ID: 968756142

View in Genome Browser
Species Human (GRCh38)
Location 4:2417543-2417565
Sequence GCGCGCTCGCCCCAAGGGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 78}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968756135_968756142 -1 Left 968756135 4:2417521-2417543 CCGCCGAGGCTGCTGGCCACGGG 0: 1
1: 0
2: 2
3: 15
4: 204
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756131_968756142 4 Left 968756131 4:2417516-2417538 CCGCCCCGCCGAGGCTGCTGGCC No data
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756125_968756142 25 Left 968756125 4:2417495-2417517 CCGGCTGGAGAGCCGCACCTCCC 0: 1
1: 0
2: 0
3: 13
4: 145
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756132_968756142 1 Left 968756132 4:2417519-2417541 CCCCGCCGAGGCTGCTGGCCACG 0: 1
1: 0
2: 3
3: 10
4: 148
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756133_968756142 0 Left 968756133 4:2417520-2417542 CCCGCCGAGGCTGCTGGCCACGG 0: 1
1: 0
2: 2
3: 13
4: 263
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756128_968756142 8 Left 968756128 4:2417512-2417534 CCTCCCGCCCCGCCGAGGCTGCT 0: 1
1: 0
2: 0
3: 40
4: 462
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756130_968756142 5 Left 968756130 4:2417515-2417537 CCCGCCCCGCCGAGGCTGCTGGC 0: 1
1: 0
2: 3
3: 29
4: 498
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756126_968756142 13 Left 968756126 4:2417507-2417529 CCGCACCTCCCGCCCCGCCGAGG 0: 1
1: 0
2: 5
3: 175
4: 5643
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78
968756137_968756142 -4 Left 968756137 4:2417524-2417546 CCGAGGCTGCTGGCCACGGGCGC No data
Right 968756142 4:2417543-2417565 GCGCGCTCGCCCCAAGGGCCGGG 0: 1
1: 0
2: 0
3: 4
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968756142 Original CRISPR GCGCGCTCGCCCCAAGGGCC GGG Intronic