ID: 968754176

View in Genome Browser
Species Human (GRCh38)
Location 4:2406496-2406518
Sequence TGACAGCATGTTTCCCCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 139}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968754176_968754179 12 Left 968754176 4:2406496-2406518 CCCTGTGGGGAAACATGCTGTCA 0: 1
1: 0
2: 1
3: 14
4: 139
Right 968754179 4:2406531-2406553 CGCCGTGCTTACCTGATACAGGG 0: 1
1: 0
2: 0
3: 0
4: 19
968754176_968754178 11 Left 968754176 4:2406496-2406518 CCCTGTGGGGAAACATGCTGTCA 0: 1
1: 0
2: 1
3: 14
4: 139
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968754176 Original CRISPR TGACAGCATGTTTCCCCACA GGG (reversed) Intronic
901137479 1:7007422-7007444 TGACATTCTGTTGCCCCACAAGG - Intronic
902735246 1:18396347-18396369 TGAAAGCATGTTCCCTCCCAAGG - Intergenic
904678351 1:32212289-32212311 GGAAAGCATGTTCCCCCACATGG + Intronic
905387321 1:37613761-37613783 AGGCAGCATGGTCCCCCACAGGG + Exonic
905665236 1:39759647-39759669 TGCCACCATGTTGCCCCACCAGG - Exonic
906170415 1:43720317-43720339 TGACAGCGTGTTTCCCAAAGTGG - Intronic
907129395 1:52082073-52082095 AGTAAGCATGTTACCCCACAAGG + Intronic
907493599 1:54826582-54826604 TGACAGCATTGTTCCCAAGAGGG - Intronic
908175412 1:61551379-61551401 TGACATCATGTTTCCCCGGATGG + Intergenic
908816610 1:68041977-68041999 TCACAGCATGATTCCAGACATGG - Intergenic
910666522 1:89730893-89730915 TGACTACATGTTTCCCCACCTGG - Intronic
911419749 1:97625658-97625680 TGACAGCATGTAAACACACAGGG + Intronic
913182415 1:116334950-116334972 TGCCAGGATGTTTCACCACATGG + Intergenic
918394083 1:184096191-184096213 TGACAGCATCTTTCCTCTGAGGG + Intergenic
922973390 1:229761876-229761898 TGTCACTATGTTTTCCCACACGG - Intergenic
1065920365 10:30387584-30387606 TCAGAGCAACTTTCCCCACAAGG + Intergenic
1066313665 10:34222417-34222439 TGACAGCATGAGGCCCCAAATGG + Intronic
1068141473 10:53013606-53013628 TGATTGCTTCTTTCCCCACAGGG + Intergenic
1068656470 10:59581240-59581262 AGACAGCATCTTTCACCAGAAGG - Intergenic
1069647113 10:70008487-70008509 TGACAGCAGGTTCACCCAAAGGG - Intergenic
1070698400 10:78580241-78580263 TGAAAGGCTGTTTCCACACACGG + Intergenic
1071745773 10:88417551-88417573 ATACAGCATGTTTCCCAAAAAGG + Intronic
1072468278 10:95687890-95687912 TTACAGAATATTTCCCCAGAAGG + Intronic
1073901638 10:108229283-108229305 TGACCGGATTTGTCCCCACAGGG + Intergenic
1076202010 10:128566520-128566542 TGACAGGCTGTTTCACCCCAGGG - Intergenic
1079919862 11:26419329-26419351 TGAGAGCATAATTCCACACATGG - Intronic
1081424695 11:42912741-42912763 TGACAGCAGACTGCCCCACATGG + Intergenic
1081937195 11:46913111-46913133 TGACACCCTGTTTCCCCATGCGG - Intronic
1084698121 11:70768499-70768521 TGCCAACAAGCTTCCCCACAGGG - Intronic
1088486732 11:110348036-110348058 TGTCAGGATGTTACCCCATATGG - Intergenic
1089762973 11:120741855-120741877 AGACTGCATCTTACCCCACAGGG - Intronic
1092523527 12:9295683-9295705 AGTCAGCATGTTTGCCTACAAGG + Intergenic
1092543769 12:9436216-9436238 AGTCAGCATGTTTGCCTACAAGG - Intergenic
1094509176 12:31085835-31085857 AGTCAGCATGTTTGCCTACAAGG + Intronic
1097940999 12:65305407-65305429 TGATTCCATGTTTCCCCACTAGG - Intronic
1099179500 12:79460852-79460874 TCACAGAATGTTTACCCACTGGG - Intergenic
1100173422 12:92003170-92003192 TGACAGCTGGTTGCCACACATGG - Intronic
1103448474 12:121010630-121010652 TGACAGCCTGTTTCCTCACCTGG + Intronic
1104982904 12:132582069-132582091 TGGCAGCATCTTTGCCCCCAAGG + Exonic
1106970810 13:35139510-35139532 TGACAGGATTTCTGCCCACATGG - Intronic
1107836489 13:44416077-44416099 TGCCTGCTGGTTTCCCCACAGGG + Intergenic
1108823483 13:54382166-54382188 TTACAGCATGTGTCACCACAGGG - Intergenic
1109226538 13:59702939-59702961 TGAAGGCAGGCTTCCCCACAGGG - Intronic
1109799649 13:67359593-67359615 TGTCTGCATGTTTCCCCTCTCGG - Intergenic
1110924404 13:81132038-81132060 TGACTCCATGTTTCACCACCAGG - Intergenic
1111466723 13:88622765-88622787 TGACAGCAAGTTTCCAGAAATGG - Intergenic
1116485581 14:45444411-45444433 TGACACCATGTCTCACAACAGGG - Intergenic
1117842274 14:59871396-59871418 TGACACCCTGTTTGCCCTCAGGG - Intergenic
1120327608 14:83050429-83050451 TGACACCAAGATTCCCCAAAGGG - Intergenic
1121621455 14:95352324-95352346 TGCCAGCATATTTCCACACAAGG - Intergenic
1127680800 15:61295977-61295999 TGACACCAAGTTTCCCCCAATGG + Intergenic
1127929516 15:63583049-63583071 TGACCCCATGCTTCCACACACGG + Intronic
1129405292 15:75312969-75312991 TCAGAGCAACTTTCCCCACAAGG - Intergenic
1130981994 15:88819039-88819061 AGACAGCATGAGTCCCCAGAAGG + Intronic
1131228978 15:90646763-90646785 TGACATCCAGCTTCCCCACAGGG + Intergenic
1135466107 16:22686387-22686409 AAACAGGATGTTTCCCCACTGGG - Intergenic
1137055722 16:35745963-35745985 TGACAGAATGGACCCCCACAGGG - Intergenic
1140934049 16:79654250-79654272 TGTGTGCATGTTTGCCCACATGG + Intergenic
1141028671 16:80570131-80570153 TAACAACAGGTTTCCCCTCAAGG - Intergenic
1141322773 16:83027205-83027227 GAACAGCATGTTTTTCCACATGG - Intronic
1144306791 17:13975863-13975885 TGACAGCATCTTTCAAGACATGG + Intergenic
1150173494 17:63024355-63024377 TGACAGGATGTTACCCTATATGG - Intronic
1153756891 18:8293350-8293372 TGTGAGCATCATTCCCCACAAGG + Intronic
1155711143 18:28881071-28881093 TGACAGACTGTTTCCCAAAAGGG + Intergenic
1157238021 18:45982227-45982249 TGACAGCATCTGACCCCACATGG - Intergenic
1159796867 18:72854441-72854463 TGACAGAAAATCTCCCCACAAGG + Intronic
1159933786 18:74343344-74343366 TGAAAGTATGTTTTCTCACAGGG - Intronic
1161745648 19:6058122-6058144 TGACAGTGTGTGTCCCCACTTGG + Intronic
1162070053 19:8147929-8147951 TGACACCCTGTTTCCCCCCCGGG - Intronic
1163832355 19:19553147-19553169 TCACAGCCTGTTTCCCCAGCTGG + Intergenic
1164812734 19:31170696-31170718 TGAAAAGATGTTTCCCCACAGGG + Intergenic
1167798084 19:51723856-51723878 TGGCAGTAGTTTTCCCCACATGG + Intronic
1168408607 19:56124051-56124073 TGACAGGATGTATTTCCACAAGG - Intergenic
929820311 2:45268108-45268130 TGATAGCATGTTTCCGCCAAGGG - Intergenic
934980224 2:98833371-98833393 GGCCTGCATGTTTGCCCACAAGG - Intronic
935584369 2:104787456-104787478 TGGCAGCCTCTGTCCCCACAAGG + Intergenic
938452020 2:131429492-131429514 TGGCTGCATGTTTCTGCACATGG - Intergenic
938739693 2:134219356-134219378 TCACAGCAGGTTTTCCCACCTGG - Intronic
941223529 2:162815422-162815444 TGACAGAATGTTTACTCATAAGG - Intronic
947873922 2:233455749-233455771 TGTCAGCATGGCTCCCCGCAAGG - Intronic
1169636495 20:7697908-7697930 TGACAGCATCCTTCCACACAGGG + Intergenic
1173062419 20:39675122-39675144 TGATTCCATGTTGCCCCACAGGG + Intergenic
1173280685 20:41624529-41624551 TGACAACATATGTCCACACAAGG - Intergenic
1173311065 20:41896167-41896189 TGACAGAATGTTACCTGACAAGG - Intergenic
1173864446 20:46305444-46305466 TCTCAGCCTGTTTCCCCACCTGG + Intronic
1174147129 20:48459802-48459824 ATGCAGCATGTTTCCCCAAACGG + Intergenic
1174639576 20:52031820-52031842 TTAGAGCACGTCTCCCCACACGG - Intergenic
1175743819 20:61439573-61439595 TGAGAGCAGATGTCCCCACAGGG + Intronic
1178703990 21:34857992-34858014 TGACTGCATTTTTCCCCAGAGGG - Intronic
1179992865 21:44957685-44957707 CTGCAGCATGTTCCCCCACAGGG + Intronic
1180164232 21:46012836-46012858 TGAAAGTATGTGTCCACACAAGG - Intergenic
1181627016 22:24129112-24129134 GGACAGCAGGTGTCCCCAGAGGG + Intronic
1182326829 22:29519583-29519605 TGGCAGAATGTGTCCCCTCAGGG - Intronic
1184046603 22:41976314-41976336 GGACAGCATATTGCCTCACAGGG - Intronic
1184918130 22:47587229-47587251 TGCCAGGATGTTTATCCACAAGG + Intergenic
1185282141 22:49977116-49977138 TGACAACATATGTCCACACAAGG - Intergenic
949741772 3:7242839-7242861 TGACAGCCCGTTTCCCCTCCTGG + Intronic
949882173 3:8670446-8670468 TCACAGCAGGTGTCCACACATGG + Intronic
950812046 3:15658392-15658414 TGACGCCATGCTGCCCCACAGGG + Intergenic
951596738 3:24326633-24326655 TGACAACGTGTTTTCCCAAAGGG + Intronic
953311296 3:41882314-41882336 TCACAGCATGTATCACCACCTGG - Intronic
958831365 3:99094375-99094397 TGAAAGCATTTTTACCCAAAAGG + Intergenic
961722402 3:128905747-128905769 TGGCAGTATGTTTGCCCCCAAGG + Intronic
962150460 3:132887380-132887402 TGACAGCATGTATCCTCACAGGG - Intergenic
962486518 3:135848232-135848254 TGACAGCATACTTCACTACAGGG - Intergenic
968754176 4:2406496-2406518 TGACAGCATGTTTCCCCACAGGG - Intronic
968940165 4:3633574-3633596 TGCCAGAAGGTGTCCCCACATGG + Intergenic
969633585 4:8352604-8352626 TGACAGCAAGTGGCCCCAGAGGG + Intergenic
974489624 4:62548206-62548228 AAACAGCATGTTGCTCCACACGG - Intergenic
975204090 4:71624279-71624301 TGAAACCATTTTTCCCCCCAAGG + Intergenic
980729359 4:136806393-136806415 TGATTGCATGTTTCACCAAAAGG - Intergenic
982958299 4:161800380-161800402 TGTCAGCAGCTTTCACCACATGG + Intronic
995737505 5:115317552-115317574 TGACAGCATGCTTGACCACAGGG - Intergenic
997775576 5:136601578-136601600 TGAAACCATTTTTCCCCCCAAGG - Intergenic
1000168316 5:158677165-158677187 TGACAGGCTGATTTCCCACAAGG + Intergenic
1000176300 5:158758463-158758485 TGACAATCTGTTTGCCCACAAGG + Intronic
1000728305 5:164800461-164800483 AGACACCATCTTTTCCCACATGG + Intergenic
1001938510 5:175724509-175724531 TGAGAGGGTGTTTCCCCACTAGG - Intergenic
1002621448 5:180491475-180491497 TGGCAGCAAGTCTCCCCAGAGGG + Intergenic
1004267633 6:14162903-14162925 TGACTGCATCTTCCCTCACAAGG - Intergenic
1005967824 6:30740366-30740388 TGACAGCCTGCTTCCCACCAAGG + Intronic
1012404982 6:98885891-98885913 TGGCAGCTGGCTTCCCCACAAGG - Intronic
1012659009 6:101862548-101862570 TGTTAGCATGTCTACCCACAAGG - Intronic
1013110527 6:107061360-107061382 TGACAGAACGTTTCTTCACAGGG - Intergenic
1013989468 6:116236840-116236862 TGTCAGCTCCTTTCCCCACAAGG + Intronic
1021138027 7:16990058-16990080 AGCCAGCATGTTTACCCACTGGG + Intergenic
1021276254 7:18655225-18655247 TGACAGCTTGTTTCCATGCAGGG + Intronic
1021626685 7:22600472-22600494 TGACACCATTTTTCTTCACATGG + Intronic
1022412346 7:30148946-30148968 TTGCAGCAGGTTTCCTCACAGGG + Intronic
1022807566 7:33837886-33837908 TGTCCTCTTGTTTCCCCACAAGG - Intergenic
1024223879 7:47310172-47310194 TCTGAGCATGTTTCCCCTCAAGG + Intronic
1028085112 7:86626534-86626556 TGACATCATGTGACCACACAGGG + Intergenic
1031181652 7:118425808-118425830 AGACAATATGTTTGCCCACATGG + Intergenic
1033323023 7:140357295-140357317 TGAAAGCATATGTCCACACAAGG + Intronic
1033718359 7:144027219-144027241 TGATAGTATTTTTCCCCAGAAGG - Intergenic
1035085750 7:156256134-156256156 TGACAGTATGTTTCACCCCACGG - Intergenic
1036446257 8:8823936-8823958 TCACAGCAGATTTCCCTACAGGG + Intronic
1041726290 8:61020670-61020692 TGGCAGCATGTTTCTCAGCATGG + Intergenic
1041859963 8:62502024-62502046 TGACAGCATGAGTTGCCACATGG - Intronic
1048566958 8:135610871-135610893 TGACAGCATGTTTCCTCCACAGG + Intronic
1049637860 8:143698840-143698862 TGACAGCTGGTCTCCCCTCATGG - Intronic
1051290215 9:15537912-15537934 TGAAAGCATGTTTGTCCCCATGG + Intergenic
1052777236 9:32744108-32744130 TGATAGGATGTTTCCTAACAAGG + Intergenic
1054450590 9:65401723-65401745 TGCCAGAAGGTGTCCCCACATGG - Intergenic
1055701516 9:78949861-78949883 TGAAACCATTTTTCCCCACTAGG - Intergenic
1057851985 9:98572949-98572971 TGTGAGCATCTTCCCCCACAAGG + Intronic
1058073741 9:100628939-100628961 TTACAGCACATTTCCCCTCAAGG - Intergenic
1060093306 9:120764105-120764127 TTACAGCAACTTTCCTCACACGG - Exonic
1060515948 9:124265933-124265955 TGACAGCCTCTGTCCCCACCAGG - Intronic
1193986184 X:88243180-88243202 TGACAGGAAGTTACCCTACATGG - Intergenic
1195208673 X:102629073-102629095 TAACAGAATTTCTCCCCACAAGG - Intergenic
1195789167 X:108562659-108562681 TGACTCCATGTTTCCCCAAATGG + Intronic
1197514705 X:127411329-127411351 TGACACCATGACTCCACACAAGG - Intergenic
1198015511 X:132606285-132606307 TGACAGTACATTTCCCAACAAGG - Intergenic
1199029556 X:142980884-142980906 GGACAACATGTTTCCTGACATGG - Intergenic