ID: 968755886

View in Genome Browser
Species Human (GRCh38)
Location 4:2416602-2416624
Sequence TGCCCCCATGTGCCTCTGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 287}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968755886_968755891 -4 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755891 4:2416621-2416643 GGCAGCAGGCAGGACCGAGAGGG 0: 1
1: 0
2: 3
3: 42
4: 401
968755886_968755899 27 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755899 4:2416652-2416674 GCGCCGCAGGAGGAGAGGCTGGG 0: 1
1: 0
2: 2
3: 24
4: 280
968755886_968755898 26 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755898 4:2416651-2416673 GGCGCCGCAGGAGGAGAGGCTGG 0: 1
1: 0
2: 2
3: 55
4: 548
968755886_968755893 5 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755893 4:2416630-2416652 CAGGACCGAGAGGGGCTCGAAGG No data
968755886_968755890 -5 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755890 4:2416620-2416642 GGGCAGCAGGCAGGACCGAGAGG 0: 1
1: 0
2: 4
3: 48
4: 552
968755886_968755892 -3 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755892 4:2416622-2416644 GCAGCAGGCAGGACCGAGAGGGG 0: 1
1: 0
2: 1
3: 43
4: 370
968755886_968755897 22 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755897 4:2416647-2416669 CGAAGGCGCCGCAGGAGGAGAGG 0: 1
1: 0
2: 3
3: 10
4: 165
968755886_968755896 17 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755896 4:2416642-2416664 GGGCTCGAAGGCGCCGCAGGAGG 0: 1
1: 0
2: 0
3: 11
4: 105
968755886_968755895 14 Left 968755886 4:2416602-2416624 CCCGGCAGAGGCACATGGGGGCA 0: 1
1: 0
2: 2
3: 33
4: 287
Right 968755895 4:2416639-2416661 GAGGGGCTCGAAGGCGCCGCAGG 0: 1
1: 0
2: 0
3: 6
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968755886 Original CRISPR TGCCCCCATGTGCCTCTGCC GGG (reversed) Intronic
900004741 1:37500-37522 TGCCCTCAGGAGCCTCTGCTTGG - Intergenic
900130272 1:1084424-1084446 TGGCCGCGTGTGCCTGTGCCAGG - Intronic
900409831 1:2507517-2507539 TGCCCCCGGGCTCCTCTGCCAGG + Intergenic
900671888 1:3859464-3859486 TGCCATCATGTGCCTTTACCTGG + Intronic
900705178 1:4076045-4076067 TGGACACAGGTGCCTCTGCCCGG - Intergenic
900961448 1:5923648-5923670 TGCCCCCAGAGGGCTCTGCCCGG - Intronic
901000367 1:6146077-6146099 TGCCCACATGTGGTTCTGCACGG + Intronic
901323878 1:8355778-8355800 TGCCCTTGGGTGCCTCTGCCTGG + Intronic
901646307 1:10718574-10718596 TGGCTGCATGTGCCTCTGGCAGG - Intronic
901835490 1:11921432-11921454 TCCCCCCATGTGCCTGTTCATGG - Intronic
901962969 1:12841807-12841829 TGCAGGCATGAGCCTCTGCCTGG + Intergenic
901990160 1:13106113-13106135 TGCAGGCATGAGCCTCTGCCTGG + Intergenic
903764209 1:25723190-25723212 TGGCACCCTGTGCCTCAGCCAGG + Intronic
904058353 1:27686873-27686895 TGCCCAAGGGTGCCTCTGCCGGG - Intergenic
904163419 1:28537518-28537540 TGCCCTGATGTTCCTCTGCCTGG - Intronic
904323012 1:29708879-29708901 AGACTCCATCTGCCTCTGCCAGG - Intergenic
905385869 1:37603647-37603669 TGCCCCCATGCCCCACTGCAGGG - Intergenic
906804699 1:48769392-48769414 TGCCTCCATGTGCCTCACCAGGG + Intronic
907401838 1:54229163-54229185 TGTCCACATGTGCCTCTGTCTGG - Intronic
907931641 1:59006497-59006519 TGCCCCCATCTTCCTCTGATTGG - Intergenic
908615539 1:65917546-65917568 GGCCCAAATGAGCCTCTGCCTGG - Intronic
909257864 1:73447878-73447900 TCCACCCTTGTGCCTCTGCAGGG + Intergenic
910105275 1:83625339-83625361 TCCACCCATCTTCCTCTGCCAGG - Intergenic
911549579 1:99263346-99263368 TGCCCCCACTTTCTTCTGCCAGG - Intergenic
913190690 1:116410566-116410588 TCACCCCATGTGCATGTGCCAGG + Intergenic
915948855 1:160174326-160174348 AGCCCACATGTTCCTCTGCTTGG - Intronic
916313547 1:163423167-163423189 CGCTCCCATGTGCCCCTGCCGGG - Intergenic
917810190 1:178650996-178651018 TGCCCACTTCTGCCACTGCCTGG + Intergenic
918658686 1:187062200-187062222 TGCCAGCATGTGCTTCTGGCGGG + Intergenic
919333585 1:196203865-196203887 TGCCCCCATGTGACACTGAAAGG - Intergenic
920379167 1:205525979-205526001 TCCCCATTTGTGCCTCTGCCTGG - Intronic
921311924 1:213853137-213853159 TGCCACCCTCTGCCTCTGCCTGG + Intergenic
923239070 1:232062917-232062939 CTTCCCCATGTGGCTCTGCCTGG - Intergenic
1062877369 10:954004-954026 TAAACCCATGTGGCTCTGCCTGG - Intergenic
1063017964 10:2096827-2096849 TGCCTCCCTGTGCTTCTGTCTGG - Intergenic
1064225473 10:13480247-13480269 TGCTCCCACGTGCCCCTGCATGG + Intronic
1064366623 10:14714344-14714366 AGTCCCCCTGTGCCTCTGCATGG + Intronic
1064712532 10:18141156-18141178 TCTCTCCATGTGCCTCTCCCGGG - Intronic
1064778234 10:18804283-18804305 TGCCCCCATCTCCTGCTGCCAGG - Intergenic
1067078071 10:43199255-43199277 TGCCCCTCTGTTCCTCTGCCCGG - Intronic
1067342812 10:45418645-45418667 AGGCCCCACGTACCTCTGCCTGG - Intronic
1068964303 10:62896242-62896264 TGTCCTCATGTGCCTCTGTCTGG - Intronic
1069860022 10:71464741-71464763 TGTTCCCATGTGCCTCTTACTGG + Intronic
1070397833 10:76027203-76027225 GGCCCCTAAGTGCCTGTGCCTGG - Intronic
1070459513 10:76650305-76650327 TTCCCCCATGTGCCTGTGTGTGG + Intergenic
1070696790 10:78569800-78569822 TGGCCCCTTGTGCCTCCTCCAGG + Intergenic
1072418175 10:95266371-95266393 TGCCTACATGTGCCGCAGCCAGG + Intronic
1074847385 10:117410348-117410370 TGACCCCATGTGAATCTCCCTGG + Intergenic
1075265554 10:120997464-120997486 TGCCCTCAAGTTCCTCTGCTTGG - Intergenic
1076366108 10:129921968-129921990 TGCCCTCATGTCCGTCTGCAGGG - Intronic
1076534747 10:131169361-131169383 TGCCCCCTTGTGCCTCAGTCAGG - Intronic
1076746517 10:132517410-132517432 AGCCCCCATGTGACTCAGCCAGG - Intergenic
1077151505 11:1075006-1075028 TGCCCCCAGGACACTCTGCCAGG - Intergenic
1077152205 11:1077432-1077454 GACCCCGATGTGCCTCCGCCAGG + Intergenic
1077722171 11:4639997-4640019 TGAGCCCATGTACCTCTTCCTGG + Exonic
1078904140 11:15668675-15668697 TGGTCCCAACTGCCTCTGCCTGG + Intergenic
1079111705 11:17608822-17608844 TGTTCACATGTGTCTCTGCCTGG - Intronic
1079138947 11:17794967-17794989 TGCCCCCTTCTGCATCTGCTGGG + Intronic
1079675458 11:23220969-23220991 TGCTCCCACTAGCCTCTGCCAGG + Intergenic
1080835600 11:35937565-35937587 CACCCCCATGTACCTGTGCCTGG - Intergenic
1081486345 11:43532786-43532808 TGCCCCCCTTGCCCTCTGCCGGG + Intergenic
1083336126 11:61922883-61922905 TGCCCCCACCTTCCTCTGCTGGG + Intergenic
1083372070 11:62190142-62190164 TGCCCACATGGGCATCTGGCAGG - Intergenic
1083700888 11:64477053-64477075 AGCCCTCATCTGCCTCCGCCTGG + Intergenic
1084148674 11:67278130-67278152 TGCTCCCATCTGACTCTGACAGG - Intronic
1085047729 11:73363163-73363185 TGTCTCCATTTCCCTCTGCCAGG - Intronic
1085818907 11:79771060-79771082 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
1085885948 11:80521981-80522003 TCCTCCCATTTCCCTCTGCCTGG + Intergenic
1090758619 11:129816165-129816187 CGCCCCCGAGTGCCTCTGTCCGG + Intronic
1090943512 11:131409555-131409577 AGGCCCCTTGTGCCTCTCCCAGG - Intronic
1091222173 11:133936102-133936124 TGCCCGGATACGCCTCTGCCCGG + Exonic
1091695141 12:2623336-2623358 TGCCCCCACGAGCCTCTCCATGG + Intronic
1091829951 12:3542435-3542457 TGCCCCCAAGAGCCTCTCACAGG - Intronic
1091862434 12:3797850-3797872 TTCCCCCATGTGGCCCTGCAAGG + Intronic
1091985669 12:4909045-4909067 TGCTGCCATGCGCCTCTGCGGGG + Intergenic
1093743116 12:22710818-22710840 TGTGCCTTTGTGCCTCTGCCAGG + Intergenic
1093773640 12:23047142-23047164 TGGCCCAATGTTACTCTGCCAGG - Intergenic
1094150349 12:27275692-27275714 TACCCACATGTGACACTGCCTGG + Intronic
1095396866 12:41771778-41771800 TGCCTGCAGGTGCCTCTGCAGGG - Intergenic
1097153437 12:56995803-56995825 TGAGCCCATGTGCCTCTTCATGG + Exonic
1097872218 12:64610814-64610836 TGCCTCCACGTGTCTCTGCGGGG + Intronic
1099037825 12:77612373-77612395 TGCCTTCAAGTACCTCTGCCTGG - Intergenic
1099796742 12:87409577-87409599 TTCACCCCTGTGCCTCTGCAGGG - Intergenic
1101245899 12:102884252-102884274 AGCACCCAGGTGCCTCTCCCTGG - Intronic
1102171343 12:110844911-110844933 TGCGTCCAAATGCCTCTGCCTGG + Intergenic
1102986865 12:117285332-117285354 TTCCGCCCTGTGCCTCTTCCAGG - Exonic
1103149260 12:118622818-118622840 TGCCCCCATGTGGCCCTGCAAGG + Intergenic
1106003863 13:25750493-25750515 TGCTTCCATGTTGCTCTGCCCGG + Intronic
1106029831 13:25990073-25990095 TGCTCCCAGGAGCCTCTGGCAGG + Intronic
1106099352 13:26681197-26681219 GGCCCCCATCTGCCTCGGCGAGG + Exonic
1108172751 13:47760075-47760097 TCCTCTCATGTGCCTCTCCCTGG + Intergenic
1113737631 13:112689880-112689902 TGCCCCCTCGCGCCTCCGCCCGG - Intergenic
1115176625 14:30569428-30569450 TTCTGCCATGTTCCTCTGCCTGG + Intronic
1118373363 14:65156605-65156627 GGCCTCCAGGTGCTTCTGCCAGG + Intergenic
1119032025 14:71200273-71200295 TGCCCACATGTGCATAGGCCAGG - Intergenic
1119750637 14:77075133-77075155 GGCCCCCATGGGACTGTGCCAGG + Intergenic
1120059901 14:79970130-79970152 TGCCTCCCTGTGACTCTTCCAGG - Intergenic
1120487942 14:85138287-85138309 TGCCCTCATGTGTCTCTGTGTGG + Intergenic
1122256247 14:100479228-100479250 GGTCTCCATGTGCCTATGCCAGG - Intronic
1122460910 14:101893952-101893974 TGCACCCCTGTGCCTGTGCTGGG - Intronic
1122504882 14:102226215-102226237 GGCTCCCCTGTGCTTCTGCCCGG + Intronic
1122627324 14:103091177-103091199 TACCCCCATGTCCCCCAGCCTGG - Intergenic
1122909558 14:104820741-104820763 AACCTTCATGTGCCTCTGCCTGG + Intergenic
1123054950 14:105564892-105564914 TGACCCCATGTGCCAAAGCCTGG + Intergenic
1123055462 14:105567193-105567215 TGACCCCATGTGCCCAAGCCTGG + Intergenic
1123079392 14:105684471-105684493 TGACCCCATGTGCCAAAGCCTGG + Intergenic
1123079914 14:105687037-105687059 TGACCCCATGTGCCAAAGCCTGG + Intergenic
1125624350 15:41094559-41094581 TGCATCCATGTGCATGTGCCAGG - Intronic
1129726558 15:77904482-77904504 TGGCCCCTTGTGCCTCTGGCAGG + Intergenic
1131464340 15:92643677-92643699 TGACTCCATGTGGCTTTGCCCGG + Intronic
1132448769 15:101953444-101953466 TGCCCTCAGGAGCCTCTGCTTGG + Intergenic
1132557980 16:580807-580829 TGCCCCCAGGCGCGTCTGGCCGG + Intronic
1133318321 16:4897756-4897778 AGCCTCCATGTGCGCCTGCCAGG + Exonic
1134282984 16:12834364-12834386 TGCCCACATGTGCTTCTTTCTGG + Intergenic
1136062585 16:27736882-27736904 TGCCCGCGTGTGCTGCTGCCTGG - Intronic
1137730761 16:50687956-50687978 TGCCACCTGTTGCCTCTGCCTGG + Intergenic
1139387222 16:66580326-66580348 TGCACCCAGCTGCCTCTGCCTGG - Intronic
1141692257 16:85602951-85602973 TGCTTCCCTGTGCCCCTGCCTGG + Intergenic
1142930307 17:3278719-3278741 CGCCCCCATGTACTTCTTCCTGG - Exonic
1142945199 17:3420762-3420784 CGCCCCCATGTACTTCTTCCTGG + Exonic
1143477600 17:7211657-7211679 CGCCTCCATGTGTCTCTGCGTGG - Intronic
1143492646 17:7293368-7293390 TGCAACCATGTGCCTCCGCAGGG + Intronic
1143615853 17:8048659-8048681 GGCCCCCATGTGCCTCTCCTGGG + Exonic
1144587032 17:16493040-16493062 TTCCTCCCCGTGCCTCTGCCAGG + Intergenic
1144761699 17:17710915-17710937 GGCCCCCATGTGTCTGTGCGGGG + Intronic
1144787658 17:17840770-17840792 TGCCCCCCTGCCCCCCTGCCTGG + Intergenic
1146759048 17:35460375-35460397 GGACCCCATGTGCCGCTGCCAGG - Intergenic
1150618414 17:66789998-66790020 CTCCCCATTGTGCCTCTGCCCGG + Intronic
1151954949 17:77375528-77375550 TGCCCCCATGTGCCTCCATCTGG + Intronic
1152336550 17:79702423-79702445 GGCCCCCGCGTGCCTCTCCCAGG - Intergenic
1152555124 17:81049220-81049242 TGACCCCATGCCCCCCTGCCAGG - Intronic
1152587492 17:81195539-81195561 TGGACCCAGGAGCCTCTGCCTGG - Intronic
1152633517 17:81421156-81421178 GGCCCCCAGCTGCCTCCGCCTGG + Intronic
1152664372 17:81558843-81558865 TGCCCCCATGTTTTTCTGGCTGG - Exonic
1154324224 18:13378322-13378344 TGCTCCCATGCCCCTCTGCCGGG - Intronic
1158400483 18:57116985-57117007 TGCCCCCCTGTCCCTCAGCAGGG + Intergenic
1158900413 18:61957170-61957192 TGCCTTCATGTGTCTGTGCCAGG - Intergenic
1160636493 19:79109-79131 TGCCCTCAGGAGCCTCTGCTTGG - Intergenic
1161478286 19:4498253-4498275 TGGCCCCCTGTGGCCCTGCCTGG + Intronic
1162565653 19:11444860-11444882 TGCCCCGACATGCCTCTGCCAGG + Intronic
1162762671 19:12897681-12897703 TACCCTCATGTGCCACTCCCAGG + Exonic
1162804112 19:13127986-13128008 TGGCCCCAAGTGACACTGCCTGG - Intronic
1163688375 19:18725171-18725193 TGCTCCCTAGTGCCCCTGCCTGG + Intronic
1165112830 19:33512315-33512337 TGTCCTCATGTTCCTGTGCCTGG + Intronic
1165697911 19:37915018-37915040 TTCCTCAATTTGCCTCTGCCTGG - Intronic
1165718713 19:38063695-38063717 TGCTCCCGTGGGCCACTGCCCGG - Intronic
1165794146 19:38508975-38508997 TGCCCCCCAGTGCCTCTTACAGG + Intronic
1165896569 19:39145226-39145248 AGCCCCCAGGTGCCTCCCCCAGG + Intronic
1166107059 19:40602613-40602635 AGCCCCAACGTGCCTGTGCCAGG + Intronic
1166381435 19:42357236-42357258 GGGCCCACTGTGCCTCTGCCAGG + Intronic
1166840100 19:45692096-45692118 TGCCCCCGTGTGGTTCTGACTGG - Exonic
1167103677 19:47418875-47418897 TGCCCCCAAGTGTCTCTTCCTGG - Intronic
925263925 2:2551269-2551291 TGCACCTCTCTGCCTCTGCCAGG - Intergenic
925909743 2:8565947-8565969 AGCCCTCTTGTGCATCTGCCGGG - Intergenic
927179354 2:20433467-20433489 CTCCCCCTTGTGCCTCTTCCGGG - Intergenic
927936804 2:27080710-27080732 GGCCTCCTTCTGCCTCTGCCAGG + Exonic
928307093 2:30179193-30179215 TGCCCACATGAGCATCTGCAAGG + Intergenic
929965787 2:46535622-46535644 TGCCCTGATGTGCCACTTCCTGG + Intronic
932497583 2:72154044-72154066 TGCCTGCATCTGGCTCTGCCAGG - Intergenic
932606585 2:73169645-73169667 TGTCCCCATGAGCTCCTGCCTGG - Intergenic
933190021 2:79324217-79324239 TGCCCCTATGTGGCCCTGCCTGG - Intronic
933925841 2:87090790-87090812 TGTCCCCATGAGCTCCTGCCTGG + Intergenic
934490661 2:94760406-94760428 TGGCCCCATATGCCCCAGCCTGG + Intergenic
935367257 2:102307795-102307817 TGCTCCCAAGTACCTCTGCAAGG + Intergenic
935663025 2:105486187-105486209 GGCCCACAGGTGCCACTGCCTGG - Intergenic
936383911 2:112011989-112012011 TGCCCCCACTGGGCTCTGCCTGG - Intronic
936947740 2:117945666-117945688 TGCACCCTTATGCCCCTGCCTGG - Intronic
937076068 2:119107833-119107855 TGCCCCCATATGCTGCTGACAGG - Intergenic
937861425 2:126714446-126714468 TGCCCCCATGATCCTCTGTGAGG - Intergenic
938967073 2:136398000-136398022 TGCCCCCAGGTGTGTTTGCCTGG + Intergenic
939877637 2:147595891-147595913 TCCCCCCAGGTACCCCTGCCTGG + Intergenic
946721214 2:222610574-222610596 TGGCCCCAAGTGCCTCAGCAAGG + Intronic
947461601 2:230308567-230308589 AGCCCCCATGTGGCCCTGCGTGG - Intronic
947855597 2:233321831-233321853 TGCTCCCATGTACCTGTGCTGGG + Intronic
948368512 2:237473652-237473674 AGCCCTCATGTGCCTCTCTCCGG + Intergenic
1168750222 20:276901-276923 GGCCCCCAGGTGCCTCTTCCTGG + Intronic
1170149193 20:13210963-13210985 TTCTCCTATGTGGCTCTGCCTGG + Intergenic
1170791887 20:19515570-19515592 TACCCCTCTGTGCCTCTGCCTGG + Intronic
1171139012 20:22724508-22724530 TGCCCTGATGTGCCTCTGGGAGG - Intergenic
1173230261 20:41190183-41190205 TGCACCCCTGTGCTTCCGCCTGG - Intronic
1174078888 20:47957173-47957195 AGCCTCCAGGTGCCCCTGCCTGG + Intergenic
1174597283 20:51693973-51693995 TGCCCGCATGGGCTTCTGCAGGG + Intronic
1174865562 20:54132042-54132064 AGACGCCATGTGGCTCTGCCTGG - Intergenic
1175831411 20:61967024-61967046 TGGCCCCATGTGCCCGTGCAAGG + Intronic
1176182718 20:63758445-63758467 CTTCCCCATGTGTCTCTGCCTGG + Intronic
1179332951 21:40423182-40423204 TGCTCGCATATGCCACTGCCTGG - Intronic
1179981084 21:44896384-44896406 TGCGCCCCTGTGCATCTGGCCGG - Intronic
1180054683 21:45351725-45351747 TGCCTCCCTGTTCCACTGCCAGG - Intergenic
1180674952 22:17580757-17580779 TGCCCCCATGGGCCGCCACCAGG - Intronic
1181008912 22:20028854-20028876 TTTCCCCATGGGCCTCTGCAAGG + Intronic
1181421589 22:22803092-22803114 AGCCCCCGTCTGCATCTGCCTGG + Intronic
1182293561 22:29299971-29299993 AGCCCCCAGGTGCCCCTTCCTGG - Intronic
1182293584 22:29300041-29300063 AGCCCCCAGGTGCCCCTTCCTGG - Intronic
1182490578 22:30668721-30668743 AGCCCCCAGTTCCCTCTGCCTGG + Intronic
1182527708 22:30931767-30931789 TGCCCCCATGTCCAGCTACCCGG + Intronic
1182723735 22:32426127-32426149 TGCCTGAATGTGCCTCTTCCTGG - Intronic
1183026711 22:35070722-35070744 TGCCCCAAGGTGGCACTGCCAGG - Intronic
1183259723 22:36786643-36786665 TGCCCTCCTGTCCCTCTACCGGG - Intergenic
1183474006 22:38026086-38026108 TCCCCTCAGGTGCCCCTGCCTGG + Intronic
1183540472 22:38426749-38426771 TGCCCACAAGAGCCTCTGCCGGG - Exonic
1183702531 22:39458077-39458099 TCTCCACATTTGCCTCTGCCTGG - Intronic
1183746582 22:39695230-39695252 TGTGCCCATGTCCCTCTGCGTGG - Intergenic
1183977828 22:41523462-41523484 TGCCCCCCAGTGCCTCTGCAGGG - Intronic
1185150797 22:49162907-49162929 TGCCACCACGAGCCTCCGCCGGG - Intergenic
1185203767 22:49524696-49524718 TGTCCCCATCTTCCTCTCCCTGG + Intronic
949826003 3:8166674-8166696 TGGTTCCATTTGCCTCTGCCTGG + Intergenic
950510758 3:13425063-13425085 TGCCACCTTCAGCCTCTGCCAGG + Intergenic
952210269 3:31223055-31223077 TGCCAACATGTGGCCCTGCCAGG - Intergenic
952423776 3:33153929-33153951 TGTCCTCATCTGCCTCTGTCCGG + Exonic
953645158 3:44746981-44747003 TGCCTCCATGTGCTTCCTCCTGG + Intronic
953666789 3:44931244-44931266 CACCCCCATGTGCTCCTGCCAGG - Intronic
954576252 3:51677942-51677964 TACACCCATGAGCCCCTGCCAGG - Intronic
954674648 3:52309078-52309100 TTCCCCCTTGTGCCTCTCTCAGG + Intergenic
955356756 3:58238078-58238100 TGCCCCCACCTCCCGCTGCCTGG + Intronic
955473693 3:59313529-59313551 TGCCCCCATCTGCCTCTCTGTGG - Intergenic
956724846 3:72148547-72148569 TGCCCCCAGGTGTCCCAGCCAGG + Intergenic
957320117 3:78619599-78619621 TCCCTCCACCTGCCTCTGCCAGG - Intronic
961450420 3:126999969-126999991 TGCCCCCACCTGCTTCTGCCTGG - Intronic
962089747 3:132230704-132230726 TGCCTCCATCTGCATCTACCTGG + Intronic
966396340 3:179507585-179507607 TGCCTCCAGCTCCCTCTGCCTGG + Intergenic
968007222 3:195251321-195251343 TGACCCCATGTGTTTCTGACAGG + Intronic
968501311 4:951519-951541 TGCCCCCATCTGGCCCTGCAGGG + Intronic
968755886 4:2416602-2416624 TGCCCCCATGTGCCTCTGCCGGG - Intronic
968910767 4:3476032-3476054 TGCCCCCACCTGCCCCAGCCTGG + Intronic
968982973 4:3860671-3860693 ACCCACCATGGGCCTCTGCCTGG - Intergenic
969146674 4:5130229-5130251 TGCCCTGCTGTCCCTCTGCCTGG - Intronic
969166629 4:5321804-5321826 TGCCCCCAACTGCCTCTGCCTGG + Intronic
970312636 4:14798568-14798590 TCCACCCATGTGGCTCTGCAGGG + Intergenic
971349687 4:25844805-25844827 TGCCTGCATGGGGCTCTGCCTGG + Intronic
973725745 4:53773928-53773950 TGCCCCCTTTAGCTTCTGCCAGG - Intronic
979195588 4:117916733-117916755 AGCCCCCATCTGGCTTTGCCTGG - Intergenic
982761722 4:159292342-159292364 TACTCCCATGTGCTTCTGCAGGG + Intronic
985551223 5:534550-534572 TGCGCCCAAGTGCCTCTGCAGGG - Intergenic
985746652 5:1652021-1652043 TGACCCGAAGAGCCTCTGCCAGG + Intergenic
985902610 5:2808455-2808477 TGCACCCCTGAGTCTCTGCCTGG - Intergenic
989842648 5:46099329-46099351 TGCCCCCAGGTGCCTATACTAGG - Intergenic
991618295 5:68518817-68518839 TCCCCTCATGTGTCTCTGGCTGG - Intergenic
991860809 5:71011403-71011425 TACCCCCTGGTGCCACTGCCAGG - Intronic
991953381 5:71968678-71968700 TGTTCCCATGTGACTGTGCCAGG + Intergenic
992725666 5:79604763-79604785 TGCACCCATGTGCATCTGTGAGG - Intergenic
994549199 5:101208964-101208986 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
997504127 5:134402573-134402595 TGCACCTTTGTGCTTCTGCCTGG + Exonic
997912847 5:137893461-137893483 TGCCCCAATGTGCATATGCCAGG - Intronic
998337477 5:141385768-141385790 TGCCTCCATGTACCTCAGCTTGG + Intronic
998391374 5:141788984-141789006 TCAACCCATGTGCCTCTTCCAGG + Intergenic
999450111 5:151671614-151671636 CACCCCCATGTGCGTGTGCCAGG - Exonic
1000128844 5:158275016-158275038 TACTCACATGTACCTCTGCCTGG - Intergenic
1001853176 5:174987225-174987247 TTCCACCATGTGCCTCACCCAGG - Intergenic
1003053364 6:2798955-2798977 TGGCCTCATGGGCCTCTGCACGG - Intergenic
1005336569 6:24802574-24802596 TGCCTCCAGTTGCCTCTGCCTGG + Intronic
1006598475 6:35210600-35210622 TGCCTACATGTGCCAGTGCCAGG + Intergenic
1007228038 6:40328492-40328514 TGCACCAATGTCCCTCTCCCAGG + Intergenic
1007248821 6:40482075-40482097 AGCCCCCATGTCACACTGCCTGG - Intronic
1007838960 6:44700070-44700092 TTCCCCCATCTGCGTCTGTCTGG + Intergenic
1007840933 6:44715423-44715445 TTTCCCCACGTGCCTCCGCCTGG + Intergenic
1012973902 6:105759153-105759175 TGCCCCCACCTTCCTCTTCCAGG + Intergenic
1015439623 6:133233167-133233189 TGACCCCATGTGCCACTTCCTGG + Intergenic
1015557291 6:134476364-134476386 TGCAGCCATGTCCCTCTGCAGGG - Intergenic
1016647537 6:146427115-146427137 TGCCAACATGAGCCTCTGCTGGG + Intronic
1017392711 6:153958689-153958711 TGACTCCATGTGCCTCTGCGTGG + Intergenic
1018016435 6:159716468-159716490 TCACCTCATGTGCCTCTCCCCGG + Intronic
1019196115 6:170283982-170284004 TGCCTACCTGTGCCGCTGCCAGG - Exonic
1019515990 7:1440430-1440452 GGCCCCCATGTCCCTCAGGCAGG + Intronic
1019732419 7:2635258-2635280 TGCCCTCAAGGGCCCCTGCCCGG - Intronic
1019773329 7:2897250-2897272 TCCCGCCATGTGACCCTGCCTGG + Intergenic
1020979704 7:15052611-15052633 TTCACCCATGTGGCTCTGCAGGG + Intergenic
1021195061 7:17665477-17665499 TGCCCACATGCCCCGCTGCCTGG + Intergenic
1022472607 7:30691060-30691082 TGACCCCGTGAGCCACTGCCAGG + Intronic
1024209608 7:47192202-47192224 TGCCACCGTGTCCCTCTGCCTGG + Intergenic
1024823295 7:53359757-53359779 TGCCCCCATGTACCTTTTACTGG + Intergenic
1026045797 7:66904489-66904511 TGCCCCCAGGGGCCTACGCCAGG - Intergenic
1026846401 7:73701141-73701163 TGCTCCCACCTTCCTCTGCCTGG - Intronic
1027216182 7:76185469-76185491 TGCCACCCTGTCCCTCTGACTGG + Intergenic
1027220563 7:76211264-76211286 TGCCTCCTTGTGCCTCTGCCTGG - Intronic
1028815860 7:95143649-95143671 TTCTCACATGGGCCTCTGCCAGG - Intronic
1029260518 7:99299526-99299548 TGAGCCGAAGTGCCTCTGCCCGG - Intergenic
1029457890 7:100680087-100680109 GGCCCCCACCTGCCTCTCCCTGG - Exonic
1033596963 7:142865560-142865582 AGCCCCCGTTTGCCCCTGCCTGG + Exonic
1034212956 7:149381222-149381244 TTCACCCATGTGGCTCTGCATGG - Intergenic
1035434680 7:158850364-158850386 TGCCTCCCTGTGCTTTTGCCTGG - Intergenic
1040545773 8:48396943-48396965 GGCCCCCACATCCCTCTGCCTGG + Intergenic
1041092435 8:54315683-54315705 TGCCTGCATGGGTCTCTGCCTGG + Intergenic
1041321768 8:56621253-56621275 TGCTCACATCTGCTTCTGCCAGG - Intergenic
1043009298 8:74861873-74861895 TGCCTCCATCTTCCGCTGCCTGG - Intergenic
1048880786 8:138870989-138871011 TGTCCCCACATCCCTCTGCCTGG - Intronic
1049253928 8:141604043-141604065 AGGCCCCTTGAGCCTCTGCCCGG - Intergenic
1049412763 8:142480837-142480859 TGCCCCCATGTCTCTGGGCCAGG + Intronic
1049631049 8:143657865-143657887 TGACTCCATGTGCCACTTCCTGG + Intergenic
1049887435 9:37282-37304 TGCCCTCAGGAGCCTCTGCTTGG - Intergenic
1052915742 9:33923342-33923364 TAACCCCATGTGTCTCTGTCTGG + Intronic
1053431266 9:38043271-38043293 TTCCCCACTGTGCCTATGCCTGG + Intronic
1055337525 9:75247630-75247652 TCCACCCCTGTGGCTCTGCCAGG - Intergenic
1055408016 9:75995077-75995099 TTCTCCCATGTCCCTCTGCTGGG + Intronic
1055994097 9:82138920-82138942 TTTCCACCTGTGCCTCTGCCAGG + Intergenic
1056275201 9:84987999-84988021 AGCCCCCATGGGGCTCTGCAGGG + Intronic
1057445603 9:95112377-95112399 TTCCTGCATGTTCCTCTGCCTGG + Intronic
1059281261 9:113136046-113136068 TGACCCCATCTGCCTCAGCCTGG + Intergenic
1059435769 9:114275418-114275440 GGCTCCCATGTGTCCCTGCCTGG - Intronic
1060456923 9:123807326-123807348 TGTCCCCATCTGCCTCTTCCAGG + Intronic
1060668198 9:125445719-125445741 AGCCCCCATGGGCCTGAGCCTGG - Intronic
1060875811 9:127082933-127082955 TGCCCAGATGGGCCTCTTCCTGG - Intronic
1061087210 9:128406066-128406088 TACCCCCAAGAGGCTCTGCCCGG + Intergenic
1061418041 9:130458609-130458631 CGCCTCCATCTCCCTCTGCCCGG - Intronic
1061448172 9:130653606-130653628 TGCTCCCATGTGTGTGTGCCAGG - Intergenic
1062024455 9:134333855-134333877 GGCAGCCCTGTGCCTCTGCCGGG + Intronic
1062103779 9:134741761-134741783 TGGCCTCCTGTGCCTCTGTCTGG + Intronic
1062375621 9:136260584-136260606 CCCCCCCATCTGACTCTGCCTGG + Intergenic
1189348865 X:40262427-40262449 TGCTCCTATCTGCCTCTGGCTGG + Intergenic
1190297125 X:49034238-49034260 TGCCCCCAGCTGCCTGTGTCAGG - Exonic
1190500866 X:51077215-51077237 AGTCCCCATGTGCCTCTTCCTGG + Intergenic
1192147265 X:68689919-68689941 TGTCCACATCTGCCTCTGCTTGG + Intronic
1194548844 X:95272177-95272199 TCCCCCCATGTGGCTCTGCAGGG + Intergenic
1194559593 X:95403930-95403952 TTCCCCCAGGTGCCTGTCCCAGG - Intergenic
1197782648 X:130172614-130172636 TGCCCACAGGTGCCGCTGCTCGG - Intronic
1198715089 X:139549898-139549920 TGCCCACTTGTTCTTCTGCCTGG + Intronic
1200054743 X:153454362-153454384 TGCCCACCTGGCCCTCTGCCTGG - Intronic
1200181883 X:154155712-154155734 TCCCCCACAGTGCCTCTGCCTGG + Intronic
1200187532 X:154192826-154192848 TCCCCCACAGTGCCTCTGCCTGG + Intergenic
1200193182 X:154229966-154229988 TCCCCCACAGTGCCTCTGCCTGG + Intronic
1200198937 X:154267770-154267792 TCCCCCACAGTGCCTCTGCCTGG + Intronic
1200684075 Y:6244832-6244854 TCACCCCATGTGCCTCCTCCTGG + Intergenic
1201048560 Y:9909554-9909576 TCACCCCATGTGCCTCCTCCTGG - Intergenic
1202104569 Y:21349212-21349234 TCCAAACATGTGCCTCTGCCTGG - Intergenic