ID: 968752444

View in Genome Browser
Species Human (GRCh38)
Location 4:2397020-2397042
Sequence CAGGGGCGACTGCCACGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968752431_968752444 24 Left 968752431 4:2396973-2396995 CCGGGTGGGGCAGGACAGGAGCC 0: 1
1: 0
2: 8
3: 46
4: 318
Right 968752444 4:2397020-2397042 CAGGGGCGACTGCCACGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 165
968752436_968752444 3 Left 968752436 4:2396994-2397016 CCAGGGCAGAAGGAAGGACTCCG 0: 1
1: 0
2: 2
3: 14
4: 199
Right 968752444 4:2397020-2397042 CAGGGGCGACTGCCACGGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968752444 Original CRISPR CAGGGGCGACTGCCACGGCC GGG Intronic