ID: 968754178

View in Genome Browser
Species Human (GRCh38)
Location 4:2406530-2406552
Sequence GCGCCGTGCTTACCTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 16
Summary {0: 1, 1: 0, 2: 0, 3: 0, 4: 15}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968754175_968754178 14 Left 968754175 4:2406493-2406515 CCTCCCTGTGGGGAAACATGCTG 0: 1
1: 1
2: 1
3: 14
4: 161
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15
968754177_968754178 10 Left 968754177 4:2406497-2406519 CCTGTGGGGAAACATGCTGTCAC 0: 1
1: 0
2: 1
3: 11
4: 79
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15
968754174_968754178 15 Left 968754174 4:2406492-2406514 CCCTCCCTGTGGGGAAACATGCT 0: 1
1: 0
2: 0
3: 8
4: 166
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15
968754172_968754178 20 Left 968754172 4:2406487-2406509 CCATCCCCTCCCTGTGGGGAAAC 0: 1
1: 1
2: 5
3: 35
4: 388
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15
968754176_968754178 11 Left 968754176 4:2406496-2406518 CCCTGTGGGGAAACATGCTGTCA 0: 1
1: 0
2: 1
3: 14
4: 139
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15
968754173_968754178 16 Left 968754173 4:2406491-2406513 CCCCTCCCTGTGGGGAAACATGC 0: 1
1: 0
2: 0
3: 13
4: 155
Right 968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG 0: 1
1: 0
2: 0
3: 0
4: 15

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968754178 Original CRISPR GCGCCGTGCTTACCTGATAC AGG Intronic
901165565 1:7219355-7219377 CCGCCATGCTTACCTGGCACGGG + Intronic
909481205 1:76130364-76130386 GAGCCATTCTTACCTGAAACTGG - Intronic
1064030048 10:11877783-11877805 ACGCAGTGCTTCCCAGATACTGG - Intergenic
1076548211 10:131260246-131260268 GCTCCGAGCCTACCTGAGACGGG + Exonic
1091225336 11:133953736-133953758 GGGCCGTGCTTAGCTGATTGTGG - Intronic
1122018351 14:98816437-98816459 GCGCCGTGCTGTCCTGTTCCAGG + Intergenic
1143897046 17:10144478-10144500 GATCCTTTCTTACCTGATACTGG - Intronic
1143932741 17:10447123-10447145 GCGCAGAGCTAACCTGATGCAGG - Exonic
1151572856 17:74935931-74935953 GCTCCGGGCTTACCTGAGGCCGG - Intronic
1161238987 19:3211392-3211414 GGGCAGTGCTTACCTGACCCCGG + Intergenic
1173950240 20:46987081-46987103 GCATCCTGCTTAACTGATACAGG + Intronic
954754471 3:52831755-52831777 CCGCCGTCCTTCCCTGATCCAGG - Intronic
968754178 4:2406530-2406552 GCGCCGTGCTTACCTGATACAGG + Intronic
980252456 4:130335502-130335524 GACCAGTGCTTACCTGGTACAGG - Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1201306375 Y:12554212-12554234 GCCCCCTGCTTACCAGAGACAGG + Intergenic