ID: 968756084

View in Genome Browser
Species Human (GRCh38)
Location 4:2417353-2417375
Sequence CGCTGCAGCCGGAGCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 371}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968756084_968756095 3 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756095 4:2417379-2417401 ACGAGCCCCAGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 12
4: 178
968756084_968756094 2 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756094 4:2417378-2417400 CACGAGCCCCAGGCGGGCGGCGG No data
968756084_968756091 -5 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756091 4:2417371-2417393 CAGCGGGCACGAGCCCCAGGCGG 0: 1
1: 0
2: 3
3: 19
4: 185
968756084_968756092 -4 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756092 4:2417372-2417394 AGCGGGCACGAGCCCCAGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 200
968756084_968756100 28 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756100 4:2417404-2417426 CGCAGCGCCCGCAGTGCGACTGG 0: 1
1: 0
2: 0
3: 10
4: 51
968756084_968756090 -8 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756090 4:2417368-2417390 CTGCAGCGGGCACGAGCCCCAGG No data
968756084_968756093 -1 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756093 4:2417375-2417397 GGGCACGAGCCCCAGGCGGGCGG 0: 1
1: 0
2: 5
3: 14
4: 271
968756084_968756096 4 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756096 4:2417380-2417402 CGAGCCCCAGGCGGGCGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968756084 Original CRISPR CGCTGCAGCCGGAGCAGGGC CGG (reversed) Intronic