGG + Intronic
956957968 3:74363225-74363247 GTACCAGGAGGAATGATGCCTGG - Intronic
961337130 3:126187315-126187337 TAACCAGAAGGAAGGAAGGGAGG + Intronic
961736425 3:129004554-129004576 TGAACAGGAGGATGGATGGACGG - Intronic
963395404 3:144725979-144726001 TAGCCAGGAGGAAGGAAGGAAGG + Intergenic
963905135 3:150767301-150767323 ACACCAGGAGGAGGGATCCCTGG - Intergenic
965988891 3:174791394-174791416 TCACGTGGTGGAAGGATGGATGG - Intronic
966582338 3:181582051-181582073 TCACCAGAAGGAAAAATGTCAGG + Intergenic
966707761 3:182935165-182935187 CCATCAGGAGGAACGTTGGCAGG + Intergenic
967080126 3:186042288-186042310 TCTCCAGGAGGAAGGAGAGAGGG - Intergenic
967196715 3:187032851-187032873 TGACCAGGAGGAAGGCAGGCAGG - Intronic
967300030 3:188003850-188003872 TCACCAGGAGGGAGCCCGGCAGG - Intergenic
967550496 3:190789177-190789199 TCACCAGGAGTTAGGAGGGAAGG - Intergenic
967892971 3:194376099-194376121 TCACCATGAGGAAGGGAGGCCGG - Intergenic
968747654 4:2369160-2369182 TCACCAGGAGGAAGGATGGCAGG - Intronic
968857546 4:3138386-3138408 TCACAAGGCGGAAGGCTGGAAGG - Intronic
968938127 4:3624284-3624306 TGACCAGCAGGCAGGATGGGTGG + Intergenic
969228810 4:5815854-5815876 TCACCTGGTGGAAGGAAGGGAGG + Intronic
969695415 4:8731513-8731535 CCACCAGGAGGCAGCATGGCTGG + Intergenic
970602291 4:17650088-17650110 TGGACAGGAGGAAGGATGGATGG - Intronic
970895705 4:21101109-21101131 TCAGTAGGTGGGAGGATGGCAGG - Intronic
971014395 4:22472111-22472133 TTTCCAAAAGGAAGGATGGCAGG - Intronic
977329924 4:95624627-95624649 TCAGCAAGTGGAAGGATGGCAGG - Intergenic
981186440 4:141809072-141809094 TCTCCAGTGGGAAGCATGGCAGG + Intergenic
985795427 5:1958413-1958435 TTACCAGGAGGAGAGAGGGCAGG - Intergenic
985926203 5:3020952-3020974 TCCCCAGGAGGGAGGAGCGCTGG - Intergenic
986051277 5:4092364-4092386 ACACCTGGAGGAAGGATTGCAGG - Intergenic
986235940 5:5910258-5910280 TCACCAGGATGAAGGGGGTCCGG - Intergenic
987092922 5:14523433-14523455 CCAGCAGGAGGAAGGAGGGAGGG - Intronic
989100322 5:37817133-37817155 TCACATGGAGGAAGGATGCAGGG + Intronic
991674050 5:69074975-69074997 TCACCAGCGGGAGGGATGGGAGG - Intergenic
991979311 5:72215116-72215138 ACACCAGGAGGAAGGTTTGTGGG - Intergenic
993552514 5:89291313-89291335 TCAGCAGGAGGAAGGGAGGATGG + Intergenic
993899740 5:93577138-93577160 GCAGCAGGAGGAAGGACGGCAGG - Intergenic
994947730 5:106417297-106417319 TCAGCAGCAGGAAGGGTAGCGGG + Intergenic
997672958 5:135691401-135691423 TCAGCAGGAGGAGGGAAGGTGGG + Intergenic
998227977 5:140341633-140341655 TCACCAGTAGAAGGGATGCCAGG + Intronic
998337073 5:141382941-141382963 TCCCCAGGAGGATGGAGAGCAGG - Exonic
999259821 5:150231067-150231089 TGAGGAGGAGGAAGGATGGGAGG + Intronic
1000242705 5:159423442-159423464 GCAACAGAAGGAAGGCTGGCTGG - Intergenic
1001895342 5:175374593-175374615 TCAGAAGGAGGGAGGATGGGAGG - Intergenic
1002375300 5:178784610-178784632 TTACCAGCAGGAAGGAGGTCAGG - Intergenic
1003523808 6:6881975-6881997 TCACCCGGAGGGAGGATTTCAGG - Intergenic
1003664948 6:8102246-8102268 CCTCCAGGAGGTAGGATGGCAGG + Intronic
1004160228 6:13206147-13206169 GCACCAGGAGGGAGGACGGGAGG + Intronic
1004485081 6:16058738-16058760 TCACCAGGAGCAAGGACGATTGG - Intergenic
1005589287 6:27308681-27308703 TTACCAGCAGTAGGGATGGCAGG + Intronic
1006296730 6:33173171-33173193 TTCCCAGGAGGAAGGATCCCAGG + Intronic
1006678313 6:35779303-35779325 TCACCAGGATGCAGGAAGGATGG - Intronic
1006784898 6:36659921-36659943 TCAGAAGGAGGAAGGATGGAAGG + Intergenic
1007097460 6:39222334-39222356 TCAGCAGGAGAAAGGAAGGAGGG + Intronic
1007167724 6:39840894-39840916 TAAGGAGGAGGAAGGGTGGCCGG + Intronic
1007748951 6:44060285-44060307 GCTCCAGGAGGATGGATGGATGG + Intergenic
1008039378 6:46780193-46780215 ACTCTAGGAGGAAGGATGGGAGG + Intergenic
1008111837 6:47503368-47503390 GCTACAGGAGGAAGGGTGGCTGG + Exonic
1008443249 6:51557064-51557086 TCACCAGAAGTAAGGTTGGGTGG - Intergenic
1008930969 6:56939454-56939476 GCACAAGGAGGAAGGATGGTTGG + Intronic
1013012154 6:106130713-106130735 ACAACAGGAAGTAGGATGGCTGG + Intergenic
1013252777 6:108350834-108350856 TCACCAGGTGAAAGGTAGGCTGG + Intronic
1015338214 6:132066210-132066232 TCACCATAAGGAAGGATGGATGG - Intergenic
1015495429 6:133877300-133877322 TCACGATGAGGAAGGATTACAGG + Intergenic
1017062006 6:150492847-150492869 CCACAAGGAGGGAGGATGGAAGG - Intergenic
1017790046 6:157790038-157790060 TCGCCAGGAAGGAGGAAGGCAGG + Intronic
1018035315 6:159876477-159876499 TCAGTAGGATGAGGGATGGCTGG - Intergenic
1018223581 6:161606273-161606295 ACAGCAGGAGGAAGGGAGGCTGG + Intronic
1019508191 7:1403919-1403941 TCACCAGGAGTGTGGATGCCGGG - Intergenic
1019787347 7:2985548-2985570 TCACTACCAGGAAGGCTGGCTGG - Intronic
1020113413 7:5461055-5461077 ACACCAGGAGAAAGGCTGGCGGG - Intronic
1020205357 7:6110233-6110255 TAACCAGAAGGAAGCCTGGCTGG + Intronic
1024326580 7:48114024-48114046 TCACCATGAGGGAAGCTGGCAGG + Intergenic
1024459558 7:49645980-49646002 TTTCCTGGAGGAAGGAAGGCTGG + Intergenic
1024953177 7:54886723-54886745 TCACCAAGAGGAAAGATGACTGG - Intergenic
1025156032 7:56606425-56606447 TCCACAGGGGGAAGGATGCCAGG + Intergenic
1025227663 7:57178643-57178665 TCACAGGGAGGAAGGCTGGTTGG + Intergenic
1025929101 7:65980725-65980747 TCACAGGGAGGAAGGCTGGTTGG + Intronic
1026063552 7:67048311-67048333 TCACCTGGGGGCTGGATGGCTGG + Intronic
1026714798 7:72779163-72779185 TCACCTGGGGGCTGGATGGCTGG - Intronic
1027512633 7:79102472-79102494 TCAGCAGGAGGAATAAAGGCAGG - Intronic
1029652533 7:101903274-101903296 TTAACAGGAGGCAAGATGGCCGG + Intronic
1029703716 7:102264454-102264476 TGACCAGGAGGAAGAGTGGGAGG + Intronic
1031331625 7:120472992-120473014 TCACCGATAGCAAGGATGGCTGG + Intronic
1031467175 7:122126793-122126815 TGACCAGAAGGAAGGATGTAAGG - Intronic
1032856705 7:135840278-135840300 TCTCCAGGAGGTAGGATTGTGGG + Intergenic
1032984726 7:137325378-137325400 TCCCTAGGAAGAAGGATGCCTGG + Intronic
1035621952 8:1041879-1041901 TCACCATGCGGAAGAATGTCGGG + Intergenic
1035624554 8:1061164-1061186 TCACCACGAACAAGGCTGGCTGG - Intergenic
1036226245 8:6960170-6960192 TCATCTGGAGGAGGGATAGCAGG + Intergenic
1036228282 8:6978643-6978665 TCACCTGGAGGAGGGAGAGCAGG + Exonic
1036230735 8:6997760-6997782 TCACCTGGAGGAGGGAGAGCAGG + Exonic
1036233181 8:7016859-7016881 TCACCTGGAGGAGGGAGAGCAGG + Exonic
1036234835 8:7029498-7029520 TCACCTGGAGGATGGAGAGCAGG + Intergenic
1036685347 8:10905665-10905687 TCCCCAGGAGGGAGGGAGGCAGG - Intronic
1038311604 8:26449651-26449673 TGAGCAGGAGGAGGGAGGGCGGG + Intronic
1038733076 8:30145001-30145023 TGACCAGGAGGAAGGGAAGCAGG + Intronic
1039042921 8:33425098-33425120 GGTCCAGAAGGAAGGATGGCTGG + Intronic
1039349048 8:36741078-36741100 CCAGAAGGAGGAAGAATGGCTGG + Intergenic
1041231605 8:55757978-55758000 GCACCAGGGGGAATGAGGGCAGG + Intronic
1041324667 8:56651831-56651853 TGAGCAGGTGGAAGGATAGCTGG + Intergenic
1041584307 8:59498086-59498108 TCACCAGGAGGAGGGAAGAGAGG - Intergenic
1041770891 8:61471663-61471685 TGACCAGGAGGAAGGGAGGTAGG - Intronic
1042203713 8:66307121-66307143 TCACCAGCTGCAAGGAAGGCTGG - Intergenic
1043350549 8:79355338-79355360 ACACCAGGAGGGAGGAGGGATGG + Intergenic
1045489292 8:102656481-102656503 TGCCCAGGAGGAAGGATGGGCGG - Intergenic
1046088028 8:109463269-109463291 TCAGCAGAAGGAAGGAAGGGAGG + Intronic
1047244347 8:123126597-123126619 TCATCAGAAGGAAGGAAGGATGG - Exonic
1047521320 8:125597331-125597353 GCACCAGGAGTGAGGATGGGAGG - Intergenic
1049287368 8:141783120-141783142 TGAACAGGTGGAAGGATGGATGG - Intergenic
1049349597 8:142157465-142157487 GCACCAGCTGGAAGGAGGGCAGG - Intergenic
1051346761 9:16158360-16158382 ACAGCAGCAGAAAGGATGGCGGG + Intergenic
1053562364 9:39209699-39209721 ACACCAGAAGGAAGGAAGGAAGG - Intronic
1053828169 9:42047691-42047713 ACACCAGAAGGAAGGAAGGAAGG - Intronic
1054134788 9:61409340-61409362 ACACCAGAAGGAAGGAAGGGAGG + Intergenic
1054453044 9:65413422-65413444 TGACCAGCAGGCAGGATGGGTGG - Intergenic
1054602390 9:67139763-67139785 ACACCAGAAGGAAGGAAGGAAGG + Intergenic
1055568019 9:77588479-77588501 TCCCCAGGAGCAAGGAAGCCTGG + Intronic
1056307429 9:85303756-85303778 TCACTAGGAGTTAGGAGGGCCGG + Intergenic
1056561214 9:87731486-87731508 TCACTAGGAGGAAGAGTGGGTGG + Intergenic
1056577316 9:87866388-87866410 TCACTAGGAGGAAGAGTGGGTGG + Intergenic
1057248835 9:93482648-93482670 TCTCCAGGAGCAACGATGGTAGG + Intronic
1057314910 9:93961728-93961750 CCAGCAGGAGGCAGGAGGGCTGG - Intergenic
1057839289 9:98472498-98472520 TTATCAGGAGGATTGATGGCAGG - Intronic
1058348045 9:103988011-103988033 TCAGAAGTAGGTAGGATGGCAGG + Intergenic
1060092575 9:120756262-120756284 TAAACTGGAGGAAGGATGGATGG - Intronic
1060617750 9:125034188-125034210 TCAGCAGGAGGTTGGAGGGCAGG - Intronic
1061400565 9:130365978-130366000 TCTCCTGGAGGAAGGACGGTAGG + Intronic
1061957872 9:133973026-133973048 TCTCCAGGAGGGAGGCTGGTTGG - Intronic
1061958355 9:133975233-133975255 CCACCAGGAGCTAGGAGGGCTGG + Intronic
1061973901 9:134058821-134058843 TCACCAAGAGGGAGGGTGGGCGG + Intronic
1062344961 9:136110362-136110384 CCCCCAGCAGGAAGGACGGCAGG - Intergenic
1062539341 9:137034725-137034747 GCACAAACAGGAAGGATGGCAGG - Exonic
1062540277 9:137038990-137039012 GCACACGGAGGAGGGATGGCAGG - Intergenic
1186143536 X:6602375-6602397 TCGGCAGGTGGAAGGAAGGCAGG - Intergenic
1186451856 X:9680538-9680560 TCAGCAGCAGGCAGGATGGCTGG - Intronic
1187461990 X:19495443-19495465 TAACTAGGAGGAAGGAGGGGAGG + Intronic
1188441525 X:30218572-30218594 TGACCACGAGGCATGATGGCTGG - Exonic
1189058007 X:37720032-37720054 ACATCAGGAGTAAGGATGACTGG - Intronic
1190128429 X:47725286-47725308 CCAACAGAAGGAGGGATGGCTGG - Intergenic
1193236833 X:79116957-79116979 TCACAAGGAGGCAGGATGGAGGG + Intergenic
1199361467 X:146924412-146924434 TCAGAAGGAGGAGGGATGGAGGG - Intergenic
1200761105 Y:7039895-7039917 TCAGAAGCAGGCAGGATGGCTGG - Intronic
1201145893 Y:11065500-11065522 TCACAAGGAGCAAGGAAGGAGGG + Intergenic