ID: 968756084

View in Genome Browser
Species Human (GRCh38)
Location 4:2417353-2417375
Sequence CGCTGCAGCCGGAGCAGGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 422
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 371}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968756084_968756100 28 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756100 4:2417404-2417426 CGCAGCGCCCGCAGTGCGACTGG 0: 1
1: 0
2: 0
3: 10
4: 51
968756084_968756092 -4 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756092 4:2417372-2417394 AGCGGGCACGAGCCCCAGGCGGG 0: 1
1: 0
2: 2
3: 22
4: 200
968756084_968756091 -5 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756091 4:2417371-2417393 CAGCGGGCACGAGCCCCAGGCGG 0: 1
1: 0
2: 3
3: 19
4: 185
968756084_968756096 4 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756096 4:2417380-2417402 CGAGCCCCAGGCGGGCGGCGGGG 0: 1
1: 0
2: 2
3: 37
4: 294
968756084_968756093 -1 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756093 4:2417375-2417397 GGGCACGAGCCCCAGGCGGGCGG 0: 1
1: 0
2: 5
3: 14
4: 271
968756084_968756094 2 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756094 4:2417378-2417400 CACGAGCCCCAGGCGGGCGGCGG No data
968756084_968756090 -8 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756090 4:2417368-2417390 CTGCAGCGGGCACGAGCCCCAGG No data
968756084_968756095 3 Left 968756084 4:2417353-2417375 CCGGCCCTGCTCCGGCTGCAGCG 0: 1
1: 0
2: 3
3: 47
4: 371
Right 968756095 4:2417379-2417401 ACGAGCCCCAGGCGGGCGGCGGG 0: 1
1: 0
2: 1
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968756084 Original CRISPR CGCTGCAGCCGGAGCAGGGC CGG (reversed) Intronic
900127364 1:1074468-1074490 CGCTGCAGCCTGGGCAGGTCTGG + Intergenic
900393424 1:2443566-2443588 GGCTGCGGCGGGCGCAGGGCGGG + Intronic
900464496 1:2818451-2818473 CCCTGCAGCCCCTGCAGGGCAGG - Intergenic
901038713 1:6351531-6351553 CGCTGCAGCTGGTGCGGGGAAGG - Intronic
901142203 1:7042444-7042466 TGGAGCAGCTGGAGCAGGGCTGG + Intronic
901155833 1:7137619-7137641 AGCTTCAGCTGGAGCAGAGCAGG - Intronic
901443540 1:9293319-9293341 CGCTGCCGCCGCTGCAGGGCAGG + Intronic
901828606 1:11878773-11878795 CGCTGCAGCCGCAGGAAGCCCGG - Intergenic
903279709 1:22243661-22243683 GGCAGCAACCTGAGCAGGGCAGG - Intergenic
904113489 1:28144916-28144938 AGCTGCAGCGGATGCAGGGCTGG - Intergenic
904236936 1:29122423-29122445 CGCTGCGGGCGGAGGAGGTCTGG - Exonic
904701735 1:32362026-32362048 CGGTCCAGGCGGAGCCGGGCAGG + Exonic
904822864 1:33256587-33256609 CCCGGCGGCCCGAGCAGGGCCGG - Exonic
905584350 1:39105340-39105362 CGCTGCAGCCGCGCCGGGGCGGG + Intronic
905862634 1:41361475-41361497 CGCTGGAGCCGGAGCGGCGGCGG + Intergenic
907430039 1:54406317-54406339 CGGCGCAGGCGGAGCCGGGCGGG - Exonic
909024625 1:70468188-70468210 TGCTGCAGCAGTGGCAGGGCAGG - Intergenic
911176143 1:94820320-94820342 GGCTGGAGCCGGGGCCGGGCCGG - Intronic
912904021 1:113684251-113684273 CTGGGCAGCCTGAGCAGGGCGGG - Exonic
914490101 1:148146439-148146461 CGATGCGGCCGGGGCAGGGAGGG - Intronic
914921608 1:151851210-151851232 TGTTGCAGCCGGAGAAGGGAGGG + Intronic
915049187 1:153049658-153049680 CACTGCAGCAGTGGCAGGGCAGG - Intergenic
915285103 1:154847316-154847338 CTCTGGAGCCTGAGCTGGGCCGG + Intronic
919936681 1:202255493-202255515 CTCTGCAGCCTGAGCGGGGAAGG - Intronic
921089654 1:211830672-211830694 CGCCACAGCCGGAGCGGGGCAGG - Exonic
921390433 1:214608774-214608796 CGATGCGGCCGGGGCAGGGCGGG + Intronic
922513138 1:226186439-226186461 CGCGGCGGCTGGAGCAGCGCTGG - Exonic
922723470 1:227910706-227910728 GGCGGCAGCTGCAGCAGGGCTGG - Intergenic
922786724 1:228286599-228286621 GGCTGCAGAGGGAACAGGGCAGG - Intronic
923461654 1:234214324-234214346 CGCGGCAACCGGAGCCCGGCGGG + Intronic
1063369621 10:5512583-5512605 CACTGCAGCCAGCGCAAGGCCGG - Intergenic
1063420539 10:5909282-5909304 CGCTGCTGCCGGGGTAGGTCTGG + Exonic
1063586797 10:7359303-7359325 AGCTGCATCTGGAGCAGGCCAGG + Intronic
1063623061 10:7666876-7666898 CCCAGCAGCAGGAGCATGGCGGG + Exonic
1065140382 10:22714103-22714125 AGCTGCAGCCGGAGGAGGAGGGG + Intronic
1066644802 10:37595605-37595627 GGCTGCAGCCAGAGGAGGCCAGG - Intergenic
1067566822 10:47345628-47345650 CGCTGCAGGTGCTGCAGGGCTGG + Intergenic
1069019171 10:63466092-63466114 CGCTGCCGCCTCCGCAGGGCCGG - Intergenic
1069546738 10:69334524-69334546 CGCTGCCGGGGGAGAAGGGCTGG + Intronic
1069725554 10:70575590-70575612 GGCTGCTGACTGAGCAGGGCAGG + Intergenic
1070162441 10:73874303-73874325 CGCAGCGGCCGGTGCAGGGCCGG + Intronic
1070879323 10:79844364-79844386 GGCTGCAGCCCGAGTGGGGCCGG + Exonic
1071567702 10:86680278-86680300 AGCTGCAGCAGGGGCAGGGATGG - Intronic
1071602246 10:86964061-86964083 CCATGCAGCCATAGCAGGGCTGG - Intronic
1072034630 10:91552667-91552689 GGATGCAGCTGGAGCCGGGCTGG - Intergenic
1072257067 10:93630710-93630732 CGCTGCAGCCTGGGGAAGGCTGG - Intronic
1073098939 10:100997183-100997205 CGCTGGAGCAGGAGCGGGGCCGG + Intronic
1073099224 10:100998268-100998290 AGCTGCCGCCTGAGCTGGGCAGG + Intronic
1073432274 10:103494247-103494269 GGCTGCAGCCGGGGGCGGGCGGG - Exonic
1073572138 10:104589554-104589576 GGCGGCAGCAGGAGCAGAGCTGG + Intergenic
1074591962 10:114821993-114822015 CCCGGCAGCCGCAGCAGGGGCGG + Exonic
1074853244 10:117455462-117455484 CACAGCAGCTGGAGCAGGCCTGG - Intergenic
1075501701 10:122980601-122980623 GGCTGCAGCAGGAGCAGGGTTGG + Exonic
1076169598 10:128308303-128308325 AGCTGCAGCTGGAGCAGCGGGGG - Intergenic
1076306126 10:129466945-129466967 CGCTGCCGGAGGACCAGGGCCGG + Intergenic
1076671407 10:132122728-132122750 CGCTGCTGCCAGGGCAGGGCTGG + Intronic
1077049768 11:561367-561389 CTCTGCGGCCTGAGCAGGTCGGG + Exonic
1077136229 11:1000497-1000519 CGCTGCCGCCGGAGGAGGGTGGG - Exonic
1077242923 11:1520499-1520521 GGCTGCAGCCTGAGAGGGGCAGG - Intergenic
1080607394 11:33875054-33875076 TGCTGCAGTGGGAGCAGGGGTGG - Intronic
1080639305 11:34149490-34149512 CATAGCAGGCGGAGCAGGGCAGG + Intergenic
1081870786 11:46381695-46381717 CGCGGCGGCCGGAGCGGGACGGG + Intronic
1082808368 11:57463887-57463909 CGCTCCAGCCCCAGCAGGCCTGG + Intronic
1083436634 11:62647592-62647614 CGATGCAGCTGGTGCAGAGCTGG - Exonic
1085083059 11:73649334-73649356 CGCTACTGCAGGAGCAGGGGTGG - Intronic
1089124761 11:116169088-116169110 GGCTGCAGCAGGAGCAGAGCTGG - Intergenic
1089398851 11:118152991-118153013 CGCTCCAGCCGCAGGAGGGGCGG + Intergenic
1089540461 11:119186548-119186570 ACCTGCAGCAGGAGCTGGGCAGG + Exonic
1090845766 11:130528499-130528521 GGCTGCAGCAGGAACAGGGGAGG + Intergenic
1091227659 11:133967337-133967359 CGCTGGGACCGGAGCAGGGGTGG - Intergenic
1091916749 12:4275410-4275432 AGCTGGAGTCGGAGCAGGGGGGG - Intronic
1092294882 12:7189836-7189858 GGCTGGAGCGGCAGCAGGGCCGG + Intronic
1092990819 12:13897340-13897362 CGGTGAAGCAGGGGCAGGGCTGG - Intronic
1093233129 12:16573669-16573691 CGCTCCAGCTCGAGCAGAGCAGG - Intronic
1094818165 12:34206014-34206036 CACTCTAGCCAGAGCAGGGCGGG + Intergenic
1097007898 12:55932056-55932078 AGCTGGAGCCCGAGCTGGGCTGG - Intronic
1097107694 12:56635028-56635050 CGCCGCCGCCGGCCCAGGGCTGG - Intronic
1097867288 12:64569339-64569361 CGCTGCAGCCTCAGCTTGGCTGG + Intergenic
1100217278 12:92465051-92465073 GGCTGCAGCCAGAACAAGGCTGG - Intergenic
1102381288 12:112468826-112468848 GGCTGAGGCCGGAGGAGGGCTGG + Intronic
1103147663 12:118609521-118609543 TGCTGCATCCAGGGCAGGGCAGG + Intergenic
1103841635 12:123869919-123869941 TGCTGCAGCAGGAGAGGGGCAGG - Intronic
1103906207 12:124328384-124328406 AGCTGGGGCCGGACCAGGGCTGG - Intronic
1104602633 12:130163438-130163460 CGCTGCGGCCGGAACAGCGGCGG - Exonic
1104926951 12:132318796-132318818 GGCTGGGGCAGGAGCAGGGCTGG - Intronic
1104957156 12:132472539-132472561 AGCTGGAGCCGGGGAAGGGCTGG + Intergenic
1104958494 12:132477205-132477227 CGCAGCAGCTGCAGCAGGGCTGG - Intergenic
1104968970 12:132522652-132522674 GCGTGCAGCAGGAGCAGGGCAGG - Intronic
1105472027 13:20703594-20703616 CGCTGGCGGCGGAGCAGGGATGG + Intronic
1106705566 13:32275532-32275554 CGATGCAGACGGAGCAGAGGTGG - Intronic
1107108024 13:36667636-36667658 CTCTGCAGCTGGCGCAAGGCAGG + Intergenic
1108478478 13:50843557-50843579 TGCTGCAGCAGGAGTGGGGCTGG - Exonic
1113381610 13:109810803-109810825 ACCCGCAGCCGGAGCAAGGCTGG - Intergenic
1116556411 14:46315928-46315950 GGCTGCAGCTGAAGCACGGCAGG - Intergenic
1119539258 14:75428088-75428110 CGCTGCAGCGGCGGCGGGGCTGG + Intronic
1121422966 14:93828562-93828584 CAATGCAGCCGGGGCAGAGCTGG + Intergenic
1122036658 14:98954006-98954028 AGCAGCTCCCGGAGCAGGGCAGG + Intergenic
1122122118 14:99560259-99560281 CGCTGCAGCCAGGGCTGGGTAGG + Intronic
1122786146 14:104164135-104164157 CGCTGCAGCCGCCGCAGTGGGGG + Intronic
1123056432 14:105572741-105572763 AGCTGCAGCCTCAGCAGGACAGG - Intergenic
1123057501 14:105579066-105579088 AGCTGCAGCCTCAGCAGGACAGG + Intergenic
1123080865 14:105692869-105692891 AGCTGCAGCCTCAGCAGGACAGG - Intergenic
1123081776 14:105698999-105699021 AGCTGCAGCCTCAGCAGGACAGG + Intergenic
1124216936 15:27815330-27815352 CGGTGCATCTGCAGCAGGGCTGG + Intronic
1125965609 15:43873389-43873411 CACTGCAGCCTCAGCAGGGCAGG - Exonic
1126798703 15:52281351-52281373 CTCTGCAGCCGGGTCAAGGCCGG + Intronic
1130335244 15:82952538-82952560 AGCGGCCGCCGGAGCAGCGCCGG - Exonic
1130819546 15:87479915-87479937 AGCTACAGAAGGAGCAGGGCAGG - Intergenic
1131254241 15:90851349-90851371 AGCAGCAGACGCAGCAGGGCAGG - Intergenic
1131254451 15:90852816-90852838 AGCAGCAGACGCAGCAGGGCAGG + Intergenic
1131513170 15:93060791-93060813 CACTCCTGCCGGGGCAGGGCTGG + Intronic
1132233524 15:100201967-100201989 GGCTGCAGCCAGGGCTGGGCGGG - Intronic
1132556878 16:576420-576442 CGCTGGGGCCTGGGCAGGGCAGG + Intronic
1132570537 16:642126-642148 CGCAGCAGCAGGTGGAGGGCCGG + Exonic
1132709835 16:1261496-1261518 CTCTGCGGTGGGAGCAGGGCAGG + Intergenic
1132722036 16:1321224-1321246 CGCTGCAGGCGGAGCAGTGGGGG - Intronic
1132726527 16:1341280-1341302 CGCTGAAGCCTGGGCACGGCAGG - Exonic
1132747326 16:1442484-1442506 TGCAGCAGGAGGAGCAGGGCCGG - Exonic
1132871074 16:2116015-2116037 ACCTGCAGCCGCAGCTGGGCGGG + Exonic
1133055344 16:3143004-3143026 CGGTGCTCCCAGAGCAGGGCAGG - Intergenic
1134374513 16:13659421-13659443 TGATGCAGCCTGAGCTGGGCCGG + Intergenic
1134492204 16:14703597-14703619 CGCGGCGGCCGGAGCAGGGTGGG - Intergenic
1134497585 16:14742719-14742741 CGCGGCGGCCGGAGCAGGGTGGG - Intronic
1134521460 16:14920879-14920901 ACCTGCAGCCGCAGCTGGGCGGG - Intronic
1134709131 16:16319530-16319552 ACCTGCAGCCGCAGCTGGGCGGG - Intergenic
1134716340 16:16359559-16359581 ACCTGCAGCCGCAGCTGGGCGGG - Intergenic
1134914827 16:18060779-18060801 AGCTGGAGCCTCAGCAGGGCTGG + Intergenic
1134950474 16:18349115-18349137 ACCTGCAGCCGCAGCTGGGCGGG + Intergenic
1134958410 16:18392600-18392622 ACCTGCAGCCGCAGCTGGGCGGG + Intergenic
1136025217 16:27464413-27464435 CGCTGCAGCGGGAGCAGCACAGG - Exonic
1136153021 16:28364638-28364660 GGCGGCGGCCGGAGCAGGGTGGG + Intergenic
1136210062 16:28750635-28750657 GGCGGCGGCCGGAGCAGGGTGGG - Intergenic
1136626366 16:31464593-31464615 CGCGACAGCAGCAGCAGGGCTGG - Exonic
1136927621 16:34389055-34389077 CGCTGGAGCCGGCGCAGGCTGGG + Intergenic
1136976953 16:35022751-35022773 CGCTGGAGCCGGCGCAGGCTGGG - Exonic
1137768759 16:50997714-50997736 CGCTGGCTACGGAGCAGGGCTGG - Intergenic
1138360767 16:56425498-56425520 GGCAGCAGCGGGAGCAGCGCGGG - Exonic
1138512775 16:57518270-57518292 CGCTCCATCTGCAGCAGGGCAGG + Exonic
1140040161 16:71402211-71402233 AACTGCAGCTGCAGCAGGGCAGG - Intergenic
1141583732 16:85019001-85019023 CGCTGTAGGTGGAGCAGGTCTGG + Intergenic
1141657718 16:85424978-85425000 CCAGGCAGCTGGAGCAGGGCAGG + Intergenic
1142118676 16:88375075-88375097 GGCTGCAGCAGGCGCAGGGCAGG + Intergenic
1142120221 16:88383348-88383370 CGCAGGAGCGGGAGCCGGGCCGG - Intergenic
1142275526 16:89116767-89116789 CGCGGGAGCCGGCCCAGGGCAGG - Intronic
1142365172 16:89646323-89646345 CACGCCAGCCGGAGCAGGACGGG + Intronic
1143028188 17:3953190-3953212 AGCTGAAGTCTGAGCAGGGCAGG + Intronic
1143462674 17:7114258-7114280 AGCTGGAGCTGGAGCTGGGCTGG + Exonic
1143567503 17:7733192-7733214 CCGAGCAGCCGAAGCAGGGCCGG - Exonic
1144676300 17:17164368-17164390 ACCTGAAGCGGGAGCAGGGCCGG + Intronic
1144728684 17:17514591-17514613 GGCAGCAGCAGGATCAGGGCAGG - Intronic
1144948097 17:18980092-18980114 TGATGCAGCCAGAGGAGGGCAGG + Intronic
1145190703 17:20841091-20841113 CGATGCGGCCGGGGCAGGGCGGG - Intronic
1146058259 17:29591779-29591801 GGCTGCAGCCAGTGCAGGGGAGG - Intronic
1146339659 17:32007840-32007862 CGCTGGTGCCGGCGCGGGGCGGG - Intergenic
1146358990 17:32159210-32159232 CCCTGCAGCAGGAGCAGGAGAGG - Intronic
1146676453 17:34776652-34776674 TGCTGGAGCCGGACCAGGGACGG - Intergenic
1147134756 17:38428447-38428469 CTCTGCGGCCGGGGCACGGCTGG - Exonic
1147179084 17:38673785-38673807 GGGTGCGGCCGGAGCCGGGCTGG + Exonic
1147382245 17:40062860-40062882 AGCCCCAGCCGGAGCGGGGCGGG + Exonic
1147452212 17:40512646-40512668 CTCTGCAGGCTGAGCAGGGGAGG + Intergenic
1147989808 17:44325701-44325723 AGCTGCAGCCCGGGCCGGGCGGG + Intergenic
1149649934 17:58270549-58270571 AGCTGCACCCAGAACAGGGCTGG + Exonic
1149685416 17:58531964-58531986 GGCTGCAGCCCGGGCGGGGCCGG + Intronic
1151384071 17:73744488-73744510 GGCTGGGCCCGGAGCAGGGCTGG - Intergenic
1151404418 17:73877485-73877507 GGCTACAGCTGGAGCAAGGCTGG + Intergenic
1151580099 17:74972696-74972718 AGCTGAAGCCGGAGCCGGGTTGG - Exonic
1151674068 17:75589020-75589042 AGCCGCAGCAGGAGCGGGGCCGG + Intergenic
1151677433 17:75605865-75605887 TCCTGCTGCAGGAGCAGGGCTGG + Intergenic
1152019011 17:77770806-77770828 GGCTGCAGCCGGGGGTGGGCTGG - Intergenic
1152083839 17:78205387-78205409 GGCTCCAGGCGGAGCAAGGCAGG - Intronic
1152127953 17:78458734-78458756 CCCTGCAGCGGCAGCAGGGCTGG + Intronic
1152600686 17:81260642-81260664 CGCCGCTGCCAGAGCATGGCAGG + Intronic
1152708539 17:81858630-81858652 TGCTACAGACGGAGCAGGGCGGG + Intronic
1152742226 17:82023358-82023380 GGCTGCAGGCGGGGCAGGGCTGG + Exonic
1153387255 18:4511357-4511379 CACGGGAGCTGGAGCAGGGCTGG + Intergenic
1154172562 18:12061906-12061928 GGCTGCAGCCGTGGCAGGGTTGG + Intergenic
1155570334 18:27185328-27185350 CGCCGCAGCCCCAGCCGGGCCGG - Intergenic
1155805342 18:30163822-30163844 CTCTGCAGCCAGAGAAGGCCTGG + Intergenic
1156307087 18:35887441-35887463 CACTGGAACCGGAGCATGGCAGG + Intergenic
1156499043 18:37545352-37545374 CGCTGGAGCCAGAGGTGGGCTGG + Intronic
1157522495 18:48355029-48355051 AGCTGCAGGCAGAGCAGGGAAGG - Intronic
1158699765 18:59735422-59735444 TGCTGCAGTTGGAGCTGGGCAGG + Intergenic
1158976479 18:62715641-62715663 CGCTGCCTCCGGAGCTGGGGGGG + Exonic
1160701090 19:507768-507790 TGCTGCAGCAGGAGCTGGCCCGG - Exonic
1160727332 19:623129-623151 CGCTGAAGCCGGCAGAGGGCAGG - Intronic
1160870609 19:1276111-1276133 CACTGAAGCCGGAGCATGCCGGG + Intronic
1160995804 19:1881500-1881522 CGATGCGGCCGGGGCAGGGCGGG + Exonic
1161068916 19:2250923-2250945 CGCGGCAGCAGGAGCAGGGCCGG - Exonic
1161140318 19:2643333-2643355 CGGTGCCGACGGAGCCGGGCCGG - Intronic
1161140344 19:2643460-2643482 CGGTGCCGACGGAGCCGGGCCGG - Intronic
1161140370 19:2643587-2643609 CGGTGCCGACGGAGCCGGGCCGG - Intronic
1161280817 19:3444599-3444621 AGCGGCAGCCAGGGCAGGGCAGG - Intronic
1161400650 19:4065349-4065371 CGCTGCGGCCGGGGCGGGGGAGG - Intronic
1161421793 19:4179928-4179950 GGCTGCAGCAGGAGCAGGAGGGG + Intronic
1161664615 19:5567929-5567951 AGCTGGAGCCGGAGCCGGGCGGG - Intergenic
1161793915 19:6375784-6375806 CCCTGCAGCTGGGACAGGGCTGG - Exonic
1161849759 19:6732230-6732252 AGCAGCCTCCGGAGCAGGGCGGG - Intronic
1162099998 19:8333748-8333770 CGCTGCAGCGGCAGCTGAGCCGG - Exonic
1162771020 19:12949361-12949383 CCCAGCTGCTGGAGCAGGGCGGG - Exonic
1163833297 19:19558199-19558221 CGCTACAGGCAGAGGAGGGCGGG + Intergenic
1165113496 19:33515219-33515241 CACATCAGCCGCAGCAGGGCAGG + Intronic
1165434681 19:35789445-35789467 CGCAGCAGCCCCTGCAGGGCTGG + Intergenic
1165792894 19:38502720-38502742 CTCTGCAGGTGGAGCGGGGCAGG + Exonic
1165871406 19:38975795-38975817 CCCCGCAGCCGGAGGAGGGGCGG - Exonic
1165923892 19:39315222-39315244 TGCAGCGGCCGGGGCAGGGCTGG + Exonic
1166106523 19:40600587-40600609 AGCTGGAGCGGGAGGAGGGCAGG - Intronic
1166304100 19:41928008-41928030 CGCCGCGGCCGGCGCAGGGGCGG - Intronic
1166706052 19:44908637-44908659 AGCTGCAGGCGGCGCAGGCCCGG + Exonic
1166790616 19:45396572-45396594 CGCTGCCGCCGGAGCCTAGCAGG + Exonic
1166882927 19:45940171-45940193 CGCTGCAGCCGCGGCCGGGGCGG - Exonic
1167169899 19:47824099-47824121 GCCTGCAGTGGGAGCAGGGCAGG + Intronic
1167266382 19:48485033-48485055 CGCTGCAGCAGCAGCACTGCTGG - Intergenic
1167369467 19:49072030-49072052 TGCTGCAGCCGCAGCCGGCCCGG - Exonic
1167426481 19:49432353-49432375 GGGTGGAGCCGGGGCAGGGCAGG - Intronic
1167569289 19:50276876-50276898 CGGAGCAGCTGGAGCAGGCCCGG + Exonic
1167569530 19:50278210-50278232 AGCTGCAGGAGGTGCAGGGCCGG + Exonic
1167679809 19:50912361-50912383 GGCTCCAGCCAGAGGAGGGCAGG + Intergenic
925928177 2:8685367-8685389 CGCTGGCGCTGGAGGAGGGCGGG + Intergenic
927006924 2:18860972-18860994 TGCTGCAGCAGGAGCACTGCAGG + Intergenic
927836370 2:26402179-26402201 CGCAGGAGCCGGAGAAGGGCTGG + Intronic
929127592 2:38535585-38535607 AGGTGCAGCCGCATCAGGGCAGG - Intergenic
929382021 2:41364929-41364951 TGCTGCAGCAGTGGCAGGGCAGG - Intergenic
930196370 2:48514776-48514798 CTGTGCAGCAGGAGCAGGTCTGG - Exonic
931638864 2:64363941-64363963 GGCTGCAGCCAGGGCAGGGTGGG - Intergenic
931890051 2:66661764-66661786 CACTGTAGCAGGGGCAGGGCAGG + Intergenic
932086972 2:68771277-68771299 GGCTGCAGGCAGACCAGGGCGGG - Intronic
932336234 2:70932879-70932901 TGCGGCTGCTGGAGCAGGGCCGG + Exonic
932345927 2:70995019-70995041 CGCTGCAGCCAGAGGGAGGCGGG + Exonic
933666908 2:84971402-84971424 CACTGCAGCCGGAGCCCGGGAGG + Exonic
933807775 2:86012456-86012478 GGCTGCAGCAGGACCAGAGCAGG + Intergenic
934519488 2:95010901-95010923 CTCTGCAGCTGGAGTAGGGCAGG - Intergenic
934522106 2:95025998-95026020 CGGGGCAGCAGGCGCAGGGCGGG + Intronic
936279154 2:111122666-111122688 GGCTGCGGCCGGGGCAGCGCGGG + Intronic
937195954 2:120156500-120156522 TGCTGCAGCAGTGGCAGGGCAGG - Intronic
938305508 2:130251880-130251902 CGCTGCAGCCGGTGCAGTCCTGG + Intergenic
942565824 2:177264365-177264387 CGCTTGCGCCGGGGCAGGGCGGG - Intronic
946321942 2:218959640-218959662 CGCTGCAGCTGGCGCAGCTCAGG + Exonic
946419582 2:219557446-219557468 GGGTGCAGCTGGAGCAGGCCGGG - Exonic
947472445 2:230411925-230411947 CGCTGCAGCCTCTTCAGGGCTGG - Intergenic
947584308 2:231343199-231343221 CACTGTACCCGGACCAGGGCAGG + Intronic
948501416 2:238397661-238397683 CCCTGCAGCAGGAGCAGAGGTGG + Exonic
948501432 2:238397705-238397727 CCCTGCAGCAGGAGCAGAGGTGG + Intronic
948501448 2:238397749-238397771 CCCTGCAGCAGGAGCAGAGGTGG + Intronic
948501492 2:238397881-238397903 CCCTGCAGCAGGAGCAGAGGTGG + Intronic
948892431 2:240914021-240914043 GGCAGCAGCCGCAGCATGGCTGG + Intergenic
948994430 2:241571291-241571313 CGGTCTGGCCGGAGCAGGGCAGG - Intronic
1169060771 20:2659031-2659053 TGCTGCAGCCAGGGCAGGACAGG + Intronic
1169073741 20:2749529-2749551 CGCGGCGGCCGGGGCTGGGCCGG - Intronic
1169197211 20:3689684-3689706 TGATGCAGGCGGTGCAGGGCTGG + Exonic
1169664522 20:8019500-8019522 CGCTGCCGCCGGAGCAGAGCCGG - Exonic
1170706287 20:18747372-18747394 CCCAGCAGCCTGGGCAGGGCGGG + Intronic
1172095133 20:32456800-32456822 CCCGGCAGCAGGAGCAGGGTGGG - Intronic
1172272745 20:33663716-33663738 CGCGGCGGCCGGAAGAGGGCGGG + Exonic
1173556983 20:43973284-43973306 AGAAGCAGCCGGAGGAGGGCAGG - Intronic
1173660186 20:44727677-44727699 GGCTGCAGCAGGTGCTGGGCTGG + Exonic
1174037749 20:47678655-47678677 CGGTGAGGACGGAGCAGGGCAGG - Exonic
1175817133 20:61889084-61889106 AGCTGCAGGCACAGCAGGGCTGG - Intronic
1176034846 20:63031283-63031305 TGTTGCAGCCGGAGGCGGGCAGG + Intergenic
1176070540 20:63224050-63224072 CGCAGCAGAGGGAGCAGGGTGGG - Intergenic
1176148092 20:63574293-63574315 CGCTGGAGGCGGGGCAGGGCGGG - Intergenic
1179728515 21:43354192-43354214 CGCTGAGGCCACAGCAGGGCGGG + Intergenic
1180075479 21:45459477-45459499 CGCTGGAGATGGAGCCGGGCAGG - Intronic
1180188822 21:46153202-46153224 TGCTGCCGCTGGGGCAGGGCTGG - Intronic
1180246583 21:46552338-46552360 ATCAGCAGCAGGAGCAGGGCAGG - Intronic
1180954180 22:19734149-19734171 GGCTGCTGTCTGAGCAGGGCTGG + Intergenic
1181121584 22:20670918-20670940 CGATGCGGCCGGGGCAGGGCGGG + Intergenic
1181334545 22:22117942-22117964 CGATGCGGCCGGGGCAGGGCGGG + Intergenic
1181443321 22:22949816-22949838 AGCTGCAGCAGGGCCAGGGCAGG - Intergenic
1181506255 22:23360205-23360227 CGCTGGTACCGGAGCAGGACTGG - Intergenic
1181725130 22:24806225-24806247 TGCTGCAGCCGCGGCGGGGCGGG - Intronic
1182125825 22:27815321-27815343 CGCCCCAGACTGAGCAGGGCTGG - Intergenic
1182271178 22:29154524-29154546 TGCCGCAGCGGGAGCTGGGCGGG - Intronic
1183617724 22:38955398-38955420 CCCTGCAGCCAGGGCAAGGCAGG - Intronic
1183710197 22:39498837-39498859 AGCTGCAGGGGGAGCAGGGAGGG - Intergenic
1184244332 22:43228322-43228344 TGCTGGAGCCGGGGCAGGGTGGG - Intronic
1184252854 22:43270759-43270781 CTCTGCAGCTGGAGAAGGGCAGG - Intronic
1184296977 22:43531051-43531073 AGGTGAAGCCGGAGCAGGGCTGG - Intronic
1184364023 22:44037948-44037970 AGCTGGAGCTGGAGCTGGGCTGG - Intronic
1185418878 22:50724198-50724220 AGCTGCAGCAGTTGCAGGGCAGG + Intergenic
1185427852 22:50783602-50783624 CGCTGCGGCGCGAGCTGGGCCGG - Exonic
950096982 3:10336133-10336155 GGCTGCAGCAGGAGGAAGGCTGG + Intronic
950104470 3:10379438-10379460 CCCTGAAGCAGGAGCAGGCCTGG + Intronic
950153830 3:10707991-10708013 AGCCGCAGCCGCAGCGGGGCCGG - Intronic
950452566 3:13073420-13073442 CGCAGCATCCGGAGAAGGGGCGG + Intergenic
950520618 3:13495708-13495730 GGGTGCAGCTGGAACAGGGCAGG - Intronic
950705504 3:14777451-14777473 GGCTGCAGCCTGAGGAGGACAGG + Intergenic
951569244 3:24044646-24044668 TCCTGGAGCAGGAGCAGGGCAGG + Intergenic
952335766 3:32401829-32401851 GGCTGCTGCCGGCGCTGGGCTGG - Intronic
953784167 3:45897827-45897849 AGCTGCAGCAGGAGGAGAGCAGG + Intronic
953890844 3:46750645-46750667 AGCTGGAGGCGGAGCAGGGCTGG + Intronic
954613877 3:51959791-51959813 TGCTGCAGGTGGGGCAGGGCAGG - Intronic
954622176 3:52002558-52002580 GGCTGCTGCCTGAGCAGGCCTGG + Intergenic
956675004 3:71725230-71725252 CGCTGCAGCCTGAGCCGGGCGGG - Exonic
959067925 3:101676699-101676721 TGCTGCAGCCGGAGCGACGCCGG - Exonic
961414698 3:126748809-126748831 GGCTGCAGCCCGGGCTGGGCTGG + Intronic
966306514 3:178541932-178541954 GGCTGGAGTCGGAGCAGAGCAGG - Intronic
967106203 3:186256737-186256759 CCCTGCAGTGGGAGCAGGCCAGG - Intronic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968653139 4:1767778-1767800 CGCTGCTGGCGGAGCGGGGTCGG - Intergenic
968756084 4:2417353-2417375 CGCTGCAGCCGGAGCAGGGCCGG - Intronic
969261337 4:6036051-6036073 CGCTGCAGCAGGAGCCGGGGCGG - Exonic
969480731 4:7445589-7445611 CGCTGAAGGCAGAACAGGGCGGG + Intronic
969586410 4:8096772-8096794 AGGTGCAGGCGGAGCGGGGCCGG + Intronic
970001936 4:11373033-11373055 TTCTGCAGCCGGAGCCCGGCTGG - Intergenic
973013903 4:45111098-45111120 GGGTGCAGCCGAAGCAGGGCGGG - Intergenic
973888554 4:55346715-55346737 CGCAGCAGCCGGGGCATGGCCGG - Intronic
975252584 4:72197439-72197461 CACTGCTGCCGGAGTAGGGAAGG - Intergenic
975829769 4:78357129-78357151 AGCTGCAACAGGAGCAGGGCAGG - Intronic
977314284 4:95425420-95425442 CGCTGAAGCAGGAGAATGGCGGG - Intronic
979523832 4:121697086-121697108 CGCTGAGGCCGGGGCAGGGGCGG - Exonic
980013604 4:127623302-127623324 CGCGGCGGCCGGAGCTGTGCGGG + Intronic
983904362 4:173168974-173168996 CGCTGCCGCCGGAGGGGGCCGGG - Intronic
985683709 5:1270907-1270929 TGCGGCAGCCGGAGCGGAGCAGG - Intronic
985727043 5:1522099-1522121 AGCTGGGGCAGGAGCAGGGCTGG + Intronic
986172558 5:5326229-5326251 TGCTGGAGGAGGAGCAGGGCTGG + Intergenic
987710531 5:21497263-21497285 CACTGCAGTGGGCGCAGGGCAGG - Intergenic
991760861 5:69916322-69916344 CACTGCAGTGGGCGCAGGGCAGG - Intergenic
991786469 5:70201779-70201801 CACTGCAGTGGGCGCAGGGCAGG + Intergenic
991840090 5:70791373-70791395 CACTGCAGTGGGCGCAGGGCAGG - Intergenic
991878912 5:71202164-71202186 CACTGCAGTGGGCGCAGGGCAGG + Intergenic
992528076 5:77630558-77630580 CTCTGCCGCCGGCGCTGGGCAGG - Exonic
996954232 5:129164208-129164230 TGCTGCAGCAGTGGCAGGGCAGG + Intergenic
999111214 5:149123090-149123112 GGGTGCAGCCGAAGCCGGGCAGG + Intergenic
999281577 5:150369734-150369756 GGCTGCAGCCGGAGAGGGGCAGG + Intronic
999445327 5:151634142-151634164 CCCAGCAGCCTGGGCAGGGCAGG - Intergenic
1001074821 5:168618113-168618135 CACTGCAGCCGGCCCAGGCCTGG - Intergenic
1001328244 5:170744770-170744792 CCCTGAAGCCGGCGCTGGGCTGG - Intergenic
1002073233 5:176693052-176693074 GGCTGCAGTGGGGGCAGGGCGGG + Intergenic
1002257778 5:177971340-177971362 CGCTCCAGCCCGGGCGGGGCCGG - Intergenic
1002317971 5:178356680-178356702 CATTGCCGCCGGAGCAGAGCCGG + Intronic
1002431841 5:179208460-179208482 CGCTGCAGTCGGCCCTGGGCAGG + Intronic
1002493494 5:179596612-179596634 AGCTGCAGCAGGAGCTGGGCGGG + Exonic
1002550059 5:179981357-179981379 CGCTCCTGACGGAGCAAGGCGGG + Intronic
1003081333 6:3024024-3024046 GGCTGCATCCGGGGCGGGGCTGG + Intergenic
1003324411 6:5081911-5081933 GGCTGCAGACTGAGCAAGGCTGG + Intergenic
1005547158 6:26883254-26883276 CACTGCAGTGGGCGCAGGGCAGG + Intergenic
1006373757 6:33660417-33660439 TGAGGCAGCCTGAGCAGGGCAGG - Intronic
1006380296 6:33693340-33693362 GGCTGCAGCTGCGGCAGGGCAGG + Intronic
1006737552 6:36285280-36285302 CGCTGCTCTGGGAGCAGGGCCGG + Intronic
1007266401 6:40599633-40599655 TCCTGCAGCCGCAGCAGCGCAGG - Intergenic
1007521287 6:42453033-42453055 CGCGGCAGGCGCAGCAGGCCGGG + Intergenic
1007595466 6:43048413-43048435 CGCTGCAGCTGCAGCAGGAGTGG + Exonic
1007751275 6:44073421-44073443 CGCGGGAGCCGGAGCGGCGCGGG - Intergenic
1010244783 6:73653471-73653493 CGGTGCAGCCGGCGCTGAGCTGG - Intronic
1011064360 6:83309509-83309531 GGCTGCAACAGGAGCAGGGCTGG + Intronic
1014254635 6:119148520-119148542 CCCTGCAGGCAGAGCAGGGGCGG - Intronic
1015497279 6:133894674-133894696 GGCTGAAGCTGGAGCAGGGTAGG - Exonic
1016461631 6:144285219-144285241 CGCTGGAGGCGGAGGAGGGAGGG - Intergenic
1018608692 6:165625312-165625334 GGCTGCAGGCAGAGCAGTGCAGG + Intronic
1019053412 6:169201913-169201935 CGCTGGAGGCAGAGCAGTGCAGG - Intergenic
1019518579 7:1450453-1450475 CACCGTGGCCGGAGCAGGGCCGG - Intronic
1019528696 7:1493175-1493197 CGACGCGGCCCGAGCAGGGCCGG - Intronic
1019634649 7:2069080-2069102 TGCTGCAGCCGGGTCAGGGTTGG - Intronic
1020381985 7:7557179-7557201 CACTGCAGCAGTAGCAGGGCAGG - Intergenic
1020735954 7:11949823-11949845 AGCTGCAGCAGAAGCATGGCAGG + Intergenic
1021313188 7:19117182-19117204 CGCAGCAGCAGGCGCAGCGCGGG - Exonic
1022351148 7:29566646-29566668 CGCTGCTCCCGGAGGCGGGCAGG + Exonic
1023405811 7:39833252-39833274 CGGCGCAGGCGGAGCCGGGCGGG + Intergenic
1024532517 7:50405617-50405639 CACTGGAGCCGGGGCAAGGCTGG - Intergenic
1024694331 7:51839305-51839327 TGCTGGAGCCGCAGCAGGGCGGG - Intergenic
1025638996 7:63349899-63349921 AGCTGCAGCCGGACGAGCGCTGG - Intergenic
1025643703 7:63398193-63398215 AGCTGCAGCCGGACGAGCGCTGG + Intergenic
1026933123 7:74236192-74236214 CGCTGCAGCCTGGGTGGGGCAGG - Intronic
1027187741 7:75981989-75982011 CCCAGAAGCCGGGGCAGGGCTGG - Intronic
1029742803 7:102500743-102500765 TGGTGCAGCAGGAGGAGGGCTGG - Exonic
1029760793 7:102599904-102599926 TGGTGCAGCAGGAGGAGGGCTGG - Exonic
1030354350 7:108526167-108526189 CGCTGGGGGCGGAGCGGGGCGGG - Exonic
1032845432 7:135748014-135748036 CTCTGCAGCCAGAGGTGGGCAGG - Intronic
1034263595 7:149771679-149771701 CGCGGAAGGCGGAGCAGGGAAGG - Intronic
1034269651 7:149797410-149797432 AGCTGGTGCAGGAGCAGGGCTGG - Intergenic
1034276628 7:149826664-149826686 TGCAGCAGCTGCAGCAGGGCAGG - Intergenic
1034354918 7:150444291-150444313 CGGTGCAGCCGGCTCTGGGCAGG - Intergenic
1034677464 7:152902232-152902254 CTGTGCAGCTGGAGCAGGCCTGG + Intergenic
1035431879 7:158828957-158828979 GGCGGGAGCCGGGGCAGGGCTGG + Intronic
1036938567 8:13029862-13029884 AGCTGCAGATGGAGCAGGTCAGG - Intronic
1037529176 8:19757207-19757229 GGCAGCGGCCGGAGCCGGGCCGG - Intronic
1037759600 8:21733207-21733229 GGCTGCAGCCGGAGGAAGGTGGG - Intronic
1038170728 8:25128959-25128981 TGCTGCAGCAGTGGCAGGGCGGG - Intergenic
1038883439 8:31639373-31639395 TGCTGCTGCCGGAGCGGAGCGGG - Intronic
1039979211 8:42392105-42392127 CGATGGAGCCGCAGCACGGCGGG + Intronic
1041381419 8:57257951-57257973 CCCTGCAGCTGCAGGAGGGCAGG + Intergenic
1041552684 8:59119264-59119286 CGCTGCCGCCGCCGCCGGGCAGG + Intergenic
1044306373 8:90645648-90645670 CGGAGCTGCCGGAGCCGGGCGGG - Exonic
1044725922 8:95194143-95194165 GGCTGCCTCCAGAGCAGGGCAGG - Intergenic
1045547275 8:103140539-103140561 CCCCGCAGCCGGAGGAGGGCTGG - Intronic
1047024476 8:120811478-120811500 TGCTGAAGCAGGAGCTGGGCGGG - Exonic
1047492391 8:125385815-125385837 GGCTGCTGCTGGAGCGGGGCGGG + Intergenic
1047499234 8:125429653-125429675 GGCTGCAGCCGGAGGAAGGAGGG - Intergenic
1048461535 8:134625500-134625522 ACCTGCAGAGGGAGCAGGGCAGG - Intronic
1049461543 8:142731712-142731734 CGCTCCTGCAGCAGCAGGGCCGG + Intronic
1049556598 8:143285484-143285506 CTCTGCAGCAGGCGCTGGGCTGG - Intergenic
1049608496 8:143541147-143541169 CTCTGCAGCCCCAGCAGGGCCGG + Intronic
1049665045 8:143839293-143839315 CGGTGCTGGCGGGGCAGGGCTGG - Exonic
1049726170 8:144147549-144147571 CGCGGCACCCGGAGGGGGGCAGG - Intergenic
1049776763 8:144409522-144409544 CGCTGCGGGCGGAGCAGCGCGGG + Intergenic
1049777868 8:144414787-144414809 AGCTGCTGTTGGAGCAGGGCAGG + Exonic
1050324986 9:4490287-4490309 CGCTGCGGCAGGAGCTGGGGCGG - Intergenic
1051718458 9:20009774-20009796 TGCTGCAGCTGGAGTTGGGCAGG - Intergenic
1052799282 9:32952668-32952690 AGCTGGAGCAGGAGCAGGGTGGG + Intergenic
1057533484 9:95875728-95875750 CGCCGCCGCCGGAGGAGGACAGG - Exonic
1058023723 9:100117615-100117637 CGGTGCAGCGGGAGGTGGGCGGG - Intronic
1058467561 9:105244628-105244650 TGCTGCAGCAGGAGCAGAGCAGG + Exonic
1060838742 9:126777906-126777928 TGCTGCAGCCGGTCCAGGACAGG - Intergenic
1061090633 9:128424090-128424112 GGCTGCAGCCCAGGCAGGGCTGG + Intronic
1061502931 9:131013994-131014016 CGCTGGGCCCTGAGCAGGGCAGG + Intronic
1061812698 9:133171591-133171613 CGAGGCAGCCCGAGCTGGGCAGG + Intergenic
1061849663 9:133406926-133406948 GGCGGCAGCAGCAGCAGGGCAGG + Exonic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062113376 9:134795018-134795040 AGCTGCCACCTGAGCAGGGCCGG + Intronic
1062309811 9:135929647-135929669 TGCTGCAGACTGGGCAGGGCTGG - Intergenic
1062401032 9:136372725-136372747 CCCCGCAGCTGCAGCAGGGCTGG - Intronic
1062412882 9:136433656-136433678 AAGGGCAGCCGGAGCAGGGCCGG - Intronic
1062583457 9:137238231-137238253 AGCTGCAGGAGGAGGAGGGCAGG + Intergenic
1186406793 X:9311615-9311637 CTCTGCAGCTGGAGGTGGGCTGG - Intergenic
1188871956 X:35383183-35383205 TGCTGCAGCTGGATCAGGGAGGG - Intergenic
1189129017 X:38479235-38479257 CGCTCCAGGCTGAGCAGGGGTGG - Intronic
1190274331 X:48890742-48890764 GGCGGCAGCCGGAGGAGGCCCGG + Intergenic
1190567333 X:51743872-51743894 CGTTGCTGCCGGAGCCGGCCGGG - Exonic
1193593532 X:83419334-83419356 CGCTGCAGCAGTGGCAGGGCAGG - Intergenic
1197694999 X:129540609-129540631 CGCGGGAGACGAAGCAGGGCGGG + Intronic
1200123061 X:153800351-153800373 CTCAGCAGCCTGTGCAGGGCGGG + Intergenic
1201190485 Y:11439168-11439190 GACTACAGCCAGAGCAGGGCTGG - Intergenic