ID: 968754172

View in Genome Browser
Species Human (GRCh38)
Location 4:2406487-2406509
Sequence GTTTCCCCACAGGGAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 430
Summary {0: 1, 1: 1, 2: 5, 3: 35, 4: 388}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968754172_968754179 21 Left 968754172 4:2406487-2406509 CCATCCCCTCCCTGTGGGGAAAC 0: 1
1: 1
2: 5
3: 35
4: 388
Right 968754179 4:2406531-2406553 CGCCGTGCTTACCTGATACAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
968754172_968754178 20 Left 968754172 4:2406487-2406509 CCATCCCCTCCCTGTGGGGAAAC 0: 1
1: 1
2: 5
3: 35
4: 388
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968754172 Original CRISPR GTTTCCCCACAGGGAGGGGA TGG (reversed) Intronic
900392198 1:2438563-2438585 GGGTGCCCACAGGAAGGGGAGGG + Intronic
900419134 1:2548025-2548047 GTTTTCCCAGGGGGAGGGGAGGG + Intergenic
900437457 1:2638165-2638187 GTGTACTCCCAGGGAGGGGAAGG + Intronic
900691556 1:3983537-3983559 GTTTCCCCACAACGAGAGGGCGG + Intergenic
900694097 1:3999597-3999619 GATACGCCACAGAGAGGGGAGGG + Intergenic
900694142 1:3999774-3999796 GATACGCCACAGAGAGGGGAGGG + Intergenic
900845915 1:5100583-5100605 GCTCCCCCACAGTAAGGGGATGG - Intergenic
901775845 1:11560096-11560118 GGTGCCACAGAGGGAGGGGAGGG - Intergenic
901854048 1:12032721-12032743 GTTTCTCCAGAGAGAGGGAAAGG - Intergenic
901930705 1:12595077-12595099 GTTTACGCAGAGGGAGGGGAGGG + Intronic
902578148 1:17391556-17391578 GTTTCCCTTCAAGGAAGGGATGG + Intronic
902662143 1:17912588-17912610 GTTTCCCCACAGGGGGGATTAGG - Intergenic
902664154 1:17925858-17925880 TTCTCCCCACAGAGGGGGGAGGG + Intergenic
903499957 1:23795293-23795315 GTTTCCCCACACTGGGGGGCTGG + Exonic
904418531 1:30377089-30377111 TTTCCCCCACTGAGAGGGGAGGG - Intergenic
905222967 1:36461536-36461558 GTCTCATCACAGGGAGGGCAAGG + Intronic
905404126 1:37721835-37721857 GTTTCCCCACAGGGCGGTTTGGG - Exonic
906011707 1:42533096-42533118 CTTTCCCCACTGGGTGGGGTTGG + Intronic
907296767 1:53460545-53460567 GTTTCCCCACGTGCAGGTGAGGG + Intronic
908561099 1:65307959-65307981 GTTTCCCCAGAAGGACTGGAAGG + Intronic
909601289 1:77464273-77464295 GGTTCCACACAGGAAGAGGAGGG + Intronic
910814068 1:91271017-91271039 GTTTCCTCAAAGGAAAGGGAGGG - Intronic
913030938 1:114902086-114902108 GCTTCCCAACGGGGAGGGGAGGG + Intronic
914991759 1:152504974-152504996 GTTTTCCCAGATGGAGAGGATGG - Intergenic
915465807 1:156097265-156097287 GATTCACCACAGGAAAGGGAAGG + Intronic
915597608 1:156904460-156904482 CTTTCCATACAGGGAGGAGAGGG + Intronic
915672875 1:157504847-157504869 GGTTCCACACAGGAAGAGGAGGG - Intergenic
916324321 1:163540269-163540291 GGTTCCACCCAGGAAGGGGAAGG - Intergenic
916470885 1:165121088-165121110 GTTTCCCAAGAGGCAGGGGCAGG - Intergenic
917076747 1:171214038-171214060 GTTTCCACACGGGAAGAGGAGGG + Intergenic
917077295 1:171218658-171218680 GGTTCCACACAGGAAGAGGAGGG + Intergenic
917371311 1:174297421-174297443 GGTTCCACACAGGAAGAGGAAGG + Intronic
917591763 1:176483429-176483451 GTTTCACCTAAGGGAGGAGAAGG - Intronic
917976961 1:180245878-180245900 GTTTCCACCCAGTGAGGGCATGG - Intronic
918641662 1:186848382-186848404 GTTTGACCATAGGCAGGGGAGGG + Intronic
919976329 1:202615400-202615422 GTGACCCCACATGGATGGGAAGG - Intronic
920502160 1:206492301-206492323 GTGTTCACACAGGCAGGGGATGG - Exonic
920915429 1:210254383-210254405 GGTTCCCCCCAGGGAGCAGAAGG - Intergenic
922597335 1:226824114-226824136 CTGGCCCCACAGGAAGGGGAAGG + Intergenic
922753005 1:228079731-228079753 GTTCCCCAAGAGGGAGGGCAGGG + Intergenic
923003851 1:230029409-230029431 GGTGCCACACAGGAAGGGGAGGG + Intergenic
923380997 1:233417700-233417722 ATGTCCTCACAAGGAGGGGATGG - Intergenic
923913841 1:238481357-238481379 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1064352214 10:14586572-14586594 GTATCCCCACATGGTGGAGAGGG - Intronic
1069103690 10:64356587-64356609 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1070457779 10:76633969-76633991 GAATACCCAAAGGGAGGGGAAGG - Intergenic
1070949713 10:80421178-80421200 GCTTCTTCACAGGGAGGGGCTGG - Intronic
1071012216 10:80952603-80952625 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1071012610 10:80955613-80955635 GGTTCCACACAGGAAGAGGATGG + Intergenic
1071843235 10:89494865-89494887 GTTTTCTTCCAGGGAGGGGAAGG - Intronic
1073009241 10:100347084-100347106 ATTTCCCCAGAGGCAGGGGCAGG + Intergenic
1073094462 10:100971317-100971339 GTGCCTCCACAGGGAGGGGTGGG + Intronic
1073249935 10:102115046-102115068 CTTTCCTCTCAGGGAGGGGGCGG - Intronic
1073574744 10:104612969-104612991 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1074127706 10:110542940-110542962 GTTTCCCCACAGGCAGGGGCAGG + Intergenic
1074186982 10:111106150-111106172 GTTTCCCCGGTGGGAGGGCATGG + Intergenic
1074973446 10:118562058-118562080 GTTTCCCCACTGGTAGAGAAAGG + Intergenic
1075195837 10:120358406-120358428 TTTTCCCCAGAGGATGGGGAGGG + Intergenic
1076405951 10:130212673-130212695 GGGTCCCCAGTGGGAGGGGAGGG - Intergenic
1076566953 10:131405322-131405344 GCCTCCCCACAGGGAGCAGAGGG - Intergenic
1077061288 11:618943-618965 GTGTCCCCACCGGGAGTGGCTGG + Exonic
1077354343 11:2108261-2108283 CTTTCCCCAGAGGGAGTGAAGGG + Intergenic
1078510270 11:11979625-11979647 GTTTCCTCACAGGCAGAGAAGGG + Intronic
1079906088 11:26248977-26248999 ATTTCCACAGAGGCAGGGGATGG - Intergenic
1080941255 11:36921322-36921344 GTTTCCACACAGGAAGAGGAGGG + Intergenic
1082659793 11:55895635-55895657 GTTTCCACCCAGGAAGAGGAGGG - Intergenic
1083707906 11:64529403-64529425 GTTTCCTCCCAGGGACTGGAGGG + Intergenic
1084157457 11:67322107-67322129 GTTCTCCCACTGGGTGGGGAAGG + Intronic
1084442273 11:69181403-69181425 GTTTCCCCACAGGCATGGCTTGG - Intergenic
1086015915 11:82167327-82167349 GTTTCAGCACAGGGAGGGGAAGG + Intergenic
1087840112 11:102911802-102911824 GTTTCCGCACAGGAACAGGAGGG - Intergenic
1089492419 11:118892344-118892366 GCACCCCCACAAGGAGGGGATGG - Intronic
1090972066 11:131652695-131652717 GCTGCCCAACAGGCAGGGGAGGG - Intronic
1091188590 11:133669872-133669894 GTCTGCCCACAGAGAGGGAAGGG + Intergenic
1091728103 12:2859312-2859334 GATTCAACACAGGGAGAGGAGGG - Exonic
1092587350 12:9912731-9912753 GGTTCCACACAGGAAGAGGAGGG + Intronic
1093983109 12:25497278-25497300 GGTTCCACACAGGAAGAGGAGGG - Intronic
1094390103 12:29939854-29939876 GTTTCAACACAGGAAGAGGAGGG + Intergenic
1095145907 12:38725934-38725956 GTTTCCCCACAGATGGGGGTGGG + Intronic
1095833760 12:46615164-46615186 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1096575658 12:52551289-52551311 GTCTGCCCAGAGGGAGGGGAAGG - Intronic
1098106176 12:67070049-67070071 GTTTCCTGGCAGGGTGGGGAGGG + Intergenic
1098436877 12:70476983-70477005 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1099534521 12:83827871-83827893 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1102006288 12:109591118-109591140 GTTTCCCCAGAGGATGGGCACGG + Intronic
1102573745 12:113843319-113843341 GCTGCCCCACAGAGAAGGGATGG + Intronic
1104956751 12:132470531-132470553 GTTATCCCACAGGGAGGGAAAGG + Intergenic
1104956817 12:132470798-132470820 GTTATTCCACAGGGAGGGAAAGG + Intergenic
1106014003 13:25850954-25850976 GTTTCCCTACAGGGTGTGCAGGG + Intronic
1106396625 13:29386886-29386908 CTTTCCACTCACGGAGGGGAGGG + Intronic
1107911414 13:45108877-45108899 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1109745503 13:66618048-66618070 GTTTCCACCCAGGAAGAGGAGGG - Intronic
1109917787 13:69014760-69014782 GTTTCCTCACTGGGAGGACAGGG - Intergenic
1110257226 13:73445392-73445414 GCTTCCACACAGGAAGAGGAGGG - Intergenic
1111132527 13:83996162-83996184 GTTTCCACACAGGAAGAGGAGGG - Intergenic
1111133085 13:84000713-84000735 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1112465129 13:99637290-99637312 TTTTCAACACAGGGAGAGGAGGG - Intronic
1112549169 13:100403801-100403823 GGTTCCACACAGGAAGAGGAGGG + Intronic
1115475882 14:33812307-33812329 GTTCCCCACCAGGGAGGGGATGG - Intergenic
1116055824 14:39862722-39862744 GGTTCCACACAGGGAGAGGAGGG + Intergenic
1117086162 14:52203593-52203615 GTTTCCCAAAAGGCAGGGAATGG - Intergenic
1117979752 14:61330707-61330729 GTTTCATAACAGGGAGTGGAGGG - Intronic
1118929115 14:70223739-70223761 GTTACCGCACAGGAACGGGAGGG + Intergenic
1120185769 14:81392304-81392326 GGTTCCACACAGGAAGAGGAGGG - Intronic
1120477065 14:85001902-85001924 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1120571944 14:86129627-86129649 GATTCCACACAGGAAGAGGAGGG - Intergenic
1121610199 14:95273398-95273420 GATTCCTCACAGGGAGAAGAAGG + Intronic
1121824138 14:96996851-96996873 GCTTCCCACCAGGGATGGGAAGG - Intergenic
1122182630 14:99967165-99967187 GGTTCCACGCAGGAAGGGGAGGG - Intergenic
1122303117 14:100743161-100743183 GTTACTCCACAGTGAGTGGATGG - Intergenic
1122783238 14:104152559-104152581 GCTTCCCTGAAGGGAGGGGACGG + Intronic
1122916845 14:104863426-104863448 CTTTCTCGACAGGGAGGGGGAGG - Intergenic
1122961125 14:105093978-105094000 GGTTCCCGGCAGGGCGGGGAAGG + Intergenic
1123135808 14:106026674-106026696 GATTCCCCACAGTAATGGGAGGG + Intergenic
1123165160 14:106319379-106319401 GATTCCCCACAGTAATGGGAGGG + Intergenic
1124491977 15:30163751-30163773 GTGACCCCACATGGATGGGAAGG - Intergenic
1124751560 15:32374566-32374588 GTGACCCCACATGGATGGGAAGG + Intergenic
1125516294 15:40323242-40323264 GTTTATCCTCTGGGAGGGGACGG - Intergenic
1125745511 15:41994903-41994925 GTTCCCCCACAGGGAGGCCAGGG - Intronic
1128511466 15:68316306-68316328 GTTTCCCCACCGCGGGGCGAAGG - Intronic
1131872306 15:96775493-96775515 GTTTTGCCAAAGGGAGGGGCTGG - Intergenic
1132542778 16:519067-519089 GCTGCCCCACAGGCAGGGCATGG - Intronic
1132775062 16:1588920-1588942 GTGTCCCCACAGGGCAGGGAGGG - Intronic
1135077630 16:19407731-19407753 GTTTCCACACAGAAAGAGGAGGG + Intergenic
1135106197 16:19652001-19652023 GATGCCCGCCAGGGAGGGGATGG - Exonic
1138186201 16:54979482-54979504 GTTTTACCACAGGGAGGGGGAGG + Intergenic
1138219620 16:55239855-55239877 ACATCCCCACAGGGTGGGGAAGG - Intergenic
1138353236 16:56357846-56357868 GTTCCCCCACAGTGGGAGGATGG + Intergenic
1139530389 16:67539782-67539804 GTTGGCTCACAGGGAGGGTAAGG + Intronic
1139652932 16:68371598-68371620 GTGTCACCACAGGGCGGCGATGG - Exonic
1140305890 16:73802304-73802326 GTGACTCCACAGGGAAGGGAGGG + Intergenic
1140740425 16:77936676-77936698 GGTTCCACACAGGAAGAGGAGGG + Intronic
1140914278 16:79480805-79480827 GTTTTCCCAGAGGAAGGGAATGG - Intergenic
1141614690 16:85203453-85203475 GTGGCCCCTCAGGGAGGGGTTGG + Intergenic
1141689478 16:85588176-85588198 GATTCCCCACCAGGAGGGCAGGG + Intergenic
1142406791 16:89894460-89894482 CTTTTCCCACAGGGAGATGACGG - Intronic
1142595235 17:1026654-1026676 GTTTCTCCCCAGGGTGGGGCAGG + Intronic
1142872151 17:2827947-2827969 GCTCCCCCACAGGGAAGGGCTGG - Intronic
1143606351 17:7988621-7988643 GTTTTGCCACAATGAGGGGAGGG + Intergenic
1143606827 17:7991789-7991811 GTTTTGCCACAATGAGGGGAGGG - Intergenic
1143672267 17:8405031-8405053 CTGTCCCCACAGGGAGTGGCAGG - Intergenic
1145276595 17:21435161-21435183 GTTCCCATACAGGGAGGGGCAGG - Intergenic
1145314435 17:21721049-21721071 GTTCCCATACAGGGAGGGGCAGG - Intergenic
1145712891 17:26993026-26993048 GTTCCCATACAGGGAGGGGCAGG - Intergenic
1146039025 17:29433687-29433709 GGTTCCACACAGGAAGTGGAGGG + Intronic
1146277150 17:31523168-31523190 GCTTCCCCACTGGAAGAGGAGGG + Intronic
1147215451 17:38896462-38896484 CTTCCCCAACAGGGAGGGGGAGG + Intronic
1148442869 17:47720822-47720844 GTCTCCTCACAGGGAGGCGGAGG + Intergenic
1148603445 17:48910572-48910594 GTTTCCTCAGGGGGAGGGGAGGG - Intronic
1148685248 17:49497154-49497176 GTTTCCCAGCAGGGCGGGGGGGG + Intronic
1149094964 17:52828789-52828811 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1149660648 17:58332523-58332545 GGTTCCCTTCAGGGAGGGCAGGG + Intergenic
1149691615 17:58581889-58581911 TTTTCCCCACCAGGAAGGGAAGG - Intronic
1149789278 17:59463225-59463247 TTTCCTCCCCAGGGAGGGGATGG - Intergenic
1150213615 17:63454969-63454991 GGGGACCCACAGGGAGGGGAGGG - Intergenic
1150791060 17:68200478-68200500 TTTAGCCCAAAGGGAGGGGATGG + Intergenic
1151100484 17:71550737-71550759 ATTTCCTCACAGTGTGGGGAAGG + Intergenic
1152383266 17:79953201-79953223 GTTTCCCTACAGCGTGGGGCTGG + Intronic
1152554043 17:81044237-81044259 GTGCCTTCACAGGGAGGGGATGG + Intronic
1152577519 17:81149383-81149405 GGTTTCCCACAGGCCGGGGAGGG - Intronic
1152635595 17:81429378-81429400 GAACCCCCGCAGGGAGGGGAGGG - Intronic
1155593448 18:27454425-27454447 GGTTCCGCACAGGAAGAGGAGGG + Intergenic
1156454403 18:37284945-37284967 TTTTCCCCCCAGGCAGAGGAGGG + Intronic
1156698996 18:39800307-39800329 AGTTCCACACAGGAAGGGGAGGG + Intergenic
1157196594 18:45624838-45624860 GTTTCCTGGGAGGGAGGGGATGG + Intronic
1158772261 18:60533218-60533240 ATTTCCCCACAGGGACAGTACGG - Intergenic
1159109840 18:64043250-64043272 GGTAGCCCACGGGGAGGGGAGGG - Intergenic
1160185222 18:76671154-76671176 CCTACCCCCCAGGGAGGGGAGGG + Intergenic
1160228728 18:77030383-77030405 GCCTCCACACAGGGACGGGAAGG + Intronic
1161161318 19:2763151-2763173 GTCTCCCCAGAGGCTGGGGAGGG - Intronic
1161805423 19:6440652-6440674 GTTTCCCCACAGGGCTGGGAGGG + Exonic
1163612687 19:18309410-18309432 GTTTCCCCTCTGAGAGGGTATGG - Intronic
1164820941 19:31250946-31250968 GTCTGACCACAGGGAGGGGCAGG + Intergenic
1165138145 19:33683795-33683817 CTTTTCCCACAGTGAGGGAAGGG + Intronic
1166586325 19:43952213-43952235 ATTTCCACAGAAGGAGGGGAGGG + Intronic
1167490797 19:49791923-49791945 GTGTCCCCACAGGGACAGCATGG + Exonic
1168494605 19:56838846-56838868 GGTTGTCCACAGGGAGGGGCGGG - Intronic
927993210 2:27462783-27462805 TTTCCCCCACAGGGCGGAGAAGG - Exonic
930136689 2:47909107-47909129 GTTTCCACCCTGAGAGGGGATGG + Intergenic
930305056 2:49666606-49666628 GAGTTCCCACAGGGAGGGCAAGG - Intergenic
931213203 2:60216770-60216792 GTTTCCCCACAGGTAACAGAAGG + Intergenic
932941269 2:76169475-76169497 GTTTTCCCACTGGGAGCAGATGG + Intergenic
933723092 2:85410458-85410480 GTCCCCCGACAGGGAGGGGCAGG + Exonic
933914460 2:86974424-86974446 GTTTACACACAGGAAGGGGCAGG - Exonic
934008533 2:87795475-87795497 GTTTACACACAGGAAGGGGCAGG + Exonic
934663199 2:96154034-96154056 GTTTCCCCAGGGGCAGGGGCAGG + Intergenic
935133563 2:100279137-100279159 GTGTCACCACAGGGAGGGAGTGG - Exonic
935538911 2:104326416-104326438 GTGCTCCCACAGAGAGGGGAGGG - Intergenic
935772178 2:106436481-106436503 GTTTACACACAGGAAGGGGCAGG + Exonic
935994289 2:108751614-108751636 GTTTACACACAGGAAGGGGCAGG - Exonic
936156912 2:110053052-110053074 GTTTCCACCCAGGAAGAGGAGGG + Intergenic
936187782 2:110318392-110318414 GTTTCCACCCAGGAAGAGGAGGG - Intergenic
937153111 2:119699557-119699579 GGTTCCACACAGGAAGAGGAGGG + Intergenic
937320448 2:120957647-120957669 GTGTCCCCACAGGGCAGGAAAGG + Intronic
938723881 2:134090088-134090110 ATTTGCCCAAAGAGAGGGGAGGG + Intergenic
940851244 2:158689955-158689977 GTTGCCTCAAAGGGAGGGAAGGG + Intergenic
943834204 2:192498953-192498975 GGTTCCACACAGGAAGAGGAGGG - Intergenic
944674416 2:202023321-202023343 GGGTCCCCAAAGGGAGGTGACGG - Intergenic
944905297 2:204256163-204256185 AATTACCCGCAGGGAGGGGATGG - Intergenic
945048238 2:205800420-205800442 GCTTCCACTCAGGGAGGGGACGG + Intergenic
946146954 2:217738290-217738312 GTTTCCAAACAGGGAAGAGAAGG + Intronic
946180856 2:217948201-217948223 GATTCCCAGCAGGGAGGGGTCGG + Intronic
947533637 2:230927863-230927885 GTTTCCCCCCTTGGAGGGAAAGG - Intronic
947917436 2:233842498-233842520 GTTTACCTACATGGATGGGAAGG + Intronic
949004318 2:241636886-241636908 GTTTCCCCGCAGGGCCGGGTCGG + Intronic
949032295 2:241802836-241802858 GGTTCCCCACAGGGTGGGTCTGG - Intronic
1169027591 20:2383624-2383646 GTTTCTCCATAGTGATGGGATGG + Intronic
1169189177 20:3646510-3646532 GTTTACCCAGATGGAGGGGAAGG + Intronic
1169334025 20:4740422-4740444 GATTCTCCGCAGGGCGGGGAAGG - Exonic
1170629829 20:18057141-18057163 GTTTCCTCTCAGGGCGGGGGAGG + Intronic
1170877908 20:20267820-20267842 GGTTCCACACAGGAAGAGGAGGG + Intronic
1171971425 20:31567312-31567334 GTTACCCCAAGGGGAGGGGCAGG - Intronic
1172169287 20:32919120-32919142 GTTTCCCTACTTGCAGGGGATGG + Intronic
1172836097 20:37874101-37874123 GCGTCCCCACAGAGAGGGGCAGG + Intergenic
1173549688 20:43923940-43923962 GTTGCCCCAGATGGAGGTGAGGG + Intronic
1175388652 20:58612881-58612903 GTGTCCTCAGAGGGTGGGGAGGG - Intergenic
1175897133 20:62343166-62343188 GTTTCCCCACAGGGACCACACGG + Intronic
1176015205 20:62927280-62927302 GTTTGCCCACAGGGGTTGGAGGG + Intronic
1176024055 20:62976950-62976972 GCTTCTGCACAGGAAGGGGAGGG + Intergenic
1176108052 20:63398859-63398881 TTTGCCCCACAGGGAGGCCACGG - Intergenic
1176172158 20:63700944-63700966 GGTGTCCCCCAGGGAGGGGATGG - Intronic
1176375069 21:6082994-6083016 TATTCCCCACAGGGTGGGGGGGG + Intergenic
1177273498 21:18877547-18877569 GAGCCCCCAGAGGGAGGGGAAGG - Intergenic
1179186525 21:39089217-39089239 TTTTCCACACACGGGGGGGATGG + Intergenic
1179748406 21:43455251-43455273 TATTCCCCACAGGGTGGGGGGGG - Intergenic
1179992868 21:44957694-44957716 GTTCCCCCACAGGGAGGCCTGGG + Intronic
1180168087 21:46040436-46040458 GTGTCCCCGCTGGGTGGGGAGGG - Intergenic
1181851148 22:25750830-25750852 GTGTCCCCACAGGCACGTGAAGG + Intronic
1182551235 22:31101847-31101869 GTTTCCAAACAGAGAAGGGATGG + Intronic
1183051964 22:35270115-35270137 GGTTCCCCACAGGCCGCGGACGG - Intronic
1183059397 22:35326931-35326953 GGCTCCCCACAAGGCGGGGAGGG - Intronic
1183339770 22:37273809-37273831 CTCTCCCCACGGGGAGGGTAAGG - Intergenic
1184503714 22:44888819-44888841 GTTGTCACACAGGGAGGGGGAGG + Intronic
950524732 3:13517228-13517250 GTGCCCCCAGAGGCAGGGGATGG + Intergenic
951193789 3:19802288-19802310 GGTTCCACACAGGAAGAGGAGGG + Intergenic
951345428 3:21542732-21542754 GGTTCCACACAGGAAGAGGAGGG - Intronic
952154632 3:30629380-30629402 CTTTCCCCACTGGGAGGAGCTGG - Intronic
952192898 3:31042784-31042806 GTTTCCACACAGGAAGAGGAGGG - Intergenic
952193448 3:31047526-31047548 GTTTCCACACAGGAAGAGGAGGG - Intergenic
952485324 3:33804256-33804278 GGTTCCGCACAGGAAGAGGAGGG + Intronic
953026350 3:39147452-39147474 GCTCCCACACCGGGAGGGGAAGG - Intronic
953739667 3:45526741-45526763 GTTTGTCCACTGGGAGAGGATGG - Intronic
954906519 3:54067747-54067769 CTCTGCCCAGAGGGAGGGGATGG + Intergenic
954968664 3:54633577-54633599 GGTTCCTCACAGGAAGAGGAGGG + Intronic
955280222 3:57588155-57588177 GTTTCTGGACACGGAGGGGAGGG - Intronic
955444666 3:58996947-58996969 GATTCCACACAGGAAGAGGAGGG - Intronic
957573985 3:81986127-81986149 GTTTCCACACAGGAAGAGGAGGG - Intergenic
957952157 3:87141209-87141231 GATTCCACACAGGAAGAGGAGGG - Intergenic
957990254 3:87617799-87617821 GCTTCCACACAGGAAGAGGAGGG + Intergenic
959431059 3:106256093-106256115 GGTTCCGCACAGGAAGAGGAGGG - Intergenic
959623414 3:108423151-108423173 GGTTCCACACAGGAAGAGGAGGG + Intronic
960497666 3:118394786-118394808 GTTTCCCCACAGGGCTGGGAGGG + Intergenic
960657733 3:120024546-120024568 CTTTACCCAGTGGGAGGGGAAGG - Intronic
960992875 3:123323195-123323217 TTTGCCCAGCAGGGAGGGGAAGG - Intronic
961004677 3:123396942-123396964 GTTTCCCCAAAGTCATGGGAAGG - Intronic
962190308 3:133303303-133303325 GGATCCCCACAGGGAGCAGATGG + Intronic
964877508 3:161384812-161384834 GTTTCCCCACAGGCATTTGAGGG + Intergenic
964980398 3:162670429-162670451 GGTTCCACACAGGAAGAGGAGGG - Intergenic
965663383 3:171065539-171065561 GTTACTCTACAGGGAGGGTAAGG + Intronic
966340921 3:178924161-178924183 GATCCCCCAGAGGGAGGGGCAGG + Intergenic
966523856 3:180900264-180900286 CTTTCCACACAGGAAGAGGAGGG - Intronic
966866224 3:184260414-184260436 GTTCCGCCATCGGGAGGGGAGGG - Intronic
967055584 3:185825945-185825967 GTTTCCCGACCGGGGAGGGAAGG + Intergenic
967472954 3:189884268-189884290 GTTCCCCCACAGGGACGGAGTGG + Intronic
968287093 3:197515077-197515099 GAGTTCCCACAGGCAGGGGAGGG - Intronic
968504858 4:967044-967066 GTGTCCCCACAGGGTGGGCGTGG - Exonic
968754172 4:2406487-2406509 GTTTCCCCACAGGGAGGGGATGG - Intronic
969057639 4:4412197-4412219 GGTTCCCCACAGGGAGGAGGGGG + Intronic
969058028 4:4414134-4414156 GGTTCCCCACAGGGAGGAGGGGG + Intronic
969365684 4:6692968-6692990 GTTTCTACACAGAAAGGGGAGGG - Intergenic
969541581 4:7794064-7794086 CTTTCCCCACAGTAATGGGAAGG - Intronic
969617303 4:8261337-8261359 GTTTCGCCACAGCGATTGGAGGG - Intergenic
969630518 4:8333175-8333197 GCTGCCCAACAGGGAGGGCAGGG + Intergenic
969681994 4:8648342-8648364 GTTGCCCAAAAAGGAGGGGAGGG - Intergenic
971244477 4:24915651-24915673 GTCTCCCCACATGCTGGGGAGGG - Intronic
972542904 4:40055664-40055686 GTAACCGCAAAGGGAGGGGACGG + Intergenic
974014224 4:56634361-56634383 GGTTCCACACAGGAAGAGGAGGG - Intergenic
974674775 4:65076074-65076096 GGTTCCACACAGGAAGAGGAGGG - Intergenic
975856400 4:78629501-78629523 GTTTACATACAGGGTGGGGAAGG + Intergenic
976290764 4:83415175-83415197 CTTTACCCACAGGGAGCAGAAGG + Intronic
976345432 4:83994179-83994201 GTTTCCACACAAGGAGAGGAGGG - Intergenic
977889820 4:102296819-102296841 GTAACTCAACAGGGAGGGGAGGG + Intronic
977925201 4:102692757-102692779 TTTTCTCCAAAGGAAGGGGAGGG + Intronic
980726618 4:136769925-136769947 GGTTCCACACAGGAAGAGGAGGG - Intergenic
981652577 4:147076466-147076488 GTTTCCACACAGGAAGAGGAGGG - Intergenic
984055961 4:174929551-174929573 GGTTCCACACAGGAAGAGGAGGG + Intronic
984083596 4:175280902-175280924 GTTACCACACAGGGAGGAGAGGG - Intergenic
984432506 4:179666434-179666456 GTTTCCACACAGGAGGAGGAGGG - Intergenic
985936083 5:3099769-3099791 GTGTCCCCACGGGGTGGAGAGGG + Intergenic
986341254 5:6791219-6791241 ACTTCCCCTAAGGGAGGGGAGGG - Intergenic
986691342 5:10316311-10316333 GGTTCCACACAGGAAGAGGAGGG + Intergenic
986727784 5:10612337-10612359 GTGTCCCCACAGGGTGGAGAAGG + Intronic
987086007 5:14468444-14468466 GGTTCTCCCAAGGGAGGGGAAGG - Intronic
987155122 5:15081528-15081550 GGTTCCACACAGGAAGAGGAGGG + Intergenic
988846379 5:35131998-35132020 ATTTCCCCAGCAGGAGGGGAAGG + Intronic
988899528 5:35717691-35717713 GTTTCCACACAGGAAAAGGAGGG + Intronic
989482531 5:41948565-41948587 GTATCACCAAAGGGAGGAGAGGG - Intergenic
990178330 5:53132105-53132127 TTTTCCCCTTAGGGAGGGGTTGG - Intergenic
990568225 5:57051484-57051506 GGTTGCCCGCAGGGAGGGCAGGG + Intergenic
992442727 5:76811048-76811070 GTTTCCACACAGGAAGAGGAAGG + Intergenic
994144249 5:96374932-96374954 ATTTCCCCACAGGTAGAAGATGG + Intergenic
995393395 5:111663243-111663265 GGTTCCACACAGGAAGGCGAGGG + Intronic
995393882 5:111666978-111667000 GGTTCCACACAGGAAGAGGAGGG + Intronic
996115090 5:119609219-119609241 GTATCCCCAAAGGGAGAAGAAGG - Intronic
996558603 5:124804258-124804280 GTTTTTCCACAGGTAGGGGGAGG - Intergenic
996661520 5:126009143-126009165 GTTTCCACACAGGAAGAGGAGGG - Intergenic
997849720 5:137320417-137320439 GCTTCTCCACTGGGAGGGAAAGG + Intronic
998266077 5:140668818-140668840 CATTTCACACAGGGAGGGGAGGG - Intronic
999666380 5:153917289-153917311 GATCCCCCAGGGGGAGGGGAGGG - Intergenic
1000232633 5:159330384-159330406 GCAGGCCCACAGGGAGGGGAGGG + Intronic
1000793441 5:165634788-165634810 GCTTCCCCACAGAGAGGTGCTGG + Intergenic
1001238527 5:170050107-170050129 GTTTCCCCACAGGGAAAGGAAGG - Intronic
1001557413 5:172646248-172646270 GTTTCCTCACAGGGAGACTAGGG + Intronic
1001651643 5:173320184-173320206 CTTTCCCCAGAGTAAGGGGAGGG + Intronic
1001726672 5:173908428-173908450 GTTTTCCCCCAGGGGTGGGAAGG - Intronic
1001913068 5:175536973-175536995 GTTTCATCAGAGGGAGGGGCAGG + Intergenic
1002542715 5:179916837-179916859 GTTAATCCAGAGGGAGGGGAGGG - Intronic
1002771487 6:293539-293561 GCTTCCACACTGGGTGGGGATGG + Intronic
1003196532 6:3919954-3919976 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1003475256 6:6475748-6475770 GTATCCCTACAGGAAGAGGAGGG - Intergenic
1004485251 6:16060329-16060351 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1005043266 6:21618580-21618602 GTTTTCCAAGAGGGAAGGGAAGG - Intergenic
1006327407 6:33364961-33364983 GTTTCCCCACACTGGGGGGCTGG - Intergenic
1006511432 6:34523621-34523643 GTTTGCCCACAGGGAGTGCCAGG + Intronic
1006577311 6:35056017-35056039 CTTTGACCACAGGGATGGGAGGG + Intronic
1007273302 6:40654814-40654836 GTTTTCCCACAGACAGGGGCAGG + Intergenic
1007573817 6:42911806-42911828 GGTTCCCCCCCGGGAGGGGGAGG - Intergenic
1008125109 6:47659169-47659191 GTTTCCAGACAGGGATGGGTGGG + Intronic
1008149575 6:47934195-47934217 GGTTCCACACAGGAAGAGGAGGG - Intronic
1010229141 6:73520182-73520204 GTTTCCCCACACTGAGTGGGTGG - Exonic
1010453146 6:76026047-76026069 GGTTCCACACAGGAAGAGGAGGG - Intronic
1011369052 6:86612714-86612736 GCTTGCCCAGAGGGAGGGCAAGG - Intergenic
1011640538 6:89412558-89412580 GTCCCCGCACAGGCAGGGGAGGG + Intergenic
1012520779 6:100118694-100118716 GTTTCCACCCAGGAAGAGGAGGG + Intergenic
1013208376 6:107965115-107965137 GATTCCACACAGGAAGAGGAGGG - Intergenic
1014470534 6:121808890-121808912 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1015604001 6:134937357-134937379 GTTTCTCCACTGGGATTGGAAGG - Intronic
1015803164 6:137080915-137080937 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1016162494 6:140898413-140898435 GCTTCCACACAGGAAGAGGAGGG + Intergenic
1018359671 6:163054771-163054793 GTTTCCACACAGGAAGAGGAGGG + Intronic
1018734206 6:166675275-166675297 GCTTCCCCACTGGGAAGGGGAGG - Intronic
1018991451 6:168676916-168676938 CTTGCCCTGCAGGGAGGGGATGG - Intergenic
1019101173 6:169631503-169631525 GGCTGCCCACAGGGAGGGCACGG + Intronic
1019547825 7:1586963-1586985 GGTCCCCCTGAGGGAGGGGACGG - Intergenic
1019662408 7:2232364-2232386 GTTTCCCCTCGGGGATGGCAAGG - Intronic
1020555353 7:9663774-9663796 GATTCCACACAGGAAGAGGAGGG + Intergenic
1021054968 7:16036012-16036034 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1022400604 7:30032992-30033014 GTTTCCCCTCAGGTGGAGGAAGG + Intronic
1022807370 7:33836106-33836128 GTTTCCCAACAGGGGGGAGCTGG + Intergenic
1023063828 7:36354986-36355008 CTTTCCCAACAGGTAGGGGTGGG + Intronic
1024655154 7:51446059-51446081 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1024655459 7:51448025-51448047 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1027660396 7:80981553-80981575 TTTTCCACACAGGAAGAGGAGGG + Intergenic
1028235912 7:88361375-88361397 GATTCCACACAGGAAGAGGAGGG + Intergenic
1028524437 7:91767987-91768009 GGTTCCACACAGGAAGAGGAGGG + Intronic
1029046918 7:97639710-97639732 GTTTCCACACAGGAAGAGAAGGG + Intergenic
1029495276 7:100893092-100893114 GGGTCCCTGCAGGGAGGGGAGGG + Intronic
1030245935 7:107384426-107384448 GGTTCCACACAGGAAGAGGAAGG - Intronic
1030901098 7:115124718-115124740 GTATCCTCACATGGTGGGGAGGG - Intergenic
1032669958 7:134073751-134073773 ATTTACTCACAGGCAGGGGATGG + Intergenic
1033620958 7:143061685-143061707 GTGGCCCCACGGGAAGGGGAAGG + Intergenic
1034818561 7:154196113-154196135 GTTTCCCCACAGAGCTGTGATGG + Intronic
1035246675 7:157566840-157566862 GCGTCTCCACAGGGATGGGATGG - Intronic
1036533648 8:9622837-9622859 GTATCCCCACAGATAAGGGAAGG - Intronic
1036678232 8:10852136-10852158 GGGTCCGCGCAGGGAGGGGAAGG + Intergenic
1037319593 8:17630643-17630665 GTGCCCCAGCAGGGAGGGGAGGG - Intronic
1037765856 8:21771827-21771849 CTTTCCCCACAGAGAAGTGAAGG + Intronic
1038433038 8:27515100-27515122 GTTTCCACACAGGAGGAGGAGGG - Intronic
1038504574 8:28073482-28073504 GTTTCCTCACTCCGAGGGGATGG - Intronic
1038524843 8:28263877-28263899 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1039100873 8:33940705-33940727 GTTTCCCCTCAGGGAGTGTTTGG + Intergenic
1039105377 8:33983982-33984004 GTCTCCCATCAGTGAGGGGAAGG + Intergenic
1039352577 8:36779265-36779287 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1039596004 8:38790233-38790255 GTGTCCTCACAGGAAGGGCACGG - Intronic
1039757611 8:40540230-40540252 GGTTCCACACAGGAAGAGGAGGG - Intronic
1039824009 8:41157598-41157620 GTTTCCCCAGCTGGAGGAGAGGG - Intergenic
1039878650 8:41609402-41609424 GGTAGCCCACTGGGAGGGGAAGG - Exonic
1039898162 8:41730964-41730986 CTTACCCCACGAGGAGGGGAAGG + Intronic
1040640956 8:49333938-49333960 GCATCCACACTGGGAGGGGAGGG + Intergenic
1041376878 8:57214792-57214814 GTGTTCTCAGAGGGAGGGGACGG + Intergenic
1041583225 8:59486496-59486518 TTTCCCCCACAGAGAGAGGAGGG - Intergenic
1042200444 8:66275653-66275675 GTTTCCCTAGGGGAAGGGGAAGG - Intergenic
1042414970 8:68508950-68508972 GTTTCCACACAGGAAGAGGAGGG + Intronic
1043983059 8:86662685-86662707 GGTTCCACACAGGAAGAGGAGGG - Intronic
1044084081 8:87921897-87921919 GTGTCCTCACAGGGTGGGGCAGG - Intergenic
1046890444 8:119416222-119416244 CTTTTCCCAGAGGGTGGGGAGGG - Intergenic
1047038947 8:120971284-120971306 GTTGCCCCACAGAGAGGCAAAGG + Intergenic
1047327968 8:123858059-123858081 GTTTCCCATGAAGGAGGGGAAGG - Intronic
1047429208 8:124776154-124776176 GGGTCCCTACTGGGAGGGGAAGG + Intergenic
1049230496 8:141479051-141479073 GGGCCCCCACAAGGAGGGGAAGG - Intergenic
1049595103 8:143479786-143479808 GTCCCCCCCCAGGGAGGAGAGGG - Intronic
1049706390 8:144045102-144045124 GTTTCCCTGCTGGGATGGGAAGG - Intronic
1049861612 8:144902429-144902451 GCTTCCCCACAGGGCGGGGCTGG + Intergenic
1050510076 9:6384894-6384916 GGTTCCACACAGGAAGAGGAGGG + Intergenic
1053594232 9:39543788-39543810 GTTTCCACACAGGAAGAGGTGGG - Intergenic
1053852013 9:42298834-42298856 GTTTCCACACAGGAAGAGGTGGG - Intergenic
1054572021 9:66821169-66821191 GTTTCCACACAGGAAGAGGTGGG + Intergenic
1055686228 9:78777928-78777950 GGTTCCGCACAGGAAGAGGAGGG + Intergenic
1055785156 9:79863570-79863592 GTTTTCCAACAGGTAGGGGTGGG - Intergenic
1057582446 9:96299440-96299462 GATTCCCCACAGGGAGGGGAAGG - Intronic
1058142783 9:101375746-101375768 GGTTCCACACAGGAAGAGGAGGG - Intronic
1058439257 9:104992020-104992042 GTTTCTCCACAGAGAGTGGGTGG - Intergenic
1058941083 9:109813202-109813224 GTTTTCCCACAGGAAGTGAAAGG + Intronic
1060187910 9:121575100-121575122 GTTTCCCCAGAGAGAGGGACAGG + Intronic
1062050243 9:134443368-134443390 GTTTGCCCAAAGGGAGGCCAAGG + Intergenic
1062560380 9:137139076-137139098 GCTTCCCAACACGGAGGCGAAGG - Intronic
1062563547 9:137152547-137152569 AGGTCCCCACAGAGAGGGGAGGG + Intronic
1062629288 9:137456538-137456560 GCTTCCCAACAGGGAGGGAGAGG - Intronic
1185709991 X:2296329-2296351 TCTGCCCCAGAGGGAGGGGAGGG + Intronic
1185892983 X:3836508-3836530 GGTACCCCACAGGGAGGGAATGG - Intronic
1185898092 X:3874928-3874950 GGTACCCCACAGGGAGGGAATGG - Intergenic
1185903210 X:3913359-3913381 GGTACCCCACAGGGAGGGAATGG - Intergenic
1187526167 X:20057023-20057045 GCTTCTCCCCAGGGAGGGGAGGG - Intronic
1189006535 X:37000357-37000379 GTTTCCACACAGGGAGAGGTGGG - Intergenic
1189903218 X:45729925-45729947 GTTTCCCCAGAAAGAGGGCATGG - Intergenic
1191645067 X:63471194-63471216 GGTTCCCCCCAGGAAGAGGAGGG + Intergenic
1191910516 X:66144412-66144434 GATTCCACACAGGAAGAGGAGGG - Intergenic
1191910557 X:66144699-66144721 GATTCCACACAGGAAGAGGAGGG - Intergenic
1192923698 X:75734436-75734458 GAGCCCCCAGAGGGAGGGGAAGG - Intergenic
1193945529 X:87728674-87728696 GTTTCCACACAGGAAGAGGAAGG + Intergenic
1194066259 X:89266295-89266317 GTTTCCACACAGGAAGAGAAGGG + Intergenic
1194066892 X:89271701-89271723 GTTTCCACACTGGAAGAGGAGGG + Intergenic
1194214347 X:91110329-91110351 GTTTCCCCACTTCTAGGGGAAGG - Intergenic
1198074962 X:133185332-133185354 GGTTCCACACAGGAAGAGGAAGG - Intergenic
1198437568 X:136631905-136631927 TTCTCCCCACAGAGAGGGAAGGG - Intergenic
1199255727 X:145716442-145716464 GGTTCCACACAGGAAGAGGAGGG - Intergenic
1200720430 Y:6600414-6600436 GTTTCCACACAGGAAGAGAAGGG + Intergenic
1200721057 Y:6605860-6605882 GTTTCCACACTGGAAGAGGAGGG + Intergenic
1200794746 Y:7330675-7330697 TTTTCTCGAAAGGGAGGGGAGGG - Intergenic
1202115141 Y:21465024-21465046 GTTCTACCCCAGGGAGGGGATGG - Intergenic