ID: 968748090

View in Genome Browser
Species Human (GRCh38)
Location 4:2371268-2371290
Sequence GTACAAAAGAAGAATGTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 325}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968748090 Original CRISPR GTACAAAAGAAGAATGTGCC AGG (reversed) Intronic
900252745 1:1679669-1679691 GTACAAAAAAAAAATCAGCCGGG + Intronic
900676538 1:3890690-3890712 GTGCAGAAGCAGAATGAGCCAGG - Exonic
901048055 1:6410822-6410844 GTACAAAAAAAAAATTAGCCGGG - Intergenic
901298488 1:8180399-8180421 GTCCTTAAGAAGAATGGGCCGGG + Intergenic
904183494 1:28684162-28684184 GAACAAAAGAAAAATCAGCCAGG - Intronic
904337374 1:29806899-29806921 GAAAAAAAGATGAATGAGCCTGG + Intergenic
904693994 1:32317117-32317139 TTACAAAAGAAGAATCTGAGGGG - Intronic
905430621 1:37920366-37920388 ATACAAAAGAAGAATGTGGCCGG + Intronic
906458969 1:46022875-46022897 ATACAAGAGAAGAATGTGCGTGG - Intronic
906504832 1:46371286-46371308 GTAAAAAAGAAAAATTAGCCAGG - Intergenic
906808808 1:48805604-48805626 GTGCAAAAGAATAATGGCCCAGG + Intronic
906980073 1:50620793-50620815 GTACAAAAGATCTATGTGGCTGG - Intronic
907200437 1:52721959-52721981 GTAAAAAAGAAGAACGAGCATGG - Intergenic
907815736 1:57916780-57916802 ATACAAAAGAAAAATTAGCCAGG + Intronic
908179926 1:61593564-61593586 GAACAAAATAAGAATCTGGCTGG - Intergenic
908437804 1:64123402-64123424 TTAGAAAAGAACACTGTGCCTGG + Intronic
908728455 1:67201245-67201267 GTACAAAAAAAAAATTAGCCAGG + Intronic
908900961 1:68955858-68955880 GTGCAACAGAAGAAAGTACCAGG - Intergenic
909911694 1:81266579-81266601 GTACAACAGAACAATCTCCCTGG + Intergenic
910256400 1:85251816-85251838 GTACAACAGAAAAAAGTACCTGG + Intronic
910390283 1:86735901-86735923 GCAGAAAAGCAGAAGGTGCCTGG + Intronic
910729166 1:90372148-90372170 GTACAAAAAAAAAATTAGCCTGG - Intergenic
911929753 1:103887005-103887027 GAACAAAAACACAATGTGCCAGG + Intergenic
912671389 1:111630679-111630701 GTATATAAGAAGAATGAACCAGG + Intronic
912827494 1:112919189-112919211 ATACAAAAAAAAAATGAGCCGGG - Intronic
913110378 1:115652172-115652194 GTCAAAAAGAATAAGGTGCCAGG - Intronic
913313248 1:117525204-117525226 GTACAAACAAAGAATTTGACAGG + Exonic
913471301 1:119190013-119190035 GAACCAAAGAAGAAAGTGCATGG - Intergenic
916388695 1:164306182-164306204 GTGCCACAGGAGAATGTGCCTGG + Intergenic
917945446 1:179965779-179965801 GTACAAAAAAAAAATTAGCCAGG - Intronic
919890333 1:201968155-201968177 ATACAAAAAAAAAATGAGCCAGG - Intronic
920723839 1:208415243-208415265 GTACAGCAGAAGTATGTGCAAGG - Intergenic
921157298 1:212448777-212448799 GTTCAAAAGAAAAAAGTGCTGGG + Intergenic
922125201 1:222714361-222714383 GTACAAAAAAAAAATTAGCCGGG - Intronic
922517036 1:226215283-226215305 GTACAAATGCAGAATGTGCCAGG - Intergenic
924369742 1:243335043-243335065 TTACATGAGAGGAATGTGCCAGG - Intronic
924746930 1:246844423-246844445 CCACAAAAGGAGAAAGTGCCAGG + Intronic
924752871 1:246912180-246912202 TTAAAAATCAAGAATGTGCCGGG + Intronic
924908766 1:248486144-248486166 GTACAGAAGAAGAATGAACAGGG + Intergenic
924915341 1:248561918-248561940 GTACAGAAGAAGAATGAACAGGG - Intergenic
1064552084 10:16512671-16512693 GTAACAAAGAGGAATGAGCCAGG + Exonic
1064919679 10:20502999-20503021 GTACAAAAAAAGAATGGGATGGG - Intergenic
1067724943 10:48762804-48762826 GCACAAAAGCAGAAGCTGCCAGG + Intronic
1068044778 10:51872068-51872090 AAACAAATGAAGAATGGGCCAGG - Intronic
1069433893 10:68362493-68362515 GAACAAAAGGAAAATGTGGCTGG + Intronic
1069541084 10:69294424-69294446 ATAAAAAAGCAGAATCTGCCAGG + Intronic
1069780239 10:70950777-70950799 GAAGAAAAGAAGAGTGTGTCTGG - Intergenic
1070456060 10:76618800-76618822 GCAGTAAAGAAGAATGTGCTGGG + Intergenic
1071275899 10:84054739-84054761 GCACAAAAGAAGAACCTGCCAGG - Intergenic
1073023919 10:100471897-100471919 ATACAAAATAAAAATATGCCGGG + Intronic
1073402333 10:103268475-103268497 ATACAAAAGAAAAATTAGCCTGG + Intergenic
1073837639 10:107463214-107463236 GTACAGAAGAAGACTATGTCTGG + Intergenic
1075313457 10:121433406-121433428 TTAAAAAAGAAAAATGGGCCAGG + Intergenic
1077540917 11:3146139-3146161 GTACAAAAGAAAAATAAGCCAGG + Intronic
1080019652 11:27546769-27546791 AAACAAAAAAAGTATGTGCCTGG + Intergenic
1082769717 11:57197870-57197892 GCACAAAAGCAGAAGCTGCCAGG - Intergenic
1083089164 11:60182182-60182204 GTAAAAATTAAGAATGTGTCTGG - Intronic
1083142142 11:60730700-60730722 GTAGACAAGTAGATTGTGCCAGG + Intronic
1085636209 11:78161404-78161426 GTACAAAACCAGGATGGGCCTGG - Intergenic
1085748112 11:79132183-79132205 ATACAAAAAAAAAATGAGCCGGG + Intronic
1087018906 11:93582457-93582479 ATACAAAAGATGAATTGGCCGGG - Intergenic
1088375194 11:109133234-109133256 GTAAAAATGTAGAATGTGACAGG + Intergenic
1089081236 11:115777761-115777783 TTAAAAAAGAAGAATGGGTCTGG - Intergenic
1090019837 11:123118288-123118310 ATACAAAAGAAAAATTAGCCAGG - Intronic
1091851681 12:3704606-3704628 ATAGAAAAGAAGAATGGGTCTGG + Intronic
1092451169 12:8603656-8603678 GTACAAAAGAAGATTGTTATGGG - Exonic
1092711603 12:11343667-11343689 ATAAAAAAGAAGAAAGTGGCTGG - Intergenic
1094505614 12:31058509-31058531 ATACAAAAAAAAAATGAGCCGGG + Intergenic
1094653115 12:32397196-32397218 GTACAAAAGTATAATATGGCCGG + Intergenic
1095545188 12:43359552-43359574 TTACAAAAGAAGAATGAAGCTGG + Intronic
1097140111 12:56895220-56895242 GTACAAAAAAAAAATTAGCCAGG - Intergenic
1097738291 12:63208281-63208303 GCACAAAAGAGGATTGTGCCGGG + Intergenic
1097970942 12:65632459-65632481 GTACAAAAGCAGAAACTGCCAGG + Intergenic
1098252066 12:68580350-68580372 GTACAAAAAAAAAATTAGCCGGG + Intergenic
1099194217 12:79595689-79595711 ATACAAAAAAAGAATTAGCCGGG + Intronic
1102403222 12:112649286-112649308 ATTCAAAATAAAAATGTGCCAGG - Intronic
1103533065 12:121615889-121615911 CTCAAAAAGAAGAATGTGGCCGG - Intergenic
1105246652 13:18658614-18658636 TTAAAAAAGAGGAATGGGCCAGG - Intergenic
1105498953 13:20954674-20954696 GTAAAAGAGAAAAATGGGCCAGG + Intergenic
1107495246 13:40920014-40920036 ATACAAAAAAAGAATTAGCCAGG - Intergenic
1107579095 13:41762971-41762993 TTATAAAAGAAGAACGGGCCAGG + Intronic
1108247215 13:48530049-48530071 GAACAAAAAAAAAATGAGCCAGG - Intronic
1108684551 13:52807532-52807554 GTAAAAAAGAGGAATCAGCCGGG + Intergenic
1109077212 13:57851495-57851517 GTAAAAAAGAAGAATGAAACTGG - Intergenic
1112893505 13:104268580-104268602 GTATTAAAGAAGAATGTCCCTGG + Intergenic
1113465532 13:110510184-110510206 GGACAAAAGAAGGGTGAGCCAGG - Intronic
1113717738 13:112525225-112525247 GGACAAAGGAATAATGTGCATGG - Intronic
1113979637 13:114263508-114263530 GTACAAAAAAATTAAGTGCCGGG - Intronic
1114372738 14:22108419-22108441 TTACAAAAGTGGAAGGTGCCAGG + Intergenic
1114390012 14:22297468-22297490 GTTCAAAGGCAGAATGTGCCAGG - Intergenic
1114575281 14:23707171-23707193 GTACAAGGGAAAAATGTGTCAGG + Intergenic
1115114838 14:29867698-29867720 GTACAGAGGCAGAATGAGCCAGG + Intronic
1115633773 14:35270924-35270946 GTACAAAAAAAAAATTAGCCAGG + Intronic
1116734536 14:48671672-48671694 GTACAAAAGAGCCATGTGACTGG + Intergenic
1120774428 14:88417782-88417804 GTACAAAAAAAGAAAATGACAGG - Intronic
1121239338 14:92417038-92417060 GTAGAAAAGAAGAAACTGACAGG - Intronic
1121984780 14:98494355-98494377 GTACAGAAATAGAATGTGTCAGG - Intergenic
1123394177 15:19911957-19911979 GTAAATAAGAAGAATCTCCCTGG - Intergenic
1124105862 15:26737267-26737289 GTACAAAACAAGACTGAGCATGG + Intronic
1125159285 15:36625118-36625140 ATACAAAAGAAAAATTAGCCGGG + Intronic
1125640144 15:41223702-41223724 ATACAAAAGAAAAATCAGCCGGG + Intronic
1125928104 15:43579999-43580021 ATACAAAAAAAAAATGAGCCAGG - Intronic
1125941248 15:43679557-43679579 ATACAAAAAAAAAATGAGCCAGG - Intergenic
1126031090 15:44498428-44498450 CTACAAAAAATGAATGAGCCTGG + Intronic
1126686048 15:51249949-51249971 CTCCAGAAGAAGAATGTCCCAGG - Intronic
1127454620 15:59145545-59145567 ATACAAAAGAAAAATTAGCCGGG - Intronic
1127588877 15:60402832-60402854 GTACAAAGCATGAATGAGCCTGG - Intronic
1127612345 15:60649287-60649309 GAACACAAGGAGAAAGTGCCAGG - Intronic
1128274897 15:66345208-66345230 GTACAAGGGAAGAGTGTTCCAGG + Intronic
1129439324 15:75568674-75568696 GAAAAAAAAAAAAATGTGCCAGG + Intronic
1129549963 15:76437985-76438007 ATAAAAAAGAAAAATGGGCCGGG + Intronic
1130744324 15:86634730-86634752 ATAAAAAAGAAAAATGTGCCAGG + Intronic
1131819738 15:96259980-96260002 GTACATAGGAAGTATGTACCGGG + Intergenic
1132905296 16:2279322-2279344 GGACACAGGAAGGATGTGCCTGG + Intronic
1133552022 16:6865470-6865492 TTAAAAAACAAGAAGGTGCCTGG - Intronic
1133772812 16:8877484-8877506 AAAAAAAAGAAGAATGTGTCTGG + Intergenic
1133813092 16:9176546-9176568 GTAAAAAAAAAAAATGAGCCAGG - Intergenic
1134362490 16:13544645-13544667 GTAGAATAGAAGACTGGGCCAGG + Intergenic
1134475458 16:14569626-14569648 TTACAAAAGAAAAATGCTCCAGG + Intronic
1135412569 16:22246229-22246251 GTACAGAAGAAGACTGGGCATGG + Intronic
1136140649 16:28286242-28286264 CTACAAAAGACCATTGTGCCTGG + Intergenic
1138080948 16:54090992-54091014 ATACAAAAGCAGAAACTGCCAGG + Intronic
1139028778 16:62853401-62853423 TTACATATGAAGAATGTGCCAGG + Intergenic
1139156004 16:64443262-64443284 GGAGAGAAGAAGAAGGTGCCAGG + Intergenic
1140562080 16:75995254-75995276 GTAGACAAGATGAATCTGCCTGG + Intergenic
1140727534 16:77827404-77827426 GGAGCAAAGAAGAATGTGTCAGG + Intronic
1140827614 16:78721996-78722018 CTAGAAAAAAAGAAAGTGCCTGG - Intronic
1141272236 16:82551893-82551915 GCACATAAGAAAAATGAGCCCGG + Intergenic
1141817961 16:86425715-86425737 GTACAAAAAAAAAAATTGCCAGG + Intergenic
1146028824 17:29346808-29346830 CTACAAAAGAAAAATGAGCTGGG - Intergenic
1146240945 17:31225111-31225133 GTAAAAAAGGAGAAAGTGACAGG - Exonic
1146713591 17:35064195-35064217 GGAAAAAAGAACAATGAGCCTGG - Intronic
1148519694 17:48260922-48260944 GAACAGAAGAAGAATGTTCCAGG - Intronic
1150760988 17:67961549-67961571 GTTCAAAAGAAAAAAGTGCTGGG + Intronic
1151753345 17:76055115-76055137 GTACAAAAAAAAAATTAGCCGGG - Intronic
1154199702 18:12290698-12290720 ATACAAAAGAAAAATAGGCCAGG + Intergenic
1154980859 18:21501099-21501121 ATGAAAAAAAAGAATGTGCCCGG + Intronic
1155308419 18:24501173-24501195 GAACAAAAGAGGACTGTGCAGGG - Intergenic
1156385482 18:36600869-36600891 GCTCAAAGGAAGAATGTGCAGGG - Intronic
1156607689 18:38687557-38687579 GTACAAAAGAAGAACTTACAGGG + Intergenic
1156876362 18:42018400-42018422 GTACAAAAGTATAATGTTCTTGG + Intronic
1157803514 18:50640360-50640382 GTAAACAAGAAGAATGTCCTGGG - Intronic
1161078203 19:2296791-2296813 TTAAAAAAGAAGAATAGGCCGGG + Intronic
1161435469 19:4260127-4260149 GTAAAAAAGTAGAAGGGGCCGGG + Intronic
1162537327 19:11270827-11270849 ATACAAAAAAAAAATTTGCCGGG - Intergenic
1163516791 19:17769417-17769439 ATACAAAAGAAAAATTAGCCGGG + Intronic
1163585100 19:18159598-18159620 ATACAAAAAAAAAATGAGCCAGG - Intronic
1164182876 19:22834663-22834685 TTTCAAAGGAAGAATATGCCAGG - Intergenic
1164606059 19:29598866-29598888 TTACAAAGGAAGAGTGTGGCTGG + Intergenic
1165651685 19:37496537-37496559 GTAGAAAAAAAAAATGGGCCAGG - Intergenic
1166574039 19:43820122-43820144 GTCAAAAAGAAGAAAGTGCTTGG - Intronic
1166668535 19:44696033-44696055 GTCAAAAAGAATAATGGGCCAGG + Intergenic
1166972295 19:46577315-46577337 GTATAAAACAACAATGGGCCAGG + Intronic
1167220622 19:48196179-48196201 GGTCAAAAGAAGAAGGGGCCTGG + Intronic
1167751550 19:51383547-51383569 GCACAAGAGAAGAATGGCCCCGG - Intronic
1167789365 19:51663512-51663534 GGAGAAAAGAAGAATGAGGCCGG - Intergenic
1202640153 1_KI270706v1_random:75516-75538 GTACAAAAAAAAAATTAGCCTGG - Intergenic
925381850 2:3433647-3433669 ATAGAAAAGAGAAATGTGCCAGG - Intronic
926209492 2:10859113-10859135 GGACAAAAGTAAAATGTGCTGGG - Intergenic
926422090 2:12709912-12709934 GGACAAAAGGAGAAAGTGCAGGG + Intergenic
927360936 2:22232430-22232452 CTACAAAAGAAAAATTAGCCAGG + Intergenic
927707815 2:25307758-25307780 GCAGAATAGAAGAATGGGCCAGG - Intronic
928419928 2:31130456-31130478 GGACAGAAGAAGAATGTGAAGGG + Intronic
931286363 2:60835189-60835211 ATACAAAAAAACAATGAGCCAGG + Intergenic
933205840 2:79506824-79506846 GTACAAAACCACCATGTGCCTGG - Intronic
933610007 2:84423894-84423916 TTACAGAAGAAAAATGTACCAGG + Intronic
934032553 2:88061393-88061415 ATACAAAAAAAGAAGGTGCCTGG + Intergenic
934585490 2:95489378-95489400 GTACAAAAGAAAAAAGTGATTGG + Intergenic
934593666 2:95583416-95583438 GTACATGAGCAGAATGTGCAGGG + Intergenic
934593976 2:95587378-95587400 GTACAAAAGAAAAAAGTGATTGG - Intergenic
935906901 2:107849525-107849547 GTACAAAAAAAAAATTAGCCAGG - Intronic
936784943 2:116083553-116083575 ATACAAAGTAAGAATGTGACTGG - Intergenic
936972958 2:118192305-118192327 GTACTAAAAGAGAATGTGACAGG + Intergenic
938412512 2:131076490-131076512 GTACAAAAAAAAAATTAGCCGGG + Intronic
938753376 2:134356803-134356825 GTCTAAAAGAAGAATGTTCCAGG - Intronic
938946650 2:136218234-136218256 CTACAATAGAAGGATGTGCTGGG - Intergenic
939859240 2:147397811-147397833 GTAAAAAATAAGAAGATGCCAGG - Intergenic
941586599 2:167366910-167366932 GCACAAAGGCAGAAGGTGCCAGG + Intergenic
941670612 2:168288581-168288603 GTACAAAAAAATAATTAGCCAGG - Intergenic
941720210 2:168804472-168804494 GTACAAGCTAAGAATGTGCCAGG - Intronic
943270578 2:185797345-185797367 GCAAAAAAGAAGAATCTTCCCGG - Exonic
943838494 2:192546896-192546918 GCACTAAAGAAGAATGTGGAGGG - Intergenic
944127731 2:196313456-196313478 GTAAAAAATAAGAAAGTTCCAGG - Intronic
944302549 2:198140146-198140168 TTAAAAAAGAAGTATGGGCCAGG - Intronic
944675028 2:202028296-202028318 ATACAAAAGAAAAATTAGCCAGG + Intergenic
945958111 2:216105215-216105237 GTGCAAAAGACAAATCTGCCAGG + Intergenic
946610317 2:221450791-221450813 GTATAAAAACAGCATGTGCCTGG + Intronic
946740391 2:222795485-222795507 GCACAAAAAAAGAATTTGGCAGG - Intergenic
947161925 2:227223581-227223603 ATACAAAAGAAAAATTAGCCGGG + Intronic
947598586 2:231430219-231430241 GTCCAGAAGAAGAATGTCCCAGG + Intergenic
947679726 2:232019385-232019407 GTACAAAATAAAAATCAGCCAGG + Intronic
948684885 2:239664293-239664315 GTCCCAAAGAAGGATGAGCCAGG + Intergenic
1168968868 20:1917188-1917210 TTATAAAAGGAGAAAGTGCCAGG - Intronic
1169070051 20:2720389-2720411 AAAGAAAAGAAGAATGGGCCGGG - Intronic
1169077624 20:2771073-2771095 CTACAAAAGAAAAATTAGCCAGG + Intergenic
1170902717 20:20481446-20481468 TGACAAATGAAGAATGTGCGTGG + Intronic
1173026128 20:39309237-39309259 GTCCAAAAGTGGAAGGTGCCAGG - Intergenic
1174409761 20:50327250-50327272 ATACAAAAAAAAAATTTGCCAGG - Intergenic
1175139664 20:56850990-56851012 TTCCAAGAGAAGAATGTTCCAGG - Intergenic
1176453865 21:6890668-6890690 TTAAAAAAGAGGAATGGGCCAGG - Intergenic
1176642568 21:9319945-9319967 GTACAAAAAAAAAATTAGCCAGG + Intergenic
1176832040 21:13755716-13755738 TTAAAAAAGAGGAATGGGCCAGG - Intergenic
1177185793 21:17794768-17794790 TTAGAAAAGAAAAATGTGGCTGG + Intronic
1178156509 21:29860021-29860043 TTACAAAGGAAGAAAGTGCAGGG + Intronic
1178711899 21:34924553-34924575 GTACAAACGAAGAAGGTGTTTGG + Intronic
1180746317 22:18091475-18091497 ATACAAAAAAAAAATGAGCCGGG + Exonic
1181667435 22:24407818-24407840 AGACAAATGAAGAATGGGCCAGG - Intronic
1184388494 22:44189614-44189636 ATACAAAAAATGAGTGTGCCTGG + Intronic
1185378037 22:50491419-50491441 GTACAAAAAAAAAATTAGCCAGG - Intergenic
949916204 3:8966577-8966599 GTACAGTAGAAGAAGGTGACAGG + Intergenic
949919465 3:8989823-8989845 CTGCAAGAGAAGAATGTTCCAGG - Intronic
951196257 3:19827046-19827068 ATACAATAAAAGAATGGGCCGGG + Intergenic
951609753 3:24479139-24479161 ATACAAAAAAAAAATTTGCCTGG + Intronic
952055577 3:29440960-29440982 GTAAATAAGAAAAATGTGACTGG + Intronic
952331672 3:32369151-32369173 ATACAAAAAAAAAATGAGCCGGG + Intronic
952331954 3:32371837-32371859 GTACCAATGAAGAATGTTCTGGG + Intergenic
952777520 3:37060596-37060618 GTACAAAAAAAAAAAGGGCCGGG - Intronic
953760190 3:45680609-45680631 GTACAAAAAAAAATTGTGCCAGG - Exonic
955932408 3:64070850-64070872 GTCCAAATGAAGTATGTGACAGG + Intergenic
956443237 3:69300685-69300707 GCACAAAAGATGAAAGTGCAAGG + Intronic
956449811 3:69363140-69363162 TTACGTAAGAAGAATGGGCCGGG - Intronic
957154768 3:76533813-76533835 GTCCAGGAGAAGAATGTCCCAGG + Intronic
957155385 3:76537916-76537938 GTCCAGGAGAAGAATGTCCCAGG + Intronic
957188631 3:76976757-76976779 GTGCAAAATAAGAATGTGTTTGG - Intronic
958846391 3:99269936-99269958 GTACAAAAGAAGCATTTGTGAGG - Intergenic
960290964 3:115883782-115883804 TTACAAAAGAAGAATGAATCAGG + Intronic
960596224 3:119410478-119410500 GCACAAAAGAACCATGTGCTGGG + Intronic
962684419 3:137833347-137833369 GGGCAAAAGAAGAATGTTCCTGG - Intergenic
963467106 3:145697484-145697506 GTACAAAGGAAAAATGTGGTGGG + Intergenic
964236489 3:154536189-154536211 GAAAAAAAGAAGAAGTTGCCGGG - Intergenic
964392619 3:156213376-156213398 CTACAAAAGAAAAATTAGCCAGG - Intronic
964577789 3:158194439-158194461 GCACAAAAGAAGAATGTCATGGG - Intronic
965868409 3:173235378-173235400 GTACAAAAGTCAAATATGCCAGG - Intergenic
966558994 3:181297767-181297789 GAAAAAAAGAAGAATGTTCCTGG - Intergenic
966931761 3:184679728-184679750 TTACAAAAGAAAAATGGGCCGGG + Intronic
967828891 3:193901932-193901954 GTACAAAAGCACAATATGCCAGG - Intergenic
1202744317 3_GL000221v1_random:85073-85095 GTACAAAAAAAAAATTAGCCAGG - Intergenic
968748090 4:2371268-2371290 GTACAAAAGAAGAATGTGCCAGG - Intronic
968844441 4:3032186-3032208 GTGAAAAAGCAGAATGGGCCGGG + Intronic
970451910 4:16177126-16177148 GTAGAAGAGAAGAATTTGACTGG + Intronic
970698350 4:18704942-18704964 CTACAAAAGAAAAATGAGCTAGG - Intergenic
970906019 4:21217413-21217435 GCACAAAAGAAGAATTTTCAAGG + Intronic
970988427 4:22185284-22185306 GTACAAAAAAAAAATTAGCCGGG + Intergenic
972320276 4:37966928-37966950 GTCAACAAGAAGAATGTGCCTGG - Intronic
972508382 4:39743306-39743328 ATAAAAAAGAAGAATAGGCCAGG + Intronic
972663075 4:41135811-41135833 GTACTAAAGAAGCAAGTTCCAGG + Intronic
973538569 4:51910096-51910118 TTACAAAGGGAGAAAGTGCCTGG - Intronic
973943186 4:55931233-55931255 TTACAAAGGAAGAATGGGCAGGG - Intergenic
975070727 4:70134345-70134367 GTACAAAATGAGAATGTTGCTGG - Intronic
975576475 4:75868153-75868175 GTACAAAAAAAAAATTAGCCAGG + Intronic
978354569 4:107857980-107858002 CTACAAAAGAAGAGTAAGCCAGG - Intronic
978447881 4:108797935-108797957 GTAGAAAAGAAAAATAGGCCAGG - Intergenic
979059721 4:116042781-116042803 GTACACAGTATGAATGTGCCTGG + Intergenic
980114159 4:128663342-128663364 GAACAAAAGTAAAATCTGCCAGG + Intergenic
980520129 4:133921067-133921089 GTAAAAAAAAAAAATGTGCCTGG - Intergenic
980942975 4:139292555-139292577 GTACAAAAGAAGAAATGGGCTGG - Exonic
981316254 4:143342716-143342738 ATACAAAAAAAAAATTTGCCGGG - Intronic
981355099 4:143780850-143780872 ATACAAAAAAAGAATTAGCCAGG - Intergenic
982499240 4:156132163-156132185 TTAAAAAAGAAGAATTTCCCTGG + Intergenic
984356442 4:178665524-178665546 GTCCAAAAGAAGAATGAAGCAGG + Intergenic
985966154 5:3340096-3340118 GTACAAAAGCAGAGGGTGCACGG - Intergenic
987170359 5:15250322-15250344 GTAGAAAAGTAGAAGGAGCCTGG - Intergenic
987939919 5:24520885-24520907 ATACAAAAAAAAAATTTGCCGGG - Intronic
988207351 5:28157389-28157411 GTTCAAGAGAAAAAGGTGCCAGG + Intergenic
988491802 5:31711515-31711537 GTGCAAAAGAAGCATTTCCCTGG + Intronic
988638818 5:33018177-33018199 GTTCAAAAGAAGAATATGGAAGG + Intergenic
991277786 5:64870916-64870938 GCACAAAAGAAGAATGTAATGGG - Intronic
991348878 5:65700371-65700393 ATGAAAAAGAAGAATGAGCCGGG + Intronic
992234442 5:74694807-74694829 ATACAAAAAAAAAATGAGCCAGG + Intronic
992546031 5:77814780-77814802 GCACAAAAGCTGAAGGTGCCAGG - Intronic
992562381 5:77965481-77965503 GCTCAAAAGTAGATTGTGCCAGG - Intergenic
993110563 5:83652313-83652335 ATACAAAAGAATAAGATGCCAGG + Intronic
995134167 5:108662251-108662273 TTACAAAAAATGAATGAGCCGGG + Intergenic
997173387 5:131748534-131748556 GTACAAAACAAAAATTAGCCAGG + Intronic
998265885 5:140667454-140667476 ATACAAGAGTAGAATTTGCCTGG - Intronic
1000995431 5:167953616-167953638 ACACAAACCAAGAATGTGCCTGG - Intronic
1003587344 6:7404490-7404512 GTACATGAGAAGAATGTATCAGG + Exonic
1003659524 6:8046933-8046955 TTAAAAAAGAAAAATGAGCCAGG - Intronic
1003796371 6:9609722-9609744 GTTCAAAAGGAAAATGTGCTGGG + Intronic
1005244411 6:23865475-23865497 GTACAAAAAAAAAATTTGCTAGG + Intergenic
1005294590 6:24412998-24413020 AGACAAAAGAAAAGTGTGCCAGG - Intronic
1005635811 6:27752242-27752264 GTACCAAAGAAAAATGTTCATGG + Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1008236275 6:49055390-49055412 CTGAAAAAGAAGAATGTTCCAGG - Intergenic
1008311421 6:49979680-49979702 GTCCAAAAGTAGAATGTCCATGG - Intergenic
1008510345 6:52270166-52270188 ATACAAAAGAAAAATTAGCCCGG + Intronic
1009866265 6:69401418-69401440 GTACAAAAGAAAAATTTGCCAGG + Intergenic
1010114513 6:72286626-72286648 TTACAAAAGAAGAACTGGCCTGG + Intronic
1010219180 6:73432749-73432771 GTACCAAAGGAGACTGGGCCAGG - Intronic
1011471853 6:87716136-87716158 GTAAATAAAAAGAATGTGGCTGG + Intergenic
1012202101 6:96419447-96419469 ATACAAATGGAGATTGTGCCTGG - Intergenic
1014121441 6:117729841-117729863 GTACAAAAGCAGAAGCTGCCAGG + Intergenic
1014627056 6:123739189-123739211 GAAAAAAAGAAAAATATGCCTGG + Intergenic
1015809305 6:137145895-137145917 CTAGAAAAGAAGGATGTGTCTGG - Intronic
1016767125 6:147807258-147807280 GTACAAAAAAAAAATTAGCCAGG - Intergenic
1017025778 6:150179241-150179263 ATACAAAATAAAAATTTGCCAGG + Intronic
1017673902 6:156794559-156794581 AAAAAAAAAAAGAATGTGCCAGG - Intronic
1018931234 6:168241724-168241746 GTGCAAAAGCAGAAGGTGCCAGG + Intergenic
1021258446 7:18423737-18423759 GAGCAAAAGTAGAAAGTGCCAGG + Intronic
1021878106 7:25067213-25067235 GTTCAAAAGAAAAAAGTGCTGGG - Intergenic
1023308148 7:38853121-38853143 TTTCATAAGAAGAATGTGGCCGG + Intronic
1023684207 7:42718249-42718271 ATACAAAAGAAGTATGTCACTGG + Intergenic
1026257305 7:68723789-68723811 GTACAGTAGAAGAAGGTCCCTGG - Intergenic
1026908302 7:74077070-74077092 ATACAAAAGAATAAAGTGGCCGG + Intergenic
1027045161 7:74986328-74986350 ATACAAAAAAAGAATTAGCCAGG + Intronic
1027488293 7:78789022-78789044 GTTGAGAAGAAGAATGTGCAGGG - Intronic
1028179879 7:87706763-87706785 GAACAACAGACAAATGTGCCTGG + Intronic
1029080545 7:97970672-97970694 GTAGAAAAGAAGAAGAGGCCGGG - Intergenic
1029317662 7:99729080-99729102 GTCCAAAATAAGTATTTGCCTGG - Intronic
1029387644 7:100254175-100254197 ATACAAAAAAAGAATTAGCCAGG - Intronic
1029800605 7:102943235-102943257 ATAAAAATGAAAAATGTGCCGGG - Intronic
1029859651 7:103555766-103555788 GTCCAAAAAAGGAATGTGCCAGG - Intronic
1030072495 7:105710031-105710053 CTACAAAAGAAAAATTAGCCAGG - Intronic
1030991691 7:116308858-116308880 GAAAAAAAGAAGAAAATGCCCGG + Intronic
1031245918 7:119311189-119311211 ATACTAAAGAAGACTGGGCCAGG + Intergenic
1031282888 7:119826997-119827019 GTACAAAACAATAATCTGGCTGG - Intergenic
1033192956 7:139299395-139299417 GTATAAAAGAAAAAAGGGCCTGG - Exonic
1033545709 7:142398244-142398266 TTACAGAAGTAGAATCTGCCTGG + Intergenic
1033760607 7:144432875-144432897 ATACAAAAGAAAAATTAGCCGGG + Intergenic
1035481771 7:159192617-159192639 GGGCAAAGGAAGAATCTGCCTGG + Intergenic
1037874132 8:22530535-22530557 ATAAAAAGGAAGAATGGGCCGGG + Intronic
1039441479 8:37598295-37598317 TTACAGAAGAAAACTGTGCCTGG - Intergenic
1039513383 8:38109850-38109872 GTACCTAAAAAGAATATGCCAGG - Intronic
1040505526 8:48044460-48044482 TTACAAAAGAAAAATGTATCAGG + Intronic
1041504285 8:58577297-58577319 GTATAAAAGAAGAATAAGCCTGG - Intronic
1042467544 8:69145078-69145100 GTACAAAATGAGAATGAGCCTGG + Intergenic
1044166342 8:88988753-88988775 ACAGAAAAAAAGAATGTGCCTGG + Intergenic
1045337978 8:101225249-101225271 GTTGAAAGGAAGAGTGTGCCAGG + Intergenic
1045735621 8:105293281-105293303 GTAAAAAAGAAGAGTGGGCCTGG + Intronic
1047035735 8:120936881-120936903 GTACAAAACTAGGATGTGCCTGG + Intergenic
1047039230 8:120974296-120974318 GGAAAAAAGGAGAATGGGCCAGG + Intergenic
1047349572 8:124060733-124060755 GCAAAAAAGAGGAATGAGCCAGG - Intronic
1047349619 8:124061367-124061389 CTACAATGGAAGAATGTGCATGG + Intronic
1051033739 9:12717384-12717406 GTACAATAGATGATTATGCCAGG + Intergenic
1051407026 9:16748545-16748567 GAAAAAAAGGAGAATTTGCCCGG + Intronic
1053174637 9:35913041-35913063 GAACAAATGAAGAGCGTGCCGGG - Intergenic
1053254002 9:36599778-36599800 GAACAAAAGACGAAGGTTCCAGG + Intronic
1056373285 9:85980641-85980663 ATACACAAGAAGAGAGTGCCTGG - Intronic
1057810624 9:98254203-98254225 GCATCAGAGAAGAATGTGCCAGG - Intronic
1058660407 9:107261505-107261527 GTGCAAAAAAGGAAGGTGCCAGG + Intergenic
1059887278 9:118760098-118760120 GTACAAAAAAAAAATTAGCCGGG - Intergenic
1060586567 9:124790328-124790350 ATACAAAAAAAAAATGAGCCGGG - Intronic
1061181038 9:129025403-129025425 GTACAAAAAAAAAATTAGCCAGG + Intronic
1203712949 Un_KI270742v1:115022-115044 GTACAAAAAAAAAATTAGCCAGG - Intergenic
1185834515 X:3332538-3332560 CTTAAAAAGAAGAATGTGGCCGG - Intronic
1186496022 X:10013936-10013958 TTAAAAAAGAAGAATGGGCCGGG - Intergenic
1187911774 X:24118101-24118123 ATACAAAAAAAGAATTAGCCAGG - Intergenic
1188774289 X:34193885-34193907 GAAGAAAACAAGACTGTGCCTGG - Intergenic
1191199644 X:57765851-57765873 GAACAAAATAAAAATATGCCTGG + Intergenic
1191576011 X:62706752-62706774 GTGGAAAAGAAGAATATCCCCGG - Intergenic
1194420994 X:93672813-93672835 CTACAGAAGAAGAATGTGAATGG - Exonic
1194483856 X:94462256-94462278 ATACAAAAAAAAAATGAGCCAGG - Intergenic
1196705386 X:118712918-118712940 ATACAAAAAAAGAATTAGCCAGG - Intergenic
1196928573 X:120658683-120658705 GTACAAAAAAAAAATTAGCCTGG - Intergenic
1197595610 X:128460352-128460374 GTACAAAAGAAGTAAGTGCAAGG + Intergenic
1197698221 X:129573713-129573735 GTACAAAAAAAAAATTAGCCAGG - Intronic
1198127820 X:133663545-133663567 GTTCAAAAGAAAAAAGTGCTGGG - Intronic
1199893049 X:152107353-152107375 ATACATAAGAAAAATGTACCAGG + Intergenic
1202026408 Y:20528520-20528542 GTACAAAAGGAGATTATACCAGG + Intergenic