ID: 968754177

View in Genome Browser
Species Human (GRCh38)
Location 4:2406497-2406519
Sequence GTGACAGCATGTTTCCCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 79}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968754177_968754178 10 Left 968754177 4:2406497-2406519 CCTGTGGGGAAACATGCTGTCAC 0: 1
1: 0
2: 1
3: 11
4: 79
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15
968754177_968754179 11 Left 968754177 4:2406497-2406519 CCTGTGGGGAAACATGCTGTCAC 0: 1
1: 0
2: 1
3: 11
4: 79
Right 968754179 4:2406531-2406553 CGCCGTGCTTACCTGATACAGGG 0: 1
1: 0
2: 0
3: 0
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968754177 Original CRISPR GTGACAGCATGTTTCCCCAC AGG (reversed) Intronic
902266624 1:15271517-15271539 GTGTGACCATGTTTCCCCAAAGG - Intronic
904393562 1:30202240-30202262 GATACAGCATGTCTCCCCTCTGG - Intergenic
907493600 1:54826583-54826605 GTGACAGCATTGTTCCCAAGAGG - Intronic
909963675 1:81880758-81880780 GGGACAGAATTTTTCACCACGGG + Intronic
911419748 1:97625657-97625679 GTGACAGCATGTAAACACACAGG + Intronic
921163022 1:212486357-212486379 GTGGCTGCATGGTTCCCCCCAGG - Intergenic
924513439 1:244747344-244747366 GTGACAGCATGTCCCAACACTGG - Intergenic
1064364853 10:14698562-14698584 GTGACAGCATGTTTCTCAAGGGG - Intronic
1066184724 10:32998140-32998162 GACACAGCATTCTTCCCCACTGG - Intronic
1071089195 10:81899214-81899236 TGCACAGCATGGTTCCCCACTGG - Intronic
1076033301 10:127177360-127177382 GTGAAGGCATTTTACCCCACTGG - Intronic
1076202011 10:128566521-128566543 GTGACAGGCTGTTTCACCCCAGG - Intergenic
1078320801 11:10332871-10332893 GAGACAGCATGTGTCAGCACAGG - Intronic
1084086059 11:66856022-66856044 GTGACTTCCTGTTTCCCAACTGG + Intronic
1084289986 11:68157395-68157417 GTGATAGCAACTTTCCACACAGG - Exonic
1084659385 11:70538115-70538137 GTGACCGCCTGAATCCCCACTGG - Intronic
1087181276 11:95144778-95144800 GTGCCAGCCCCTTTCCCCACTGG - Intergenic
1089762974 11:120741856-120741878 GAGACTGCATCTTACCCCACAGG - Intronic
1090119926 11:124015593-124015615 GTGACAGCATTCATCCTCACAGG + Exonic
1093831444 12:23764810-23764832 ATGACAGAATGTTTTACCACTGG + Intronic
1097149710 12:56967638-56967660 GAAACAGAATGATTCCCCACAGG - Intergenic
1097953225 12:65455930-65455952 GTTTCACCATGTTGCCCCACTGG + Intronic
1099179501 12:79460853-79460875 ATCACAGAATGTTTACCCACTGG - Intergenic
1102942065 12:116951912-116951934 TGGAAAGAATGTTTCCCCACTGG - Intronic
1103379669 12:120484155-120484177 ATGACAGCATGTTTGCACGCTGG + Intronic
1105421190 13:20253822-20253844 TGCACAGCATGTTTCCCCAGAGG - Intergenic
1108343631 13:49522430-49522452 GTGAGAGCATCTGACCCCACAGG + Intronic
1108823484 13:54382167-54382189 GTTACAGCATGTGTCACCACAGG - Intergenic
1110732122 13:78890786-78890808 GTGAAAGCATATGTCCACACAGG + Intergenic
1112607161 13:100917825-100917847 GGGACAGCAGCTGTCCCCACGGG - Intergenic
1120327609 14:83050430-83050452 GTGACACCAAGATTCCCCAAAGG - Intergenic
1123860287 15:24458970-24458992 GTGACAGATTGTTTCTCCTCCGG + Intergenic
1126777002 15:52109041-52109063 TTGACAGCATGATTCCCTGCAGG - Intergenic
1127417366 15:58771021-58771043 GTGAGAGGATGTTTTCCTACTGG + Intergenic
1132220274 15:100100153-100100175 GTGTCTGCTTGTTTCCGCACTGG - Intronic
1132744593 16:1431447-1431469 GGGTCAGGATGTTTCCCCGCTGG - Intergenic
1134241619 16:12510923-12510945 ATGGCAGCCTGTCTCCCCACAGG - Intronic
1135466108 16:22686388-22686410 GAAACAGGATGTTTCCCCACTGG - Intergenic
1137952996 16:52801312-52801334 GTGACAGGCTGTTTCCCAACTGG - Intergenic
1143015408 17:3888851-3888873 GTGAGGGCGTGTGTCCCCACAGG + Intronic
1162070054 19:8147930-8147952 CTGACACCCTGTTTCCCCCCCGG - Intronic
1164812733 19:31170695-31170717 TTGAAAAGATGTTTCCCCACAGG + Intergenic
1167094290 19:47365802-47365824 GTGACAGCATATGTCCACCCCGG - Intronic
927077857 2:19597942-19597964 CTGACAGCATGTGTCTCCAGGGG - Intergenic
932879378 2:75486683-75486705 GAGACAGCATGTGTCAGCACAGG - Intronic
936253329 2:110886323-110886345 GTCACAGCATTCTTCCCCACTGG + Intronic
941950636 2:171152072-171152094 GTGACTTCATGATTCCCCACTGG - Intronic
948357101 2:237387486-237387508 GTACCAGCATGATTCGCCACGGG - Intronic
1168795118 20:606132-606154 GGGACAGCATGTTCACTCACAGG + Intronic
1169615312 20:7436989-7437011 GTGACAACATGTTTCCCAAGAGG - Intergenic
1169636494 20:7697907-7697929 TTGACAGCATCCTTCCACACAGG + Intergenic
1172714755 20:36954481-36954503 GTCAGGGCAGGTTTCCCCACAGG - Intergenic
1173062418 20:39675121-39675143 GTGATTCCATGTTGCCCCACAGG + Intergenic
1178703991 21:34857993-34858015 CTGACTGCATTTTTCCCCAGAGG - Intronic
1179128687 21:38614815-38614837 GGGACAGGATATTTCCCCAAAGG - Intronic
1179330080 21:40391635-40391657 GTGACAGGATGTCTCCCCACTGG + Intronic
1179546698 21:42117260-42117282 GTGGCAGCATGTGTCAGCACTGG + Intronic
1181627015 22:24129111-24129133 GGGACAGCAGGTGTCCCCAGAGG + Intronic
1184651228 22:45920294-45920316 GGCAGAGCATGTGTCCCCACCGG + Intergenic
950812045 3:15658391-15658413 GTGACGCCATGCTGCCCCACAGG + Intergenic
954396434 3:50295736-50295758 GGGAAAGCATGTTTCCCCAGGGG + Intronic
956874720 3:73450995-73451017 GTGACGGTAGGTTTCCCCAATGG - Intronic
957355145 3:79073813-79073835 GTGACAGTATGTTTGCTCCCTGG + Intronic
962150461 3:132887381-132887403 CTGACAGCATGTATCCTCACAGG - Intergenic
962695158 3:137940565-137940587 GTGACAGAATATTTTCCCAATGG - Intergenic
968754177 4:2406497-2406519 GTGACAGCATGTTTCCCCACAGG - Intronic
970505125 4:16721333-16721355 GGGACAGCATGTTTTGCCTCTGG + Intronic
980823444 4:138045249-138045271 GGGACAGAATTTTTCACCACGGG + Intergenic
988583260 5:32486845-32486867 GTGACACCATCTTTGCTCACTGG + Intergenic
989458374 5:41668253-41668275 GACACAGCATGTTTCCCCTCTGG - Intergenic
994141411 5:96345833-96345855 GACACAGCTTGTTTCCACACAGG + Intergenic
995737506 5:115317553-115317575 TTGACAGCATGCTTGACCACAGG - Intergenic
997720322 5:136073459-136073481 GTGACAGCAGGTCTCCTCTCTGG - Intergenic
999084456 5:148874690-148874712 ATGACAGCATGATGCCCCAAGGG + Intergenic
1001337006 5:170807141-170807163 GTTACATCATGTTTCCCAGCTGG + Intronic
1002621447 5:180491474-180491496 GTGGCAGCAAGTCTCCCCAGAGG + Intergenic
1018700154 6:166420010-166420032 TTGACAGCACGTTTCTCCAGCGG + Intronic
1020260731 7:6529475-6529497 GTGACAGCCTGGTTCCCACCTGG - Intronic
1021138026 7:16990057-16990079 CAGCCAGCATGTTTACCCACTGG + Intergenic
1024512068 7:50212294-50212316 GTGACAGCAAGTTGCCTCACTGG - Intergenic
1024630253 7:51241395-51241417 GTGAGAACATATCTCCCCACAGG + Intronic
1032475011 7:132205613-132205635 GTGAGATCACCTTTCCCCACTGG - Intronic
1032668599 7:134063260-134063282 CTGACAGAATCTTACCCCACAGG + Intronic
1034515392 7:151573373-151573395 GTTTCACCATGTTGCCCCACTGG + Intronic
1035979995 8:4359927-4359949 GTGAAAGAATGCTTCCCTACTGG + Intronic
1037507309 8:19543628-19543650 GTGGCTGCATGTTTCCCAGCTGG + Intronic
1042200448 8:66275663-66275685 GTGAGAGCTTGTTTCCCTAGGGG - Intergenic
1048124022 8:131612715-131612737 GTCAGTGAATGTTTCCCCACTGG - Intergenic
1061001172 9:127903831-127903853 GGGACAGGATGTTTCCCTCCTGG - Intronic
1187109619 X:16283351-16283373 GTGACCACATGCTTCTCCACAGG - Intergenic
1190047651 X:47125534-47125556 GTAACAGAATGTCTCTCCACTGG - Intergenic
1190110556 X:47586410-47586432 GTGAGAGCAAGTCTCCCCAGCGG + Intronic