ID: 968756063

View in Genome Browser
Species Human (GRCh38)
Location 4:2417274-2417296
Sequence AGGGCGCATCTGGGCGTCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 67
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 62}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968756063_968756068 -8 Left 968756063 4:2417274-2417296 CCTCGGACGCCCAGATGCGCCCT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 968756068 4:2417289-2417311 TGCGCCCTGGACCCTGCGCCGGG 0: 1
1: 0
2: 1
3: 17
4: 208
968756063_968756067 -9 Left 968756063 4:2417274-2417296 CCTCGGACGCCCAGATGCGCCCT 0: 1
1: 0
2: 0
3: 4
4: 62
Right 968756067 4:2417288-2417310 ATGCGCCCTGGACCCTGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968756063 Original CRISPR AGGGCGCATCTGGGCGTCCG AGG (reversed) Intronic
900379387 1:2376339-2376361 AGGGCTCTTCAGGGCGTCCGGGG + Intronic
902186709 1:14730899-14730921 AGTGGGCATCTGGGAGTCCCTGG - Intronic
902272403 1:15314267-15314289 AGGGTGGATCTGGGGGTCCAAGG + Intronic
903646773 1:24900860-24900882 AGGAGGCAGCTGGGGGTCCGCGG + Exonic
905017002 1:34784822-34784844 CGGGCGCATCTGGCTGTCCGTGG + Exonic
922335835 1:224617482-224617504 AGGGCCCGACTGGGCGTCCCGGG + Intronic
1067145422 10:43690240-43690262 AGGGCGCTGCGGGGCGGCCGTGG + Intergenic
1073637457 10:105214495-105214517 AGGGCACATCTGGGCCTTGGCGG - Exonic
1075400151 10:122155194-122155216 AGGGCGGATCTGCGCCTCTGTGG - Intronic
1076724019 10:132405073-132405095 TGGGCGCGGCTGGGGGTCCGGGG - Exonic
1076802326 10:132836326-132836348 AGGGCCCTGCTGGGCGTCCATGG - Intronic
1077196603 11:1284095-1284117 AGGGCGCATCAGGGCCCCCAGGG + Intronic
1079094987 11:17504318-17504340 AGGGCCCATCTTGGCCTCTGTGG + Intronic
1084537182 11:69764110-69764132 TGGGCTCATCTGGGGGTCTGAGG - Intergenic
1090402670 11:126458952-126458974 CTGGCTGATCTGGGCGTCCGTGG + Intronic
1103562494 12:121799976-121799998 AGGGCGGATCAGGGCGTTGGGGG + Intronic
1119480745 14:74956110-74956132 TGCGCGCATCTGTGTGTCCGAGG + Intergenic
1122657754 14:103273598-103273620 GGGGCGGATCTGGGACTCCGAGG + Intergenic
1126113299 15:45187776-45187798 CGGGAGCACCTGGGCTTCCGCGG - Intronic
1127864880 15:63024123-63024145 AGGGCTCATCTGGGTATGCGGGG - Intergenic
1141132556 16:81445576-81445598 AGGGCGCATCTCGGGCCCCGAGG - Intronic
1148262061 17:46192968-46192990 AGGGCGGCTCCGGGCGTCGGGGG - Intronic
1152684081 17:81685200-81685222 CGGGAGCATCTGGGCGAACGGGG + Intronic
1154194203 18:12254122-12254144 GGGGAGCATCTGGGCTTCCAAGG + Intergenic
1156453516 18:37279985-37280007 AGGGAGCATCTGGGGTTCTGTGG + Intronic
1161420284 19:4172953-4172975 AGGGCGCACCCGGGGCTCCGGGG - Exonic
1164834477 19:31348987-31349009 AGAGCGCGGCGGGGCGTCCGGGG + Intronic
1165023668 19:32943875-32943897 GGGACGCATGTGGGGGTCCGTGG + Intronic
1165100179 19:33434596-33434618 AGGGCGCATCTGGCCTCCCTTGG + Intronic
1168721802 19:58558469-58558491 AGGCCGCAGCTGCGGGTCCGAGG - Exonic
931428954 2:62195212-62195234 AGGGCGCATCGGTGGGCCCGGGG + Intergenic
932500543 2:72179305-72179327 AGGTCGCCTCTGTGGGTCCGGGG + Exonic
938368949 2:130756673-130756695 AGGGCGCCTCTGGGCGGTCCTGG - Intronic
940317003 2:152336188-152336210 GGGGCGCATGTGGCCGGCCGCGG + Intronic
944717821 2:202392700-202392722 AGGGAGCATCTGGCCGGGCGCGG + Intronic
948489419 2:238302942-238302964 TGGGCGCCTCTGGGCATCAGAGG - Intergenic
948646208 2:239406692-239406714 AGGGCGCATCTGCGGGGCCCAGG + Intergenic
1168779264 20:475060-475082 AGGGTGCTTCTGGGGGTCCTCGG - Intronic
1173247877 20:41348680-41348702 AGTGCCCAGCTGGGAGTCCGAGG - Exonic
1176284997 21:5014712-5014734 ATGGCGCATATGGGTGTCCAGGG - Intergenic
1179872184 21:44248763-44248785 ATGGCGCATATGGGTGTCCAGGG + Intronic
1180109719 21:45642422-45642444 GAGGCGCCTCTTGGCGTCCGTGG - Intergenic
1180154223 21:45970469-45970491 AGGAGGCATCAGGGCCTCCGTGG - Intergenic
1181068928 22:20320559-20320581 AGTCCCCATCTGGGCCTCCGTGG + Intergenic
1181570936 22:23767577-23767599 AGGGCGCGGCTGGGCGGCTGCGG + Exonic
1182747047 22:32614227-32614249 AGGAGGAATCTGGGCTTCCGTGG + Intronic
963133205 3:141876917-141876939 GGGCAGCAGCTGGGCGTCCGGGG + Intronic
968560387 4:1277846-1277868 ATGCCGCATCTGGGCCTCCCGGG - Intergenic
968593288 4:1470383-1470405 AGGGGGCAGCTGAGCGGCCGTGG + Intergenic
968756063 4:2417274-2417296 AGGGCGCATCTGGGCGTCCGAGG - Intronic
968803122 4:2756014-2756036 CTGGCGCATCTGGGCCTCGGCGG + Exonic
971367844 4:25991909-25991931 AGGGTGCATCTGGGAGGCAGAGG - Intergenic
985642180 5:1068867-1068889 AGGGCGCGTCTGTGCGCACGAGG - Intronic
988216896 5:28286801-28286823 AGGGGCCATCTGGGCTTCCTGGG + Intergenic
999251510 5:150185114-150185136 AGGGCCAATCTGAGCGTCAGGGG + Intergenic
1002524169 5:179806436-179806458 CTGGCGCACCTGGGCGTCGGCGG - Intronic
1019344484 7:522671-522693 GGCGCGCGTCTGGGAGTCCGTGG + Intergenic
1021412725 7:20346438-20346460 AGGGTGCATCTGGGAGTCTTGGG + Intronic
1021633153 7:22665697-22665719 TGGGCGCGTCTGGGCCACCGGGG - Intergenic
1024930737 7:54664710-54664732 CGGGCGGATCTGCGGGTCCGCGG + Intergenic
1024979164 7:55143203-55143225 AGGGTTCAACTGGGCGTCCTAGG + Intronic
1027390107 7:77696125-77696147 ATGGCAGATCTGGGGGTCCGGGG + Intergenic
1051936405 9:22447339-22447361 CGGGCGCACTTGGGCGTCCGCGG - Exonic
1061537346 9:131258363-131258385 GGGGCTCAGCTGAGCGTCCGTGG + Exonic
1061877880 9:133554064-133554086 AGGGCCCACCTGGGCGTGCCTGG + Intronic
1062629027 9:137455387-137455409 AGGGCCCAGCAGGGCGTCTGGGG + Intronic
1189418171 X:40832856-40832878 CTGGCGCATCTGGGCCTCCGCGG + Intergenic