ID: 968754173

View in Genome Browser
Species Human (GRCh38)
Location 4:2406491-2406513
Sequence GCATGTTTCCCCACAGGGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968754173_968754179 17 Left 968754173 4:2406491-2406513 CCCCTCCCTGTGGGGAAACATGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 968754179 4:2406531-2406553 CGCCGTGCTTACCTGATACAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
968754173_968754178 16 Left 968754173 4:2406491-2406513 CCCCTCCCTGTGGGGAAACATGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968754173 Original CRISPR GCATGTTTCCCCACAGGGAG GGG (reversed) Intronic
902266621 1:15271511-15271533 CCATGTTTCCCCAAAGGAAAGGG - Intronic
902476551 1:16691569-16691591 GCCTGATTCCCCACAGGGGCAGG + Intergenic
902771538 1:18648044-18648066 GCTTCTGTCCCCACAGGCAGAGG + Intronic
905293451 1:36939201-36939223 TCATGTGCCCCCAGAGGGAGCGG + Intronic
905310841 1:37047677-37047699 GCTCGTCTCCCCACAGGCAGTGG - Intergenic
905412224 1:37778557-37778579 GCACCTTTGCCCACTGGGAGTGG - Intergenic
906691245 1:47794208-47794230 ACATGTGGCCCCAGAGGGAGAGG - Intronic
913030936 1:114902082-114902104 TCATGCTTCCCAACGGGGAGGGG + Intronic
915995054 1:160553555-160553577 GCAGGTTTGCCCACAGTCAGGGG + Intronic
918169454 1:181982586-181982608 GAAAGTTTCTCCACAGGTAGAGG + Intergenic
920522979 1:206642965-206642987 TAATTTTTCCACACAGGGAGGGG - Intronic
920533398 1:206721719-206721741 GGATGTTTCCTCCCAGGGTGGGG + Intronic
921066814 1:211629121-211629143 ACAGGTTTACCCACAGGCAGGGG - Intergenic
1063319453 10:5039105-5039127 GCATGTTTCCACATAATGAGTGG + Intronic
1063516631 10:6702817-6702839 CCATGTTTCCCCAAACTGAGTGG + Intergenic
1063742689 10:8840850-8840872 GCATGTTCTCCCCCACGGAGAGG - Intergenic
1067813726 10:49454329-49454351 GTATGGTACCTCACAGGGAGGGG - Intergenic
1067837382 10:49650036-49650058 GCCTTTTTCCCCAAGGGGAGGGG + Intronic
1069748879 10:70733172-70733194 CCTTGTGTCTCCACAGGGAGGGG - Intronic
1070501047 10:77072698-77072720 GCATTTATCCACACAGTGAGAGG + Intronic
1071188327 10:83070529-83070551 ACATGTTTCCCCAGAGGGCTTGG + Intergenic
1071482392 10:86075048-86075070 GCATGACACCCCACAGTGAGAGG + Intronic
1071482703 10:86077170-86077192 GCATGACACCCCACAGTGAGAGG - Intronic
1074127705 10:110542936-110542958 CTAGGTTTCCCCACAGGCAGGGG + Intergenic
1077135664 11:997027-997049 GAGTGTCTCCCCATAGGGAGGGG - Intronic
1077218636 11:1405543-1405565 GCATGTTTTCCTAGAGGAAGGGG - Intronic
1077468922 11:2747747-2747769 GACTGGTTGCCCACAGGGAGTGG + Intronic
1077499706 11:2903603-2903625 GCATGAGTCCCAACTGGGAGGGG - Exonic
1084779612 11:71399750-71399772 GCACGTCCCCCCACAGGGACAGG - Intergenic
1085014824 11:73166920-73166942 GAATGTTTCCCCAAAGCCAGGGG + Intergenic
1086015914 11:82167323-82167345 GCTTGTTTCAGCACAGGGAGGGG + Intergenic
1087762471 11:102115867-102115889 GCATGTGACCCAGCAGGGAGAGG - Intronic
1089599621 11:119605378-119605400 GGATGCCTCCCCACAGGGAGAGG + Intergenic
1091321305 11:134654317-134654339 TCATGTTTCCTCAAAGGGACAGG + Intergenic
1094687906 12:32736976-32736998 GCATGAGTCCCAACAGTGAGAGG + Intronic
1097011284 12:55955171-55955193 CCATGCTTCCTCAAAGGGAGAGG + Intronic
1100631715 12:96396169-96396191 CCATGTTGGCCAACAGGGAGAGG + Intronic
1104300555 12:127560903-127560925 GCATGTGTAAACACAGGGAGAGG + Intergenic
1105590641 13:21790092-21790114 TCATGTTTCCCCAGAGGGGAGGG + Intergenic
1105997800 13:25688750-25688772 GCAGGTTAGCCCACAGGGCGTGG - Intronic
1106378470 13:29212749-29212771 GCTTGTGTCCCCACAGAGAGAGG + Intronic
1106392465 13:29347972-29347994 GCTTGTGTCCCCACAGAGAGAGG + Intronic
1110065318 13:71097470-71097492 GCATATTTCCAGAAAGGGAGGGG + Intergenic
1111529224 13:89515179-89515201 GCATGTTTCAGCTCAGGCAGAGG + Intergenic
1113467249 13:110520937-110520959 GCAGATTTCCCCACTGGGTGTGG - Intergenic
1118025576 14:61764666-61764688 GCATTTTTCCCCCCAAGAAGTGG - Intronic
1120124621 14:80726420-80726442 GCATGTTTTTCAAAAGGGAGGGG - Intronic
1122864222 14:104596290-104596312 GCATGGTGCCCCTCAGGGCGGGG + Intronic
1123051408 14:105545878-105545900 GCCTGTTTCCTCCCATGGAGGGG - Intergenic
1123076821 14:105671581-105671603 GCCTGTTTCCTCCCATGGAGGGG - Intergenic
1123132949 14:106001693-106001715 GCATGCTTCACAACAGGGATAGG - Intergenic
1124202812 15:27693011-27693033 GCATGTGTGCCCACAGGGAAGGG + Intergenic
1124258385 15:28164360-28164382 GTCTGTTTCCCAAAAGGGAGAGG - Intronic
1124358317 15:29015697-29015719 GCAAGTTTCCAAACAGTGAGTGG - Intronic
1124465215 15:29932267-29932289 ACAGGTTTCTACACAGGGAGAGG + Intronic
1125886566 15:43234175-43234197 TCATGTTTCCCCACCGGAAGGGG + Intronic
1126067228 15:44835235-44835257 GCATGGATCCCCACAGAAAGTGG + Intergenic
1126092602 15:45065314-45065336 GCATGGATCCCCACAGAAAGTGG - Exonic
1131054155 15:89365789-89365811 GCATGTTTCACCTGAGAGAGAGG - Intergenic
1134749381 16:16613766-16613788 GCCAGTTTCCCTACTGGGAGTGG - Intergenic
1134765222 16:16751556-16751578 GCATGAATCCCCACAGGGCAAGG - Intergenic
1134819120 16:17231347-17231369 GCCTTTCTCCCCACAGGCAGTGG + Intronic
1134980832 16:18607655-18607677 GCATGAATCCCCACAGGGCAAGG + Intergenic
1134996089 16:18739857-18739879 GCCAGTTTCCCTACTGGGAGTGG + Intergenic
1136599085 16:31272089-31272111 GGATGCTTCCCCACCGGCAGAGG + Intronic
1137350762 16:47712433-47712455 GAAAGTTCCCCAACAGGGAGTGG + Intergenic
1138126860 16:54446405-54446427 GCAAGTTCCCCCAGAGGGTGCGG - Intergenic
1138186199 16:54979478-54979500 GTTTGTTTTACCACAGGGAGGGG + Intergenic
1139280711 16:65768002-65768024 GCATGATTAGCCACAAGGAGGGG - Intergenic
1139425158 16:66874641-66874663 GCTAGCTGCCCCACAGGGAGGGG + Intergenic
1143606617 17:7990359-7990381 GCACGTTTCCCTGCAGGGACCGG - Intergenic
1145777353 17:27538741-27538763 GCATGGTGCTCCACAGGGTGTGG + Intronic
1146642146 17:34549542-34549564 GCTTGTGTGCCCACAGGCAGAGG - Intergenic
1146707873 17:35014855-35014877 GCCTGGTTCCCAGCAGGGAGTGG - Intronic
1148475815 17:47927943-47927965 GCAACTGTCCCCACAGGAAGGGG + Exonic
1148895610 17:50837476-50837498 GCCTGTTGCCCCAGAGGGGGTGG - Intronic
1151525634 17:74664739-74664761 GCATGTTTCCCCAAACAGGGAGG - Intergenic
1153991468 18:10404269-10404291 GCATGTGTCCCTGCAGGGACAGG + Intergenic
1154107164 18:11533306-11533328 GCATGGGTCACCGCAGGGAGAGG + Intergenic
1156235356 18:35198566-35198588 GCATTTTTCTTCACAGGGAGAGG + Intergenic
1157699658 18:49753117-49753139 GCATGTTTTCCCACAAGAAAAGG + Intergenic
1163412269 19:17162580-17162602 GGCTGTTTCCCCACAAGGACAGG + Intronic
1164646150 19:29859937-29859959 GTATGTTTCCCACCAGGCAGGGG - Intergenic
1202710572 1_KI270714v1_random:17410-17432 GCCTGATTCCCCACAGGGGCAGG + Intergenic
925650794 2:6087110-6087132 GCATGTTTCTGGTCAGGGAGGGG - Intergenic
925710690 2:6736709-6736731 TGATGTTTCTCCACAGGCAGAGG - Intergenic
925919764 2:8630914-8630936 GCACGTGTCCCCACAGGCTGAGG + Intergenic
926142152 2:10374067-10374089 GCCTGCTTCCCCACAGGCAGCGG + Intronic
926610584 2:14942656-14942678 CCACCTTTCCCCACAGGGAGTGG - Intergenic
927422121 2:22944571-22944593 GCAGTTATACCCACAGGGAGGGG + Intergenic
928025571 2:27736105-27736127 GCCTCTTCCCCAACAGGGAGGGG - Intergenic
928134753 2:28679877-28679899 GACTCCTTCCCCACAGGGAGAGG + Intergenic
929494360 2:42427311-42427333 AAATGTTTCCTGACAGGGAGTGG + Intergenic
929937433 2:46303854-46303876 CCATTCTTCACCACAGGGAGAGG - Intronic
934862902 2:97779371-97779393 GTCTCTGTCCCCACAGGGAGTGG + Intronic
938247716 2:129791870-129791892 ACATGCTTGCTCACAGGGAGCGG - Intergenic
940345462 2:152623828-152623850 GCATATTCCCGCACAGTGAGAGG + Intronic
1171146637 20:22789853-22789875 ACATGTTTCCCCACAGATGGTGG - Intergenic
1171464138 20:25316023-25316045 GCAGGTCTCCCCACATGCAGGGG - Intronic
1172284076 20:33728734-33728756 GCAGGGTTCCCCAAGGGGAGAGG + Intergenic
1172498972 20:35411651-35411673 ACCTGCTTCCCCTCAGGGAGAGG - Intronic
1173062421 20:39675127-39675149 CCATGTTGCCCCACAGGGTCTGG + Intergenic
1176011765 20:62900634-62900656 GGATGGCTCCCCACAGGGAAAGG + Intronic
1176015203 20:62927276-62927298 ACATGTTTGCCCACAGGGGTTGG + Intronic
1182805146 22:33063346-33063368 GCATTTTACCCCTCAGGGACAGG - Intergenic
1183511700 22:38239187-38239209 GCATGTGTCACCAGAGGGTGTGG - Intronic
952671223 3:35971843-35971865 ACATATTTCCCCACATGCAGTGG - Intergenic
953753891 3:45630520-45630542 GCGGGTTGCCCCCCAGGGAGAGG + Intronic
954956059 3:54519063-54519085 GCATGTCTGCCTGCAGGGAGGGG + Intronic
955233506 3:57120307-57120329 TCTTGTTTTCCCACAGGGAGTGG - Exonic
956487799 3:69740203-69740225 GCTAGTTTCCCCACAGAGACCGG - Intronic
964533375 3:157692653-157692675 AAATGTTTCCCCCTAGGGAGGGG - Intergenic
968754173 4:2406491-2406513 GCATGTTTCCCCACAGGGAGGGG - Intronic
969348155 4:6581985-6582007 GAAAGTGTCCCCTCAGGGAGGGG - Intronic
969575418 4:8033628-8033650 CCAGGTCTCCCCAGAGGGAGGGG + Intronic
971481991 4:27123295-27123317 GAAGGTTTCCCAGCAGGGAGAGG - Intergenic
976462696 4:85330808-85330830 TAATGTTTCCCCACTTGGAGTGG - Intergenic
980321906 4:131290647-131290669 TCATTTTTCCCCACCTGGAGTGG - Intergenic
983380355 4:166983487-166983509 CCATGTTTCTCCAAAGGGAGAGG + Intronic
985521778 5:377249-377271 GCCTGTTACCCCTCTGGGAGAGG + Intronic
985658779 5:1145312-1145334 AGCTGTGTCCCCACAGGGAGGGG - Intergenic
987258684 5:16181867-16181889 GCAAGTTTCCCTTCAGGGACTGG - Intergenic
991992140 5:72350352-72350374 TCATGTCTCCCCACAGGAACTGG - Intronic
998888245 5:146717807-146717829 GCATGTTTCCCCAAATTAAGGGG - Intronic
1003604949 6:7551334-7551356 GCATGTTTCCTGGCTGGGAGTGG + Intronic
1004241247 6:13924717-13924739 GCCTGTTTCTCCCCAGCGAGAGG - Intronic
1004610611 6:17236167-17236189 GCATATTTCACCTCAGGGACAGG + Intergenic
1004764880 6:18714925-18714947 ACATGTTTTCACACATGGAGTGG - Intergenic
1007505492 6:42332231-42332253 GAATGTTTCCCCGCTGGGCGCGG - Intronic
1011847072 6:91579040-91579062 GCATCATTCCCCATAGGGAAGGG + Intergenic
1013225520 6:108117638-108117660 AGAGGTTTCCCCAAAGGGAGAGG + Intronic
1020138347 7:5598892-5598914 GCATGTCTACCTACAGGCAGGGG - Intronic
1021138029 7:16990063-16990085 GCATGTTTACCCACTGGGCTTGG + Intergenic
1023360417 7:39409695-39409717 GCATGTCTCCCCACGTGGGGTGG - Intronic
1024291524 7:47807728-47807750 GAATGGTTCCCCACAGGGATGGG - Intronic
1026296466 7:69057132-69057154 ACATGTCTTCCCAAAGGGAGGGG + Intergenic
1027402399 7:77822424-77822446 GCAGCTTTTCTCACAGGGAGTGG + Intronic
1034139800 7:148804890-148804912 GCATGTTTTCCAACTGGGGGTGG - Intergenic
1034419451 7:150981372-150981394 GCATGTTTCCCCTCCAGAAGTGG + Intergenic
1034716159 7:153244441-153244463 GCATTTTTACCCACAGGTGGAGG + Intergenic
1035274192 7:157737637-157737659 GAGTGTTCCCCTACAGGGAGGGG + Intronic
1037434270 8:18846434-18846456 ACATGTTTCCCTGCAGGGCGTGG - Intronic
1037468537 8:19184614-19184636 GCAGGTTGCCCCAGTGGGAGGGG + Intergenic
1038322259 8:26538461-26538483 CCTTTTTCCCCCACAGGGAGAGG - Intronic
1039943098 8:42108045-42108067 GCATGTGTCCCCCTATGGAGAGG - Intergenic
1040583289 8:48715522-48715544 TCCTTTTTCCCCACAGAGAGAGG - Intronic
1043271540 8:78339880-78339902 GCATGTTTCCCCCCCTGTAGGGG - Intergenic
1047354270 8:124105409-124105431 GCATGGTTTCCAGCAGGGAGGGG + Intronic
1048695861 8:137027151-137027173 CCATTTTTTCCCACAGAGAGAGG - Intergenic
1050873371 9:10604404-10604426 GCATGTTTTCCAAGTGGGAGAGG + Intronic
1052914968 9:33918025-33918047 GGTTATTTCCCCCCAGGGAGTGG + Exonic
1053046909 9:34927416-34927438 GCAGCTTGGCCCACAGGGAGTGG + Intergenic
1053249478 9:36562402-36562424 GGATGTTTCCTCACAGTCAGTGG + Intergenic
1055070876 9:72164432-72164454 GCTTATTTCAGCACAGGGAGAGG + Intronic
1057582447 9:96299444-96299466 TGAAGATTCCCCACAGGGAGGGG - Intronic
1058648151 9:107149907-107149929 ACATCATTCCTCACAGGGAGAGG + Intergenic
1061482200 9:130902843-130902865 GCATGTGTGCACACAAGGAGTGG + Exonic
1061973460 9:134056732-134056754 GCACATTCTCCCACAGGGAGGGG - Intronic
1062432479 9:136532234-136532256 CCAACTTTCCCCACAGGGAAAGG - Intronic
1062452641 9:136621975-136621997 GCAGCTTCCCCCACAGGGAGGGG - Intergenic
1186150350 X:6668123-6668145 TTATTTTTCCCCACAGGGACAGG - Intergenic
1186725572 X:12355049-12355071 GCATTTTTCCTCTAAGGGAGAGG + Intronic
1187473575 X:19590156-19590178 GCATATTTCCCCACATTGTGGGG - Intronic
1187581212 X:20609475-20609497 GCTGGGTTGCCCACAGGGAGTGG - Intergenic
1189006538 X:37000361-37000383 CCCAGTTTCCACACAGGGAGAGG - Intergenic
1194952973 X:100148974-100148996 ACTTATATCCCCACAGGGAGGGG + Intergenic
1198015414 X:132605396-132605418 CTATGTGTCTCCACAGGGAGAGG - Intergenic
1200780470 Y:7210954-7210976 CCAAGTTTGCACACAGGGAGAGG - Intergenic
1201629104 Y:16049554-16049576 TTATTTTTCCCCACAGGGACAGG - Intergenic