ID: 968751892

View in Genome Browser
Species Human (GRCh38)
Location 4:2394385-2394407
Sequence ATTGGAGCAGGTGTGGCCGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968751892_968751904 18 Left 968751892 4:2394385-2394407 CCCACGGCCACACCTGCTCCAAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 968751904 4:2394426-2394448 CCTTCACGTTGCCAGCTGACTGG 0: 1
1: 0
2: 0
3: 1
4: 72
968751892_968751898 -8 Left 968751892 4:2394385-2394407 CCCACGGCCACACCTGCTCCAAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 968751898 4:2394400-2394422 GCTCCAATGCCTGGACCTGGAGG 0: 1
1: 0
2: 2
3: 15
4: 215
968751892_968751899 -7 Left 968751892 4:2394385-2394407 CCCACGGCCACACCTGCTCCAAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 968751899 4:2394401-2394423 CTCCAATGCCTGGACCTGGAGGG 0: 1
1: 1
2: 6
3: 21
4: 177
968751892_968751907 26 Left 968751892 4:2394385-2394407 CCCACGGCCACACCTGCTCCAAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 968751907 4:2394434-2394456 TTGCCAGCTGACTGGCAAAGGGG 0: 1
1: 0
2: 1
3: 15
4: 143
968751892_968751905 24 Left 968751892 4:2394385-2394407 CCCACGGCCACACCTGCTCCAAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 968751905 4:2394432-2394454 CGTTGCCAGCTGACTGGCAAAGG 0: 1
1: 0
2: 0
3: 7
4: 65
968751892_968751906 25 Left 968751892 4:2394385-2394407 CCCACGGCCACACCTGCTCCAAT 0: 1
1: 0
2: 0
3: 12
4: 138
Right 968751906 4:2394433-2394455 GTTGCCAGCTGACTGGCAAAGGG 0: 1
1: 0
2: 1
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968751892 Original CRISPR ATTGGAGCAGGTGTGGCCGT GGG (reversed) Intronic