ID: 968747992

View in Genome Browser
Species Human (GRCh38)
Location 4:2370810-2370832
Sequence GGCGCCCAGCATCACAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 115}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968747992_968747998 3 Left 968747992 4:2370810-2370832 CCCACACTGTGATGCTGGGCGCC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 968747998 4:2370836-2370858 CTGACTGCCCTCAGGAGGGATGG 0: 1
1: 0
2: 2
3: 25
4: 275
968747992_968747996 -2 Left 968747992 4:2370810-2370832 CCCACACTGTGATGCTGGGCGCC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 968747996 4:2370831-2370853 CCTCTCTGACTGCCCTCAGGAGG 0: 1
1: 0
2: 2
3: 21
4: 291
968747992_968747999 4 Left 968747992 4:2370810-2370832 CCCACACTGTGATGCTGGGCGCC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 968747999 4:2370837-2370859 TGACTGCCCTCAGGAGGGATGGG No data
968747992_968748004 30 Left 968747992 4:2370810-2370832 CCCACACTGTGATGCTGGGCGCC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 968748004 4:2370863-2370885 CCAACCCTGCCACGTCCATGTGG 0: 1
1: 0
2: 1
3: 12
4: 149
968747992_968747997 -1 Left 968747992 4:2370810-2370832 CCCACACTGTGATGCTGGGCGCC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 968747997 4:2370832-2370854 CTCTCTGACTGCCCTCAGGAGGG 0: 1
1: 0
2: 3
3: 36
4: 251
968747992_968747994 -5 Left 968747992 4:2370810-2370832 CCCACACTGTGATGCTGGGCGCC 0: 1
1: 0
2: 0
3: 7
4: 115
Right 968747994 4:2370828-2370850 GCGCCTCTCTGACTGCCCTCAGG 0: 1
1: 0
2: 0
3: 17
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968747992 Original CRISPR GGCGCCCAGCATCACAGTGT GGG (reversed) Intronic
900595476 1:3478359-3478381 GGAGCCCAGCAGCACTGGGTAGG + Intronic
900957172 1:5893166-5893188 GGGGACCAGCCTCACAGGGTCGG + Intronic
901083064 1:6594306-6594328 GGTGCCCAGCCTGACAGTGATGG - Intronic
902197445 1:14808115-14808137 GGCTCACAGTATCTCAGTGTTGG - Intronic
903709013 1:25308077-25308099 TGCACCCATCATCACAGTGCAGG + Intronic
903718103 1:25384342-25384364 TGCACCCACCATCACAGTGCAGG - Intronic
903743085 1:25569575-25569597 GGTGACCATCATCACATTGTTGG + Intergenic
904854880 1:33490098-33490120 GGAGCCCGGGATCACTGTGTGGG + Intronic
910340689 1:86183539-86183561 GGAGCTCAGCATGAAAGTGTGGG + Intergenic
912367959 1:109150385-109150407 GTCGCCTAGCAACACAGTGCTGG - Intronic
915460210 1:156066019-156066041 GGTGCCCAACATCACAGTGCGGG - Exonic
918550605 1:185737834-185737856 GGAGCCCTGCATTACAGTTTGGG + Intronic
920370171 1:205473755-205473777 GATGCCCAGCAGCAAAGTGTTGG + Intergenic
1070587993 10:77780711-77780733 GGAGCCCATCATCACTGTGGAGG + Intergenic
1075668023 10:124244627-124244649 GAGGCCAAGCATCACAGGGTGGG - Intergenic
1078060722 11:8041026-8041048 GGGAACCAGCATCACTGTGTGGG + Intronic
1078240772 11:9529408-9529430 GGCGCCCAGCCTCCCAGTGCTGG + Intergenic
1082691250 11:56307740-56307762 GGCACCCCTCATCACAGTATTGG - Intergenic
1083800180 11:65041907-65041929 GGAGCCCACCATGACAGTGGAGG + Intronic
1084418545 11:69048927-69048949 GGCGCCCAGCTTCACTGCGCAGG - Exonic
1084436989 11:69148727-69148749 GGAGGCCAGCAGCAAAGTGTGGG + Intergenic
1084747552 11:71182905-71182927 GCCTCTCTGCATCACAGTGTGGG + Intronic
1085299441 11:75449772-75449794 GGCGCCCAGGGTCACAGAGCAGG - Intronic
1089061588 11:115630289-115630311 GGCGCCCAGCAACACTGGGCTGG - Intergenic
1090155432 11:124432660-124432682 GGAGACCAGAATCACAGTTTGGG + Intergenic
1091041364 11:132284548-132284570 GGGTCCCAGTATCACAGTGTGGG - Intronic
1091339692 11:134800752-134800774 CACTCCCAGCATCACTGTGTGGG + Intergenic
1093568980 12:20643983-20644005 GGGGGGCAGTATCACAGTGTTGG - Intronic
1096685407 12:53285315-53285337 TGGGGCCAGCATCACAGGGTAGG + Intronic
1101298986 12:103458458-103458480 GGTGCCCAGCATCACACCCTGGG - Intronic
1103326469 12:120124658-120124680 GTCCTCCCGCATCACAGTGTTGG + Intergenic
1103844337 12:123891058-123891080 GGAGCCCAAGATCACGGTGTCGG + Intronic
1103928186 12:124435280-124435302 GGCACCCAGCAGCCCTGTGTGGG + Intronic
1104485702 12:129149749-129149771 GGCTCCCAGCCCCCCAGTGTTGG - Intronic
1105724319 13:23146665-23146687 TGTGCCAAGCATCACAGTTTTGG - Intergenic
1113788485 13:113015292-113015314 GGCTCCCAGCACCCCTGTGTGGG + Intronic
1116940902 14:50789684-50789706 GGCCCCCAGCTGCAGAGTGTGGG - Intronic
1124057966 15:26260284-26260306 GGGGCCCAGCCCCACTGTGTAGG + Intergenic
1124145494 15:27121574-27121596 GGTGCACAGCATCACTGTGGTGG - Intronic
1126937587 15:53728514-53728536 TTTGCCCAGTATCACAGTGTTGG + Intronic
1129219325 15:74122250-74122272 GTCACCCAGCATCAGAGTTTGGG - Intronic
1129226921 15:74175531-74175553 GGCGCCGAGCATGGCAGTGGCGG - Exonic
1129348237 15:74938003-74938025 GGCGCCCAGCATGACGGCGATGG + Exonic
1133916278 16:10112518-10112540 GGAGCCCATCATCACTGTGGAGG - Intronic
1136281926 16:29218346-29218368 GGCACCCAGCCTGGCAGTGTGGG + Intergenic
1139367159 16:66440584-66440606 GGGGCCCAGCATCCCAGGGCAGG - Intronic
1141158284 16:81611923-81611945 GGCGCCCAGCCTTCCAGCGTGGG + Intronic
1142086302 16:88184262-88184284 GGCACCCAGCCTGGCAGTGTGGG + Intergenic
1145289824 17:21534332-21534354 GGGCTCCAGCATCACAGTGAAGG + Exonic
1146714610 17:35074560-35074582 GGCCCAAAGCCTCACAGTGTTGG - Intronic
1156399567 18:36728258-36728280 GGCCTCCAGCACCACAGTATTGG + Intronic
1158657443 18:59351724-59351746 GGCTCACAGCCTCACGGTGTTGG + Intronic
1160434833 18:78841764-78841786 GGCACCCAGCACCACCGCGTTGG + Intergenic
1161154043 19:2723076-2723098 GGTGCCCAGCAGCCCCGTGTAGG - Intronic
1161275562 19:3414774-3414796 GATCCCCAGCATCACAGAGTCGG - Intronic
1161283936 19:3459343-3459365 GCCACCCAGCCTCACAGTGGGGG - Intronic
1163510906 19:17734344-17734366 GGCGCTGGGCATCACGGTGTTGG + Exonic
1163610681 19:18299845-18299867 GGAGCCCAGGATCCCAGTCTGGG - Intergenic
1163639890 19:18456263-18456285 GGTGCCCACCATCCCAGAGTAGG + Intronic
1164527855 19:29024939-29024961 GGCGCCCAGCCCCAAGGTGTTGG - Intergenic
1165046864 19:33111743-33111765 GGACCCCAGCATGACAGAGTGGG + Exonic
1165726953 19:38119598-38119620 GGCGCTGAGCAGCACAGTGCAGG + Exonic
1165807173 19:38587554-38587576 GCCCCCCAGCATCACTGTGTTGG + Intronic
924972616 2:142670-142692 CTCGCCCACCATCACAGTGAAGG + Intergenic
926170438 2:10549814-10549836 GGCGCTCAGGATCTCAGTGCTGG + Intergenic
926678339 2:15645520-15645542 ACCTCCCAGCATCACACTGTTGG + Intergenic
932893991 2:75621273-75621295 GCCTACCAGCAACACAGTGTGGG - Intergenic
934087536 2:88522655-88522677 GGTCCCCAGCATGGCAGTGTTGG - Intergenic
941245806 2:163094860-163094882 GGTGGCCAGCAGCACAGTCTTGG + Intergenic
943369747 2:187002255-187002277 GGAGCCCATCATCACTGTGGAGG + Intergenic
944581740 2:201137897-201137919 GGAGCCCATCATCACTGTGGAGG + Intronic
948842672 2:240662844-240662866 GGCTCCCAGCATCAGAGTGATGG + Intergenic
1175731444 20:61357050-61357072 GGCACCCCGCATCTCAGTGAGGG - Intronic
1176966048 21:15213072-15213094 GGCACTCAGCATCACAGTGCTGG - Intergenic
1180748802 22:18110709-18110731 GCCCCCCGGCATCACAGTGCCGG - Intronic
953329520 3:42040967-42040989 TGCGCCCAGCCACACTGTGTTGG + Intronic
953772118 3:45785783-45785805 CCAGCCCAGCCTCACAGTGTGGG - Intronic
961398569 3:126616582-126616604 GGGGCCCAGCAGCACAGTGGGGG - Intronic
967176616 3:186866481-186866503 GGCGCCCAAAACCACATTGTGGG - Intergenic
968747992 4:2370810-2370832 GGCGCCCAGCATCACAGTGTGGG - Intronic
969214551 4:5711466-5711488 GGCGCCCAGCAGCACGGCGGGGG - Exonic
975118855 4:70706591-70706613 GTCACCCACCATCACAGTTTTGG - Intronic
983237039 4:165191336-165191358 AGCGCTCAGCAGCACAGAGTAGG + Intronic
986547869 5:8918607-8918629 GGAGCACAGCATCATAGTATTGG + Intergenic
988180236 5:27781840-27781862 GGCTCTCAGCACCACAGTGATGG + Intergenic
988567338 5:32329848-32329870 CTCGCCCAGGATCACAGTGCTGG + Intergenic
989450662 5:41582926-41582948 GGAGTGCAGCATCACAGTCTTGG - Intergenic
996527282 5:124492382-124492404 GGCGACCAGCACCACAGTTGCGG - Intergenic
998336347 5:141375609-141375631 GGCGTACAGAATCCCAGTGTCGG - Exonic
999308387 5:150535512-150535534 TGTGCCCAGAATCTCAGTGTGGG - Intronic
1002717128 5:181234628-181234650 GGCGCCCAGCTTCATAGTCCAGG - Exonic
1006111699 6:31750659-31750681 GGCTCCCACCAGAACAGTGTAGG - Intronic
1006115897 6:31776080-31776102 GTCGCTCAGCATCAAAGTGCAGG + Exonic
1006610435 6:35291395-35291417 AGGGCCCAGCATACCAGTGTGGG - Exonic
1007030624 6:38622824-38622846 GTCGCCCTGCTTCACAGTCTGGG + Intronic
1008244289 6:49150961-49150983 GGCGACCAGCACCACAGTTGTGG - Intergenic
1009964415 6:70563630-70563652 GGCCCTCTGCATCACACTGTGGG - Intergenic
1011416718 6:87129605-87129627 GGCCCCCAGAATCCCACTGTAGG + Intergenic
1011613700 6:89179013-89179035 GCCGTCCAGCATCGCAGTGCGGG + Exonic
1018700484 6:166422376-166422398 GGCGCCTGGCATCTCACTGTGGG - Intronic
1018982209 6:168610153-168610175 CGTGCCCATCCTCACAGTGTGGG - Intronic
1019267233 7:124661-124683 GGCACCCAGCTTCTCACTGTTGG + Intergenic
1019450402 7:1094832-1094854 GGAGCCCAGCACCACGGTGCTGG - Intronic
1023321772 7:39006086-39006108 GGGGCCCAGTCTAACAGTGTTGG + Intronic
1024684950 7:51734738-51734760 GGTGCCCTGCATCCCAGTGGTGG - Intergenic
1025853709 7:65261136-65261158 GGCGCCCAAAACCACATTGTGGG - Intergenic
1028439790 7:90846799-90846821 GGCCCCCAGCATCCTAATGTTGG + Intronic
1029273324 7:99389967-99389989 GGCAGCCAGCAGCACATTGTTGG - Exonic
1029453948 7:100657862-100657884 GGCTCCCAGTACCACAGTTTTGG + Intergenic
1030084461 7:105804819-105804841 GGCTCCCAGTCTCACAGTTTGGG + Intronic
1033097157 7:138441841-138441863 GGAGCCCATCATCACTGTGGAGG - Intergenic
1035256212 7:157629588-157629610 GGCGCCCATCATCACTCCGTGGG + Intronic
1038103410 8:24406376-24406398 GATGCCCTGCATGACAGTGTTGG + Intergenic
1039247133 8:35621289-35621311 TGAGCCCGGGATCACAGTGTAGG + Intronic
1049194990 8:141310312-141310334 GGCGCCCAGGCTCACACAGTTGG - Intergenic
1057272226 9:93657730-93657752 GGCGCCCCTTAGCACAGTGTAGG - Intronic
1057877779 9:98771097-98771119 GCCGTGCAGGATCACAGTGTGGG + Intronic
1062134010 9:134915199-134915221 GGCGCCCACCCTCTCCGTGTGGG - Intronic
1062201651 9:135306052-135306074 GAAGCCCAGCATCACAGGGAGGG - Intergenic
1187531690 X:20102877-20102899 GGATCACAGCATCACAGAGTTGG + Intronic
1189361910 X:40359564-40359586 GGAGCCCATCATCACTGTGGAGG + Intergenic
1192634369 X:72803961-72803983 TGCCCGCAGCATCACAGGGTGGG - Intronic
1192647341 X:72916840-72916862 TGCCCGCAGCATCACAGGGTGGG + Intronic