ID: 968750809

View in Genome Browser
Species Human (GRCh38)
Location 4:2387926-2387948
Sequence ATGTGGGGCCCTTTTCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 151}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968750809_968750815 16 Left 968750809 4:2387926-2387948 CCCACAGGAAAAGGGCCCCACAT 0: 1
1: 0
2: 0
3: 12
4: 151
Right 968750815 4:2387965-2387987 CAGATCTGCAGCCCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968750809 Original CRISPR ATGTGGGGCCCTTTTCCTGT GGG (reversed) Intronic
901020882 1:6254836-6254858 ATGTGGGGGCCTCTCCCTGCTGG - Exonic
903334156 1:22613899-22613921 ATGTGGGCCCCGTTGTCTGTGGG - Intergenic
904118284 1:28178093-28178115 CTGTGGGACCCTGGTCCTGTCGG - Intronic
906065944 1:42980196-42980218 AGGTGGGGCCCTTGTCCTGAAGG + Intergenic
906790449 1:48654552-48654574 AAGTGGGGCCCCGTTCCTGCTGG + Intronic
912718085 1:111996258-111996280 CTTTGGGGCTCTTTTCATGTAGG - Intergenic
913959729 1:143329034-143329056 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
914054088 1:144154607-144154629 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
914125058 1:144811758-144811780 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
918222538 1:182448702-182448724 ATCTGGTGCCCTTTTCTTTTGGG + Intergenic
920796010 1:209137538-209137560 ATGTGGGATCATTTTCCTTTAGG - Intergenic
1067018631 10:42776031-42776053 ATGTGGGGCCCTTTGGCCATAGG - Intergenic
1067222468 10:44353841-44353863 AAGTGGGGCCCTTTCACCGTGGG + Intergenic
1067536195 10:47112007-47112029 AAGTGTGGTCCTTCTCCTGTTGG - Intergenic
1074454517 10:113585786-113585808 TGGCGGGACCCTTTTCCTGTGGG - Exonic
1076042954 10:127267067-127267089 CAGTGGGGTCCTTTTCCTGCTGG - Intronic
1076199353 10:128546223-128546245 ATCTGGGACCCTCTTGCTGTGGG - Intergenic
1077128725 11:958122-958144 AGGTGGGGTCCTAATCCTGTAGG + Intronic
1077499527 11:2902884-2902906 ATGTGGGTCCCTGTGCCTGGAGG - Intronic
1077933071 11:6753782-6753804 ATATGGGGCCCCGTTCCTGGTGG + Intergenic
1079084272 11:17433973-17433995 ATCTGGGTCCCTTTTGCTGTGGG - Intronic
1079098032 11:17523391-17523413 ATGTGGGGGTCTTCACCTGTTGG - Intronic
1083897355 11:65626726-65626748 ATGTGGAGCCCTTGCCCTGCTGG + Intronic
1083921042 11:65781428-65781450 AGCTGGGGCGCTTTTCCTGCGGG - Intergenic
1085258968 11:75193465-75193487 ATGCGGTGCCCTTTGCCTGCTGG + Exonic
1096193566 12:49634879-49634901 ATACTGGGCCCTTTTCCTTTGGG - Intronic
1097756003 12:63407386-63407408 ATTAGGAGCCCTTTTCCTGGTGG + Intergenic
1097975046 12:65676420-65676442 ATGTTCGGCCCTTATACTGTTGG - Intergenic
1100169669 12:91959813-91959835 ATGGGAGGCTTTTTTCCTGTAGG + Intergenic
1101767982 12:107720938-107720960 ATGAGGGGAACTTGTCCTGTTGG - Intergenic
1103004882 12:117413230-117413252 TTGTGGGGCCCTTATTCTGTTGG + Intronic
1103030457 12:117607973-117607995 ATGTGGGGCTCCATTCCTGTTGG - Intronic
1103160114 12:118721734-118721756 AAGTGGGGTCCTATTACTGTGGG + Intergenic
1106770797 13:32959001-32959023 ATATGGGGCCCCTTTTATGTTGG - Intergenic
1119690108 14:76664966-76664988 ATCAGGGGCCCTTTTCCCTTGGG - Intergenic
1122230232 14:100303341-100303363 CTGTGGGGTCCCCTTCCTGTGGG + Intronic
1123134057 14:106011383-106011405 ATGTGGGACCCTAATCCAGTAGG - Intergenic
1123165750 14:106323752-106323774 ATGTGGGACCCTAATCCAGTAGG - Intergenic
1123423531 15:20149789-20149811 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
1123532753 15:21156310-21156332 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
1123584085 15:21741823-21741845 ATGTGGGACCCTAATCCAGTAGG - Intergenic
1123620735 15:22184426-22184448 ATGTGGGACCCTAATCCAGTAGG - Intergenic
1123777457 15:23594415-23594437 ATTAGGGGCCCTTTTCTTTTAGG - Intronic
1125327283 15:38548954-38548976 ATGTAGGGAGCTTTTCCTTTAGG + Intronic
1128048415 15:64640535-64640557 ATGCGAGGCACTTTTCCTTTTGG - Intronic
1128914012 15:71543429-71543451 ATGTGGGGCCATAGACCTGTTGG + Intronic
1129224842 15:74163146-74163168 AGCTGGGGCCAGTTTCCTGTTGG - Intergenic
1136861288 16:33705817-33705839 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1137489353 16:48918676-48918698 ATGTGGTGCCCTCTTCCTCTGGG + Intergenic
1137667199 16:50258363-50258385 AGCTGGGTCCCTTTACCTGTAGG + Intronic
1140473344 16:75226813-75226835 ATTTCCGACCCTTTTCCTGTTGG - Intergenic
1141426852 16:83949744-83949766 ATGTGGGGCACTGCTCCTGAGGG + Intronic
1203122785 16_KI270728v1_random:1554008-1554030 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1143027454 17:3949421-3949443 TTGTGGGTCAGTTTTCCTGTCGG + Intronic
1144335279 17:14263291-14263313 AAGTGGGACCCTCTTCCTCTGGG + Intergenic
1149149351 17:53541443-53541465 ATGTGGGACCCTAATCCAGTAGG + Intergenic
1153440828 18:5117459-5117481 ATATGGGGCCCTTTTACTTGTGG - Intergenic
1156848074 18:41692547-41692569 ATGTGGTGACATTTTCCAGTAGG + Intergenic
1157513399 18:48294616-48294638 ATGTGGGGACCTTACCGTGTGGG - Intronic
1158940093 18:62399808-62399830 AGGTGGAGCCCCCTTCCTGTGGG + Intergenic
1159136550 18:64343534-64343556 ATATGGGGCCCTATTCCAATAGG - Intergenic
1161340398 19:3738790-3738812 ATTTGGGGCACTCTCCCTGTAGG - Intronic
1161675212 19:5643227-5643249 CTGTGGGGCCCTTTCTGTGTTGG + Intronic
1163662913 19:18589228-18589250 CTGTGGGGCCTTTTTCGTGAAGG - Intronic
1163668850 19:18615995-18616017 AAGTGGGGCCCTCTCCCTCTTGG + Exonic
1166902975 19:46080674-46080696 ATGTGTGGCCCTGTCCCTGTTGG + Intergenic
1202693567 1_KI270712v1_random:107285-107307 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
926141425 2:10370751-10370773 ATGTGGTGCCCTGCTCCTGGGGG + Intronic
933953003 2:87347297-87347319 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
934237238 2:90243642-90243664 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
934459659 2:94206936-94206958 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
936712881 2:115153273-115153295 ATGAGGGACCAATTTCCTGTTGG + Intronic
940167377 2:150789605-150789627 ATGTGGGAGTTTTTTCCTGTTGG + Intergenic
940866326 2:158820912-158820934 ATCTGGGGGCCCTTTCTTGTTGG - Intronic
941397611 2:164992567-164992589 ATATGGGTCTCTTTTTCTGTCGG - Intergenic
941641200 2:167990679-167990701 ATGTGGGTTCTTTTTCCTGTTGG - Intronic
944492040 2:200267782-200267804 ATGTTGGGTCTTTTGCCTGTAGG - Intergenic
947883789 2:233545819-233545841 ATTTGGGACCCTTTGTCTGTGGG + Intronic
1169816177 20:9658998-9659020 ATGGGGGGCTTTTTACCTGTTGG - Intronic
1170164456 20:13346811-13346833 ATTTGGGGCCCCTTTCCAGGAGG + Intergenic
1172163585 20:32885288-32885310 ACGTGGGGCCCTTTTTCTTTTGG + Intronic
1173945365 20:46946058-46946080 ATCTGGGTCCCTTTCCCAGTGGG + Intronic
1173947172 20:46960850-46960872 CTGTGGGGCCCCTTCCCTGCTGG + Intronic
1175549314 20:59806349-59806371 GTGTGGAGGCCCTTTCCTGTGGG + Intronic
1175591406 20:60194847-60194869 ATGTGGGCCCCTGTCCCTGTTGG - Intergenic
1176386222 21:6139747-6139769 ATGAGGTGCCCTTCTCCTGCCGG - Intergenic
1179737251 21:43398505-43398527 ATGAGGTGCCCTTCTCCTGCCGG + Intergenic
1181014388 22:20060920-20060942 ATGAGAAACCCTTTTCCTGTTGG + Intronic
1181112189 22:20608695-20608717 CTGTGGGGACATTTTCCTGACGG - Intergenic
1181117960 22:20645629-20645651 GGGTGGGGCCCTTTTATTGTGGG + Intergenic
1181356536 22:22299519-22299541 AGGTGGGGAGCCTTTCCTGTTGG + Intergenic
1181713314 22:24705448-24705470 ATGCCTGGCCCATTTCCTGTTGG - Intergenic
1181740182 22:24914834-24914856 ATTTGGATCCATTTTCCTGTTGG + Intronic
1181858114 22:25797296-25797318 ATGTGGTTCCCTTTGCCTGTTGG + Intronic
1183717725 22:39543658-39543680 AGGTGGGGCCATCTTCCTGCTGG + Intergenic
1184402754 22:44283299-44283321 AGGTGGGACACTTTTCCTTTTGG - Intronic
1185000578 22:48243023-48243045 ATCTGGTGCCCTTGTCCTGAAGG - Intergenic
950864344 3:16176698-16176720 ATTTAGGTCCCTTTTCCTATAGG + Intronic
951164939 3:19474058-19474080 ATGTGGGGCATTTCTTCTGTTGG + Intronic
952250046 3:31644392-31644414 ATTTGGGGCCATTTTCCCTTGGG - Intergenic
953087331 3:39682837-39682859 ATTTGGGGCCACTTTTCTGTGGG + Intergenic
953546609 3:43868134-43868156 ATTTGGGTTCCTTTTCCTCTTGG + Intergenic
959839540 3:110958754-110958776 ATGTGTGACCCTTTTCTTCTAGG - Intergenic
960270373 3:115667607-115667629 CTCTGGGGCCCTCTTCCTGCTGG + Intronic
962918814 3:139933639-139933661 ATGTGGGGCTCTTTACCTTCAGG - Intergenic
968463485 4:737605-737627 ATGGGAGGCCCCTTTCCTTTTGG + Intronic
968750809 4:2387926-2387948 ATGTGGGGCCCTTTTCCTGTGGG - Intronic
969388922 4:6876082-6876104 TTGTGGGGCCATTTGCCTGATGG + Intronic
969624604 4:8295953-8295975 CTCTTGAGCCCTTTTCCTGTTGG + Intronic
976046439 4:80953947-80953969 ATATGGGTCCCTTTTACTTTTGG - Intronic
978810367 4:112842717-112842739 CTGTGCGGCCCGCTTCCTGTTGG + Intronic
980016922 4:127660403-127660425 ATGTGTTGTCCTTTCCCTGTTGG - Intronic
980093168 4:128463228-128463250 AGGTGGGGCCCTAATCCTATAGG - Intergenic
980905672 4:138946419-138946441 GGGTGGGGCCCTGTTCCTATAGG + Intergenic
981432269 4:144674912-144674934 AACTGGGCCCCTTTGCCTGTAGG + Intronic
986206781 5:5631923-5631945 ATTTGGGGACCTATTCTTGTGGG - Intergenic
988132565 5:27122909-27122931 ATGTGGTGTCCTGTGCCTGTAGG + Intergenic
989085456 5:37671880-37671902 TTGGGGGGGACTTTTCCTGTAGG + Intronic
990676503 5:58192211-58192233 TTGTGTGGCCATTATCCTGTGGG + Intergenic
991993547 5:72365081-72365103 ATGTGGTTCCCTTTCCCTCTGGG - Intergenic
995407519 5:111816274-111816296 ATGTAGGATCATTTTCCTGTTGG - Intronic
998037606 5:138930115-138930137 GTGTGGAGCCCTTTCCCTGGTGG - Intronic
998811533 5:145971401-145971423 ATGTGGGGCTCCCTACCTGTGGG + Intronic
999843329 5:155452168-155452190 CTGTAGGGCCCTATTTCTGTTGG + Intergenic
1002003992 5:176216922-176216944 AAGTGGAGCCCTTTTCATCTTGG + Intergenic
1002222381 5:177693718-177693740 AAGTGGAGCCCTTTTCATCTTGG - Intergenic
1002329545 5:178432197-178432219 ATGTGAGGACTTTTTCCTGAAGG - Intronic
1004249803 6:14014594-14014616 GTGAGGGGCCCTGTTCATGTTGG + Intergenic
1005686260 6:28255758-28255780 ATATGGGGCCCTACTCCTGGTGG + Intergenic
1010151772 6:72741090-72741112 ATGTCTTGCCCTTTTCCTGAGGG + Intronic
1014037785 6:116787854-116787876 ATGTGTGTCCCTTACCCTGTAGG + Intergenic
1018021741 6:159767623-159767645 AAGTGGTGCCCTTCTCCAGTAGG + Intronic
1020901504 7:14009204-14009226 ATGGGGGTCCATTTTCCTATGGG + Intergenic
1022710769 7:32847777-32847799 CTGGTGGGCCTTTTTCCTGTAGG + Intergenic
1022794218 7:33719258-33719280 AACTGGAGCCCTTTGCCTGTGGG + Intergenic
1027367074 7:77469575-77469597 ATGTGGGGCCCTAATCCCATGGG + Intergenic
1027797658 7:82714653-82714675 ATATGGGGCCCTGCTCCTGGTGG + Intergenic
1028364602 7:90012877-90012899 ATGTGGGGCCCTGTTTATCTAGG - Intergenic
1029954904 7:104628026-104628048 ATGTATGGCTCTTTTCATGTTGG + Intronic
1031690996 7:124787381-124787403 TTTTGGGGCTCTTTTCTTGTTGG - Intronic
1032190737 7:129764089-129764111 ATGTGCTGCCCTTTTCCTGAGGG - Intergenic
1034950168 7:155291511-155291533 CTGTGGGGCCCTCTTCCTCCCGG + Intergenic
1034996739 7:155582160-155582182 AAGTGAGCCCCTTTTCCTGAGGG + Intergenic
1035238168 7:157513618-157513640 AGGTGGGGCCCAATACCTGTTGG + Intergenic
1036157327 8:6354843-6354865 ATGAGGGGCCCTCCTGCTGTGGG - Intergenic
1036538207 8:9673419-9673441 ATTTGGGGCCTTTTACCTTTTGG + Intronic
1039829870 8:41204580-41204602 ATGTGAGGCTCTTTCCATGTGGG + Intergenic
1049019066 8:139941402-139941424 GGGTGGGGCCCTCTTACTGTAGG + Intronic
1049263537 8:141652809-141652831 AGGTGCAGCCCTTGTCCTGTTGG - Intergenic
1052990708 9:34518008-34518030 ATTTGGGGCCCTTGGCCTCTGGG - Intronic
1053690166 9:40582750-40582772 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1054301416 9:63383710-63383732 AGGTGGGGAGCCTTTCCTGTTGG - Intergenic
1055287780 9:74747522-74747544 ATATGGGTGCCTTTTCCTGTAGG - Intronic
1058054887 9:100439473-100439495 TTGTGGGGCTCTTTTCAAGTTGG + Intronic
1061502825 9:131013547-131013569 ATGTGCGGCCCCTGTCCTGAGGG + Intronic
1187119925 X:16395122-16395144 ATGTGGGCTCCTTTCCCTATAGG + Intergenic
1187574252 X:20537689-20537711 ATGGGGGGCACTTTTCCAGAAGG - Intergenic
1190691481 X:52916525-52916547 ATGTGGTCCCCTTTTCTTATAGG - Intergenic
1190694502 X:52939267-52939289 ATGTGGTCCCCTTTTCTTATAGG + Intronic
1194827117 X:98577355-98577377 ATGTGGGGCTTTCTTCCAGTTGG + Intergenic
1197896090 X:131317250-131317272 TTGTAGGCCCCTTCTCCTGTGGG - Intronic
1199698383 X:150359838-150359860 CTATGGGCCCCTTTTCCAGTGGG + Intergenic
1199980270 X:152916908-152916930 ACCTGGGGCACTTTTCCTGGGGG + Intronic
1200774863 Y:7161103-7161125 GTGTGGGGCCCTCATCCTATAGG + Intergenic