ID: 968754175

View in Genome Browser
Species Human (GRCh38)
Location 4:2406493-2406515
Sequence CAGCATGTTTCCCCACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 161}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968754175_968754178 14 Left 968754175 4:2406493-2406515 CCTCCCTGTGGGGAAACATGCTG 0: 1
1: 1
2: 1
3: 14
4: 161
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15
968754175_968754179 15 Left 968754175 4:2406493-2406515 CCTCCCTGTGGGGAAACATGCTG 0: 1
1: 1
2: 1
3: 14
4: 161
Right 968754179 4:2406531-2406553 CGCCGTGCTTACCTGATACAGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968754175 Original CRISPR CAGCATGTTTCCCCACAGGG AGG (reversed) Intronic
900664965 1:3809034-3809056 CAGGCTGTGTCCTCACAGGGTGG + Intergenic
901179066 1:7327566-7327588 CAGCATGTTTCCCTGCAGGTTGG + Intronic
902242836 1:15100237-15100259 CAGCATGTACCCCAGCAGGGTGG + Intronic
905942058 1:41871608-41871630 GAACATGTTTCCACAGAGGGTGG + Intronic
906204907 1:43981493-43981515 AACCCTGTTTCCCCACAGGCAGG - Intronic
908452009 1:64265002-64265024 CAGCATATTTCCCCTCAAGCAGG - Intronic
910123753 1:83818298-83818320 CAGGATGTTTCCACTCATGGTGG - Intergenic
911419750 1:97625661-97625683 CAGCATGTAAACACACAGGGAGG + Intronic
915287839 1:154864173-154864195 CTGCAGGTCACCCCACAGGGAGG + Intronic
915511127 1:156387710-156387732 CAGCATTGTCCCCCACATGGTGG + Intergenic
916560974 1:165933920-165933942 CTTCATGTTGCCCCACTGGGGGG - Intergenic
917602867 1:176595093-176595115 CAGACTGTTTGCCCACAGAGTGG - Exonic
917693707 1:177495892-177495914 CAGCATGTTTCTTCATAGGCAGG - Intergenic
917929280 1:179812713-179812735 TAGCATGATGCCACACAGGGAGG + Intronic
920066652 1:203274020-203274042 CAGCCTGTGGCCACACAGGGTGG + Intergenic
920533396 1:206721717-206721739 TAGGATGTTTCCTCCCAGGGTGG + Intronic
1063306369 10:4905104-4905126 CAGAACTTTTCCCCACTGGGAGG + Intergenic
1070769969 10:79076500-79076522 CAGCATGTGTCTTTACAGGGTGG + Intronic
1075101688 10:119510544-119510566 CAGCATCTGCCCCCACACGGAGG - Intronic
1075240785 10:120776580-120776602 CTGCATCTGTACCCACAGGGTGG - Intergenic
1075937496 10:126355592-126355614 CAGCATGGTGCCACACAGAGAGG + Intronic
1075948188 10:126455470-126455492 CCGCCTGCTTCCCCACAAGGTGG + Intronic
1076228666 10:128801870-128801892 CAACAAGTTTCTCCACAGAGGGG + Intergenic
1076560640 10:131361061-131361083 CACCATGTTTCCCTGCAGAGTGG - Intergenic
1077329284 11:1976867-1976889 CAGCAGGGTTCTCCTCAGGGTGG + Intronic
1085147209 11:74212278-74212300 CAGTAAGTTTCCACAGAGGGAGG + Intronic
1085829075 11:79880504-79880526 CAGCATTGTTTCCCAAAGGGTGG + Intergenic
1087181271 11:95144774-95144796 CAGCCCCTTTCCCCACTGGGGGG - Intergenic
1088139970 11:106604370-106604392 CAGCATCTTTCACCACCAGGAGG - Intergenic
1089970610 11:122690015-122690037 CAGCATTTCTTCCCCCAGGGTGG + Intronic
1202812263 11_KI270721v1_random:32046-32068 CAGCAGGGTTCTCCTCAGGGTGG + Intergenic
1091979024 12:4850726-4850748 CAGCATTTTTCCTGCCAGGGAGG - Intronic
1096558789 12:52421452-52421474 CAGCATTCTTGACCACAGGGTGG + Intergenic
1099356580 12:81644697-81644719 AAGCATGTGTTCCCACAAGGTGG + Intronic
1103448475 12:121010633-121010655 CAGCCTGTTTCCTCACCTGGAGG + Intronic
1104982905 12:132582072-132582094 CAGCATCTTTGCCCCCAAGGAGG + Exonic
1108115523 13:47123460-47123482 CCCCATGTGGCCCCACAGGGTGG - Intergenic
1109651053 13:65326960-65326982 CAGCACGCTTGCCTACAGGGAGG + Intergenic
1109799648 13:67359590-67359612 CTGCATGTTTCCCCTCTCGGTGG - Intergenic
1110866180 13:80398827-80398849 CTTCTTGTTTCCCTACAGGGGGG - Intergenic
1112829666 13:103433699-103433721 GACCATGGTTACCCACAGGGGGG - Intergenic
1113470976 13:110545872-110545894 CAGCATTTTCCCCCACAGCAAGG - Intronic
1114650465 14:24281320-24281342 CAGCATACCTCCCCTCAGGGAGG + Intergenic
1118259912 14:64236850-64236872 CACCATGTTGCCCCACATGCTGG + Intronic
1119465630 14:74855877-74855899 CTGCATCTTTCCACATAGGGTGG - Intronic
1121232120 14:92365569-92365591 CACCATGGGTCCCCACAGAGGGG - Intronic
1121390779 14:93572202-93572224 CTTCAAGTTTCTCCACAGGGTGG - Intronic
1122864220 14:104596288-104596310 CTGCATGGTGCCCCTCAGGGCGG + Intronic
1124210774 15:27763641-27763663 CTGCCTGTCTCCCCACAGGAAGG - Intronic
1125886564 15:43234173-43234195 CTTCATGTTTCCCCACCGGAAGG + Intronic
1126583023 15:50258437-50258459 CAGCATGTCTCCTAGCAGGGAGG + Exonic
1128511467 15:68316312-68316334 TCGCATGTTTCCCCACCGCGGGG - Intronic
1130014048 15:80173856-80173878 CAGCCTGGATCCCCACAGGGAGG - Intronic
1131211110 15:90497462-90497484 CAGCTTCTTTCCCCGCAGTGTGG - Intronic
1132495751 16:262536-262558 CAGGATGCTTTCCCACAGGTGGG + Exonic
1134241618 16:12510919-12510941 CAGCCTGTCTCCCCACAGGAAGG - Intronic
1135765324 16:25172779-25172801 AAGCATCCTTCCCCACAGGCTGG + Intronic
1136159407 16:28408815-28408837 CAGCATTTTGTCCCACAGAGGGG - Intergenic
1136203680 16:28706479-28706501 CAGCATTTTGTCCCACAGAGGGG + Intronic
1136278069 16:29191296-29191318 CAAGATGTTGCACCACAGGGAGG + Intergenic
1136279896 16:29202194-29202216 CAGCATCTTTCCCAACAGCCTGG - Intergenic
1136279926 16:29202364-29202386 CAGCATCTTTCCCAACAGCCTGG - Intergenic
1136466814 16:30449962-30449984 GGGCAGGGTTCCCCACAGGGCGG - Intergenic
1137055721 16:35745960-35745982 CAGAATGGACCCCCACAGGGAGG - Intergenic
1138392028 16:56676907-56676929 CACCTTTTTTCCCCACAGGCTGG - Intronic
1139464230 16:67145596-67145618 CAACAGGCTTCTCCACAGGGTGG - Exonic
1139781531 16:69355518-69355540 CAGCATGTATCCACAGAGGGAGG - Intronic
1140687992 16:77451947-77451969 CAGCCTGTTTCCACTCATGGTGG - Intergenic
1141792537 16:86246377-86246399 CAGCATGTTTCCAGACGGTGTGG - Intergenic
1141999437 16:87655764-87655786 CAGACTGGTTCCCCACACGGGGG - Intronic
1142082446 16:88157336-88157358 CAAGATGTTGCACCACAGGGAGG + Intergenic
1142084288 16:88168302-88168324 CAGCATCTTTCCCAACAGCCTGG - Intergenic
1143542008 17:7574408-7574430 CAGCTGGTTTCCCTAAAGGGAGG + Intronic
1147495655 17:40912670-40912692 CAGCTTGTTTTTCCAGAGGGCGG - Intergenic
1147692469 17:42324978-42325000 CAGCATGTTGTACCACAGGATGG + Exonic
1152495329 17:80667169-80667191 CAGCTTGTTGCCCCCCAGGGAGG + Intronic
1155412491 18:25561957-25561979 CAACATGTCTCCCCACGTGGGGG + Intergenic
1156333482 18:36148052-36148074 CAGCATTTTTTCCCCCAGGGTGG + Intronic
1162017595 19:7853784-7853806 CTCCATCTTTCCCCAGAGGGCGG - Intronic
1165434662 19:35789371-35789393 CAGCCTGCTGACCCACAGGGAGG - Intergenic
925644813 2:6025155-6025177 AAGCATGTTTCAGCAAAGGGAGG - Intergenic
927920014 2:26965130-26965152 CCCCATGTTTCCCCATAGGAGGG - Intergenic
930724971 2:54673863-54673885 CAGCGACTTTCTCCACAGGGTGG + Intergenic
931899764 2:66774693-66774715 CAGAGTGTTTCCTCACAGTGAGG + Intergenic
933970476 2:87465793-87465815 CAGCACGTTCCCACACAGAGAGG - Intergenic
934115319 2:88785082-88785104 CAGCATGTTTTCACCAAGGGTGG + Intergenic
934628259 2:95883862-95883884 CAGCATGTTTTCACCAAGGGTGG - Intronic
934631077 2:95923183-95923205 CAGCATGTTTTCACCAAGGGTGG - Intronic
934631330 2:95926912-95926934 CAGCATGTTTTCACCAAGGGTGG - Intronic
934631452 2:95928759-95928781 CAGCATGTTTCCACCAAGAGGGG - Intronic
934802707 2:97182072-97182094 CAGCATGTTTTCACCAAGGGAGG + Intronic
934802969 2:97185800-97185822 CAGCATGTTTTCACCAAGGGTGG + Intronic
934832213 2:97539721-97539743 CAGCATGTTTTCACCAAGGGTGG - Intronic
934833231 2:97554747-97554769 CAGCATGTTTTCACCAAGGGTGG - Intronic
934833492 2:97558498-97558520 CAGCATGTTTTCACCAAGGGAGG - Intronic
935209979 2:100931164-100931186 CTGGACGTTTCCCCACAGCGCGG + Intronic
935503156 2:103867044-103867066 CAGCATGTTGCCCGAGATGGTGG + Intergenic
935697621 2:105783785-105783807 CAGTGTGCTTCCCCACAGAGAGG + Intronic
936323254 2:111484394-111484416 CAGCACGTTCCCACACAGAGAGG + Intergenic
942505970 2:176641995-176642017 CATCATGTTTTTCCACAGAGGGG - Intergenic
946702816 2:222429606-222429628 CCGCATGTTCCTCCACAGGATGG + Intronic
947565706 2:231191590-231191612 CAGGATGTTAGCCCAGAGGGTGG - Intergenic
947827916 2:233118674-233118696 CAGCAGGTTTTCCCTCAGGTGGG + Intronic
947873921 2:233455746-233455768 CAGCATGGCTCCCCGCAAGGTGG - Intronic
1168795119 20:606136-606158 CAGCATGTTCACTCACAGGCAGG + Intronic
1173341994 20:42161321-42161343 CAGGAAGTTTCCCCACAGGCTGG + Intronic
1174103548 20:48145805-48145827 CAGAATTTTTCCCAACAGGACGG + Intergenic
1174580895 20:51570771-51570793 CAGAATGTAACCCAACAGGGAGG + Intergenic
1175181671 20:57152785-57152807 CAGTTTGTATCCCCACTGGGAGG + Intergenic
1178554437 21:33575767-33575789 CAGGATGTTTGCCTGCAGGGGGG - Exonic
1178689548 21:34739821-34739843 CAGCATCTTTCTTCACAGGGGGG + Intergenic
1179128685 21:38614811-38614833 CAGGATATTTCCCCAAAGGAGGG - Intronic
1179607356 21:42525379-42525401 CAGCATCAGCCCCCACAGGGCGG - Intronic
1179992866 21:44957688-44957710 CAGCATGTTCCCCCACAGGGAGG + Intronic
1180447818 22:15431814-15431836 CTGAATGTTTCCCCTCAGGCAGG + Intergenic
1183164641 22:36138703-36138725 CAGAATGTTCCTCTACAGGGAGG - Intergenic
1183170943 22:36187853-36187875 CAGAATGTTCCTCTACAGGGAGG - Intergenic
1184651230 22:45920298-45920320 GAGCATGTGTCCCCACCGGTGGG + Intergenic
959987596 3:112593256-112593278 CAGAAAGTTTCCCAAAAGGGAGG + Intergenic
961530137 3:127535663-127535685 CATCATGTTTGACCAAAGGGAGG - Intergenic
962150459 3:132887377-132887399 CAGCATGTATCCTCACAGGGAGG - Intergenic
962628384 3:137250078-137250100 CAGCAGGTTTCTGCACAGGTAGG - Intergenic
962891917 3:139679384-139679406 CAGCTTATTTCCCAGCAGGGTGG + Intergenic
962945048 3:140160748-140160770 CAGCATCTTTCCCCACCATGTGG - Intronic
963069612 3:141292132-141292154 CAGCCTGTTTCCCCATGGTGTGG - Intronic
968504860 4:967050-967072 CAGACTGTGTCCCCACAGGGTGG - Exonic
968754175 4:2406493-2406515 CAGCATGTTTCCCCACAGGGAGG - Intronic
969650876 4:8467250-8467272 CAGCATGTGCCCCCGCCGGGCGG + Intronic
970663281 4:18309611-18309633 CAGCCTGAGTCCCCACAGGTTGG + Intergenic
972702805 4:41510348-41510370 CAGCATGTAACCCCACAGGCAGG - Intronic
973029944 4:45325008-45325030 CAGCCTGTTTCCACTCAGGATGG - Intergenic
978909515 4:114047876-114047898 GAGAATGATTCCCCACAGGCCGG + Intergenic
979644581 4:123053399-123053421 CAGCATATTTCTGCACAGGCAGG + Intronic
985848480 5:2371503-2371525 CGGCTTCTTTCCCCGCAGGGAGG + Intergenic
986206498 5:5629639-5629661 CAGAATGTATCCCCACAGCTTGG - Intergenic
991230281 5:64324600-64324622 CATCATGTTTCCCCATAGCAAGG + Intronic
991430665 5:66541673-66541695 TAGCAAGTTTCCCCACAGCTTGG + Intergenic
992082026 5:73242957-73242979 CACCATGTGTCTCCACATGGAGG + Intergenic
993949667 5:94158391-94158413 CTCCATGTTTCCCCATACGGAGG - Intronic
996175844 5:120355742-120355764 CACCATGTTTCCCCTCAAGACGG - Intergenic
996416883 5:123220286-123220308 CAGGACGATTCCCCAGAGGGTGG - Intergenic
998860256 5:146436611-146436633 ATGTATGTTTGCCCACAGGGAGG + Intergenic
1006736471 6:36277130-36277152 CATCATGTTTCCCCACTGTGTGG - Intronic
1020984855 7:15120562-15120584 CTGGATGTGTCCTCACAGGGTGG - Intergenic
1022092638 7:27117554-27117576 GAGCATGCTTCCCCACAAGCCGG - Intronic
1022903986 7:34838125-34838147 CAGCATGCCTCCCCCCAGGGAGG + Intronic
1023207235 7:37763861-37763883 GAGTAGGTTTCCCCACAGCGAGG + Intronic
1023770788 7:43554805-43554827 CAGCAGGTTTCCCCGAAGGCTGG - Intronic
1024847821 7:53669622-53669644 CAGTATTTTTTCCCCCAGGGAGG + Intergenic
1026208566 7:68280702-68280724 CAGCATGTTTGGGCACAGGAGGG - Intergenic
1026296464 7:69057130-69057152 CAACATGTCTTCCCAAAGGGAGG + Intergenic
1027189209 7:75988088-75988110 CAGCATGACTCCCGACAGGAAGG + Exonic
1034358604 7:150474079-150474101 CACCGCGTTTCCCCACAAGGAGG - Exonic
1034863088 7:154616786-154616808 CAGCATGTTTCCCGTCACTGTGG - Intronic
1035274190 7:157737635-157737657 CAGAGTGTTCCCCTACAGGGAGG + Intronic
1035865733 8:3079696-3079718 CATGATGTTTGCCCACAGAGAGG - Intronic
1037468535 8:19184612-19184634 CAGCAGGTTGCCCCAGTGGGAGG + Intergenic
1037554534 8:20009397-20009419 GAGCATGTTCCCACACAGGTTGG + Intergenic
1039824011 8:41157604-41157626 GAGCATGTTTCCCCAGCTGGAGG - Intergenic
1039850737 8:41362793-41362815 TAGCATGTTTTCCCATGGGGTGG - Intergenic
1040659167 8:49549080-49549102 CAGCAAGGTTGCCAACAGGGTGG + Intronic
1046800377 8:118419914-118419936 CAGCATCTTTCCCCAGTGGTAGG - Intronic
1047188858 8:122660039-122660061 CAGCTTATTGCCCCAAAGGGTGG - Intergenic
1049861609 8:144902423-144902445 CAAGAGGCTTCCCCACAGGGCGG + Intergenic
1052691387 9:31820734-31820756 GAGCATGTTTCCACACAGTGGGG - Intergenic
1053290760 9:36878419-36878441 AAGCATCTTCCCCCAGAGGGGGG + Intronic
1056764066 9:89434025-89434047 CAGCATCTCTCCCCAGAGCGGGG - Intronic
1057279451 9:93699395-93699417 CAGGAAGTTTCCCCACGGTGGGG - Intergenic
1057836431 9:98449149-98449171 CAGGAGGGTTCCCCACAGGGTGG + Intronic
1061749633 9:132769015-132769037 CAGCCTGTTTCCCCCCATGCGGG - Intronic
1062452643 9:136621977-136621999 CGGCAGCTTCCCCCACAGGGAGG - Intergenic
1203582842 Un_KI270746v1:28479-28501 CAGCATGTTTTCACCAAGGGTGG + Intergenic
1187422695 X:19150053-19150075 CAGTATTTTTCCCCCCAGGAAGG - Intergenic
1187473577 X:19590158-19590180 GAGCATATTTCCCCACATTGTGG - Intronic
1194952971 X:100148972-100148994 CAACTTATATCCCCACAGGGAGG + Intergenic
1195927526 X:110040718-110040740 CAGCAGGTAACCCCAGAGGGTGG - Intronic
1196753255 X:119136333-119136355 CAGCCTTTTGGCCCACAGGGTGG + Intronic
1200249028 X:154542381-154542403 CAGCATCTTTCCCCACCTGATGG - Exonic