ID: 968756413

View in Genome Browser
Species Human (GRCh38)
Location 4:2418428-2418450
Sequence CAGCCTCCCTGCGACAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 230}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968756413_968756426 23 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756426 4:2418474-2418496 GCGGGCGGCGGGCAGGTGCGCGG 0: 1
1: 0
2: 13
3: 82
4: 725
968756413_968756416 -8 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756416 4:2418443-2418465 GGAGGCTGGCTAGCGAAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 178
968756413_968756422 11 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756422 4:2418462-2418484 CCGGAGCGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 253
968756413_968756419 8 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756419 4:2418459-2418481 AGCCCGGAGCGCCGAGCGGGCGG 0: 1
1: 0
2: 2
3: 19
4: 149
968756413_968756423 12 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756423 4:2418463-2418485 CGGAGCGCCGAGCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 34
4: 284
968756413_968756429 29 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756429 4:2418480-2418502 GGCGGGCAGGTGCGCGGGGCAGG 0: 1
1: 0
2: 10
3: 115
4: 866
968756413_968756427 24 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756427 4:2418475-2418497 CGGGCGGCGGGCAGGTGCGCGGG 0: 1
1: 1
2: 8
3: 62
4: 419
968756413_968756424 16 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756424 4:2418467-2418489 GCGCCGAGCGGGCGGCGGGCAGG 0: 1
1: 0
2: 6
3: 70
4: 607
968756413_968756418 5 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756418 4:2418456-2418478 CGAAGCCCGGAGCGCCGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
968756413_968756417 4 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756417 4:2418455-2418477 GCGAAGCCCGGAGCGCCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 78
968756413_968756428 25 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756428 4:2418476-2418498 GGGCGGCGGGCAGGTGCGCGGGG 0: 1
1: 1
2: 9
3: 59
4: 600

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968756413 Original CRISPR CAGCCTCCCTGCGACAGCGC GGG (reversed) Exonic
900139496 1:1133614-1133636 CAGCCTCCCTTCCACAGGTCTGG + Intergenic
900480052 1:2893878-2893900 GAGCCTCCTTGCAACAGGGCCGG - Intergenic
900604110 1:3516226-3516248 CCGCCTCCCTGCGCCAGCTCAGG - Intronic
900933753 1:5752664-5752686 CACCCTCCCTGAGACAGTGTAGG + Intergenic
901361365 1:8703429-8703451 CAGACTCCCCGCGACGGCGGCGG + Intronic
902618080 1:17634775-17634797 CAGCCACCCTGCCCCAGGGCTGG - Intronic
902915704 1:19637840-19637862 CAGCCTCCGTGTGACAGCACCGG - Intronic
903852007 1:26313107-26313129 CATCCTCACTGAGACAGGGCTGG - Intronic
905787209 1:40767724-40767746 CAGCCTCCCTCCCAAAGTGCTGG - Intronic
906754002 1:48291704-48291726 CAGGCTCCCTGGGACAGCCAAGG - Intergenic
907804370 1:57803478-57803500 CAGTCTTCCTGCCACAGAGCAGG + Intronic
911475493 1:98367554-98367576 CAGCCTCCCAGCCACAGCTCTGG - Intergenic
913027321 1:114856829-114856851 CAGCCTCCCTCCCACAGTGCTGG - Intronic
913236151 1:116785076-116785098 CAGCCTCCATGGGACAGCCTAGG + Intergenic
915326082 1:155081941-155081963 CCTCCTCCCTGCGACAGCGGCGG - Intronic
920065819 1:203268939-203268961 CTGCCTCCCTGCCACGGCCCTGG + Intronic
923630090 1:235644120-235644142 CAGCCTTCCAGAGACAGGGCTGG + Intronic
1063508265 10:6621643-6621665 CTGCCTCTCTGCGACAGCATTGG - Intergenic
1063570481 10:7210769-7210791 AAGCCTCCCTGGGTCAGCTCTGG + Intronic
1066661028 10:37738276-37738298 CAGGCTCCCTGCACCAGCGGTGG + Intergenic
1067069397 10:43120841-43120863 CAGCCTCCCAGTGGCAGCCCAGG + Intronic
1067103395 10:43349443-43349465 CAGCCTCAGTGGGACAGAGCTGG - Intergenic
1068164079 10:53305268-53305290 CAGTCTGCCTGGGACAGCCCTGG + Intergenic
1069744463 10:70706337-70706359 CAGCCTTCCTGTGACAGGCCTGG + Intronic
1070071795 10:73096966-73096988 CAGCGCCCCGGCGACTGCGCAGG + Exonic
1070132324 10:73664321-73664343 CGGCCTCCATGGGACAGCGTGGG + Intergenic
1075726623 10:124613859-124613881 CAGCCTCCCTGCGACTGCCCAGG + Exonic
1076117068 10:127907819-127907841 CTGCCTCCCTGGGAAGGCGCGGG - Intronic
1076248768 10:128967926-128967948 CTGCCTCCCTGCGACCACCCTGG - Intergenic
1076729766 10:132432408-132432430 CAGCCACCCGGCAACAGGGCTGG + Intergenic
1076794287 10:132791232-132791254 CAGCCACCCTGAGGCAGGGCAGG + Intergenic
1076993834 11:289086-289108 CCGCCTCCCAGCGACCGCCCGGG + Intergenic
1081702000 11:45158201-45158223 CAGCAGCCCTGGGACAGGGCAGG - Intronic
1085085097 11:73661495-73661517 GAGGATCCCTGCTACAGCGCCGG + Exonic
1087076230 11:94129137-94129159 CAGGCTCCCAGCGACTCCGCTGG - Exonic
1088926517 11:114308393-114308415 CAGCCTTGCTGAGACAGGGCAGG + Intronic
1090354320 11:126129669-126129691 CAGACTCCCTGAGACATCCCAGG - Intergenic
1094676999 12:32630424-32630446 CAACCTCCCTCCGAAAGTGCTGG - Intronic
1095236172 12:39798643-39798665 CAGCCTCCCTGGAACAGCCCGGG + Intronic
1096246493 12:49991738-49991760 CAGCCTCCCTCCCAAAGTGCTGG + Intronic
1103167797 12:118785083-118785105 CAGCCTCCTAGGGACAGAGCAGG + Intergenic
1104860287 12:131919861-131919883 CTCCCTCCCTGCCACAGCCCTGG - Intronic
1104962898 12:132496623-132496645 CTGCTTCCCTGCGGCTGCGCTGG + Intronic
1105404059 13:20119035-20119057 CAGCCTCCCTTCCACAGGGGCGG - Intergenic
1112095649 13:96129098-96129120 CAGCCTCCCTCCCAAAGTGCTGG + Intronic
1113904975 13:113814946-113814968 CTGCCTCACTGGGACAGCACAGG + Exonic
1113908489 13:113831091-113831113 CAGGCTCCCGCCCACAGCGCTGG - Intronic
1115059020 14:29168377-29168399 CAGCCTCCCAGCTGCAGCTCTGG + Intergenic
1117723200 14:58646705-58646727 CATTCTCCCGGCGACCGCGCCGG - Exonic
1119671121 14:76518938-76518960 CAGCCTCCCTTCCACAGCAACGG + Intergenic
1120990497 14:90372676-90372698 CAGCCTCCCTCCCAAAGTGCTGG + Intergenic
1122450783 14:101805317-101805339 CAGCCTCCCAAAGAAAGCGCTGG + Intronic
1122787173 14:104169100-104169122 CAGTCTCCTTGAGACAGGGCAGG + Intronic
1202899758 14_GL000194v1_random:28314-28336 GGGCCTCCCTGCGCCTGCGCCGG + Intergenic
1202862333 14_GL000225v1_random:90470-90492 CACCCTCCCTGCGGAAGCCCAGG - Intergenic
1124083078 15:26519018-26519040 CAGCCTCCCAACGACAGCTCGGG - Intergenic
1127280409 15:57486078-57486100 CAGCCTGCCTGAGTCAGCCCGGG - Intronic
1127760545 15:62135498-62135520 CAGCCTCCCTGTGACCTCTCTGG + Intergenic
1128309394 15:66621015-66621037 CAGCCACACTGAGGCAGCGCCGG + Intronic
1128435743 15:67645804-67645826 CAGCCTCCCTTCCAGAGTGCTGG + Intronic
1129033894 15:72638429-72638451 CAGCTTCCCTGCTGCAGCTCAGG - Intergenic
1129215988 15:74098787-74098809 CAGCTTCCCTGCTGCAGCTCAGG + Intergenic
1130738290 15:86572234-86572256 CAGCCTCCCTGCCATGGCTCAGG - Intronic
1131510419 15:93046809-93046831 GAGCCTCCCTGCTCCAGCCCCGG - Intronic
1131568414 15:93506845-93506867 CAGCCACCCAGCCACAGCTCCGG - Intergenic
1132660211 16:1057862-1057884 CAGCCTCCCTGCCACCTGGCGGG - Intergenic
1132693077 16:1190350-1190372 CAGGCTCCGTGCGACACAGCCGG + Intronic
1132807763 16:1782946-1782968 CAGCCTCCCAGCTAGAGCGAAGG - Exonic
1132850141 16:2021274-2021296 CAGCCTCCCTCCCAAAGTGCTGG + Intergenic
1133055972 16:3145664-3145686 CAGCCACCCTGCGGAAGAGCTGG - Exonic
1134615420 16:15647775-15647797 CAGCCTCCCTCCCAAAGTGCTGG - Intronic
1136032991 16:27516998-27517020 CAGACTCTCTGCCACAGAGCTGG + Intronic
1137756477 16:50906363-50906385 CAGCCTCCCTGTGACAGAGAGGG - Intergenic
1137819051 16:51426168-51426190 CAGCCTCCCTGCTGCACAGCAGG + Intergenic
1139742411 16:69046567-69046589 CAGCCTCCTTGCCAAAGTGCTGG + Intronic
1141122549 16:81371760-81371782 CAGCCTCACTGGGGCAGCTCTGG - Intronic
1142173058 16:88632807-88632829 CCACCTCCCTCCGATAGCGCAGG + Intergenic
1142232606 16:88906864-88906886 CAGCCTTGCTGGGACAGCCCAGG + Intronic
1142475631 17:187444-187466 CAGCCTCCCTCCCACAGGCCTGG + Intergenic
1142644721 17:1304461-1304483 CAGCCTCACTGTGACCACGCTGG - Intergenic
1142651843 17:1358588-1358610 CAGCCTCCCTCCCAAAGTGCTGG - Intronic
1142760943 17:2041670-2041692 CCGCCGCCCTGCGACCGCGACGG + Intronic
1145031605 17:19508473-19508495 CGCCCTCCCTGCGACACGGCTGG - Intronic
1145255040 17:21317822-21317844 CAGCCTCCCTGCTCCTGAGCAGG - Intergenic
1145295944 17:21592855-21592877 CAGCCTCCCCGGAAGAGCGCTGG - Intergenic
1145321563 17:21770124-21770146 CAGCCTCCCTGCTCCTGAGCAGG + Intergenic
1145367844 17:22279207-22279229 CAGCCTCCCCGGAAGAGCGCTGG + Intergenic
1145823312 17:27857313-27857335 CAGCCTCCCTTCATCAGCACCGG - Intronic
1151541913 17:74768916-74768938 CACCCTGCCTGGGACATCGCTGG + Exonic
1152535993 17:80950653-80950675 CAGCTTCCCTGGGACAGGGCAGG + Intronic
1153102921 18:1494930-1494952 CAGCCTCCCTCCCAAAGTGCTGG + Intergenic
1153464108 18:5369723-5369745 CTGCCTCCCTGCAAGAGAGCTGG + Intergenic
1154360117 18:13653906-13653928 CAGCCTCCCAGGGACAGTGGGGG - Intergenic
1154485035 18:14866459-14866481 CAGCCACCCTCCTACAGCTCAGG - Intergenic
1157589818 18:48829584-48829606 CAGCCTCCGTGCTCCAGCACAGG + Intronic
1160987313 19:1845039-1845061 CAGACTCCCTGAGACACCACAGG + Intronic
1163831389 19:19548671-19548693 CAGCCACCCTGGGTCAGCTCAGG + Intergenic
1163844129 19:19628852-19628874 CGGCCTCCCTGCGGCGGCCCCGG + Exonic
1164179734 19:22807760-22807782 CAGGCTCCGTGCGGCGGCGCTGG - Intergenic
1164852506 19:31496279-31496301 CATCCTCCGTGGGACAGAGCCGG + Intergenic
1166709933 19:44930353-44930375 CAGCCTCCCTGCGTATGCCCAGG - Intergenic
926775561 2:16419145-16419167 CAGCCACCCTGGGACAGAGGTGG + Intergenic
934996607 2:98967432-98967454 CAGCCTCCCTGGTGCAGGGCTGG + Intergenic
935313073 2:101804650-101804672 CAGCCACACTGCTACAGCACAGG - Intronic
936048626 2:109205773-109205795 CAGCCTCCCTGAAGCAGCGGGGG + Intronic
937394256 2:121520657-121520679 CAGCCTGCCTGCAAAAGGGCAGG + Intronic
944104537 2:196065502-196065524 CAGCCTCCCAGGCACAGAGCAGG - Intronic
944511409 2:200469770-200469792 GAGCCTCCCAGCAACAGGGCTGG + Intronic
945957034 2:216096014-216096036 CAGCCTTCCTGAGAGAGCCCTGG - Exonic
946242312 2:218364239-218364261 CAGCCTGCCAGCAACAGCACAGG + Intronic
946704176 2:222441167-222441189 CAGCCTCCCTGCCAAAGCCCTGG - Intronic
947867497 2:233409673-233409695 CAGTCTCCCTACCACAGAGCAGG - Intronic
948132110 2:235608496-235608518 CAGCCTCCCTGGCCCAGCGTTGG + Intronic
1169211612 20:3768733-3768755 CAGCCTCCCTTCAGCAGGGCCGG + Intergenic
1170589688 20:17762456-17762478 CAGCCTCACTCAGACAGAGCTGG - Intergenic
1170649136 20:18223950-18223972 CAGCTTGCCTGCTACAGGGCAGG + Intergenic
1170869510 20:20192344-20192366 CAGGCTCCCTGAGACAGAACAGG - Intronic
1171175732 20:23049849-23049871 GAACCTCCCTGCGCCAGGGCAGG - Intergenic
1172147520 20:32767143-32767165 CAGCCTCCCTCCCAAAGTGCTGG + Intronic
1172756654 20:37289908-37289930 CAGCCTCCGCACGAAAGCGCAGG - Intronic
1172894524 20:38291232-38291254 CAGCCTCCCTGAGTCAGCCATGG - Intronic
1173317861 20:41961254-41961276 CAGCCTCCCTGGCACAGAGCTGG - Intergenic
1174401182 20:50276826-50276848 CAGTTTCCCTGCTACAGCGATGG + Intergenic
1175259022 20:57663397-57663419 CAGTCTCCCTGTGTCAGCGGGGG + Intronic
1176604155 21:8815390-8815412 CTGCCTCTCTGCGTCTGCGCCGG + Intergenic
1176619133 21:9043088-9043110 GGGCCTCCCTGCGCCTGCGCCGG + Intergenic
1176796293 21:13373016-13373038 CAGCCACCCTCCTACAGCTCAGG + Intergenic
1178947270 21:36959085-36959107 CAGCCTCCCAGCCACAGCTGCGG + Intronic
1179453333 21:41480387-41480409 CTGCCTCCCTGTGAAAGCACCGG - Intronic
1179563989 21:42235019-42235041 CAGCCTCCCTGGGACAGGGGCGG + Intronic
1180074929 21:45457457-45457479 CAGCCTCCCTGCCACAGTGGGGG + Intronic
1180346439 22:11706968-11706990 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180354208 22:11825121-11825143 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1180384038 22:12167205-12167227 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
1180886538 22:19248802-19248824 CAGCCTCCCTCCCAAAGTGCTGG + Intronic
1183317570 22:37145347-37145369 GAGCCTCCCTCTGACAGGGCTGG - Intronic
1183469432 22:37997748-37997770 CAGCTTCCCTGAGACTGCCCCGG + Intronic
1184934886 22:47714008-47714030 CCTCCTCCCTGGGACAGGGCTGG - Intergenic
1185086942 22:48746017-48746039 CAGCCTCCAGGAGACAGCGATGG + Intronic
1185371966 22:50465106-50465128 CAGCCTTCCTGGGCCAGCGTGGG - Exonic
952465838 3:33584771-33584793 TAGCCTCTCTGCTACAGCCCTGG + Exonic
953716705 3:45322087-45322109 CAGCCTCCCTAGGACTGCGGAGG - Intergenic
960465494 3:117992729-117992751 CAGCCTCCCTCCCAAAGTGCTGG + Intergenic
960721351 3:120627408-120627430 CAGCATCCCTCCCAGAGCGCTGG - Intergenic
961479167 3:127168456-127168478 CAGCCTCCCTCCCTCAGCTCTGG - Intergenic
961482811 3:127195060-127195082 CCTCCTCTCTGCCACAGCGCGGG - Intronic
965748517 3:171951526-171951548 CAGCCTCCCTCCCAAAGGGCTGG + Intergenic
966208959 3:177433229-177433251 CACCCTCCCTGGGGCAGCACAGG - Intergenic
967538307 3:190633608-190633630 CAGCCTCCCTCCCAAAGTGCTGG + Intronic
967942267 3:194775399-194775421 CAGCCTCCTGGCTACAGAGCAGG - Intergenic
968597954 4:1495046-1495068 CACCCACCCTGCGCCAGCTCTGG - Intergenic
968756413 4:2418428-2418450 CAGCCTCCCTGCGACAGCGCGGG - Exonic
968758048 4:2426949-2426971 CACCCTCACTGCCACAGCCCTGG - Intronic
971330817 4:25680016-25680038 CAGCCTCCCTCCCAAAGTGCTGG - Intergenic
973323178 4:48830925-48830947 GAGCCGCACTGCGACTGCGCAGG - Intronic
973338844 4:48984371-48984393 CAGCCCCCCTGCGACAGGCCCGG - Intergenic
973373962 4:49275530-49275552 CTGCCTCTCTGCGCCTGCGCCGG - Intergenic
973383450 4:49334709-49334731 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973387057 4:49519723-49519745 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
973694426 4:53476331-53476353 CAGCCTCCCTGCAAGATCCCAGG + Intronic
974260386 4:59518389-59518411 CAGCCACCCTGCCACAGCTGTGG - Intergenic
982126844 4:152191093-152191115 CACCCTCACTGCCACTGCGCAGG - Intergenic
982901141 4:161003793-161003815 CAGCCGCCCAGCGACGGCTCTGG - Intergenic
985481070 5:111282-111304 CAGCTTCCCTGGGGCAGCTCTGG + Intergenic
987008027 5:13730951-13730973 CAGCCTCCCTCCCAAAGCACTGG + Intronic
987869618 5:23598412-23598434 CAGCCTTCCTCCGAAAGCACTGG - Intergenic
989184832 5:38613505-38613527 CAACCTCCCTGCAGCAGCACAGG - Intergenic
989279284 5:39622320-39622342 CAGCCTCCCTGCCATGGCTCTGG - Intergenic
995217819 5:109615240-109615262 CAGCTTCCCTGCTACACCACTGG + Intergenic
995926924 5:117385997-117386019 CAGCCACCCAGCCACAGCTCTGG + Intergenic
997659568 5:135578991-135579013 CAGCCTCCCTCCGCCCGCCCTGG + Exonic
998129407 5:139643699-139643721 CAGCCTCCCTGCCACACTTCAGG - Intergenic
999309827 5:150544893-150544915 CAGCCTCCCTGGGGCAGTCCTGG + Intronic
1001043216 5:168351757-168351779 CAGCCTGGCTGCGACAGGACTGG - Intronic
1001493271 5:172170577-172170599 CAGCCACCCTGGCACAGCTCAGG + Intronic
1001602073 5:172935346-172935368 CAGCCACCCTGCGCCTGCTCTGG + Intronic
1002189645 5:177472040-177472062 CAGCCCCCCTGGGGCAGGGCTGG + Intronic
1002453022 5:179330458-179330480 CAGCCTCCCTGCAACTGCCCCGG + Intronic
1006573609 6:35026365-35026387 CAGCCTACCTGGAACAGAGCAGG - Intronic
1006849810 6:37090158-37090180 CAGCCTCCCTCCCAAAGTGCTGG - Intergenic
1009650230 6:66466890-66466912 GAGCCTCCCTGCCAAAGAGCAGG - Intergenic
1010489244 6:76453543-76453565 CAGCCACCCAGCCACAGCTCTGG - Intergenic
1013272506 6:108557893-108557915 CCGCGTCCCTCCGCCAGCGCGGG + Intergenic
1015157326 6:130111384-130111406 CATCCTCCCTGCCACACAGCAGG + Intronic
1018262542 6:161984859-161984881 CAGCCTCCCTGAGAGTGAGCAGG + Intronic
1018432026 6:163730205-163730227 CTGCCTCCCTGCAACAGGGAGGG - Intergenic
1019198320 6:170295428-170295450 CTTCCTGCCTGCGCCAGCGCTGG - Intronic
1019473840 7:1234842-1234864 AAGGCTCCCTGCGACAAGGCTGG + Intronic
1021908891 7:25364516-25364538 CAGCCTTCCTGGGACAGCTCTGG - Intergenic
1022475079 7:30704771-30704793 TAGGCTCCCTGCAACAGTGCTGG - Intronic
1023109288 7:36793702-36793724 CAGCTTCTCTGTGACAGAGCGGG - Intergenic
1025095622 7:56093317-56093339 CACTGTCCCTGCGACAGCCCGGG - Intergenic
1030455748 7:109772320-109772342 CAGGCTCCCTGGGACAGCTGAGG + Intergenic
1032191239 7:129767154-129767176 CAGCCTCCCTGCCACATGCCAGG + Intergenic
1035121642 7:156573233-156573255 CAACCTCCCTGTGCCAACGCCGG + Intergenic
1035512935 8:206264-206286 GCGCCTCTCTGCGCCAGCGCCGG - Intergenic
1036632518 8:10525525-10525547 CAGCCTCACTGCCTCAGCCCTGG + Exonic
1036692081 8:10950381-10950403 CACCCTCCCTGTGCCAGGGCTGG + Intronic
1039144958 8:34437511-34437533 CAGGCTCCCTGGGACAGCCCAGG + Intergenic
1039541695 8:38377600-38377622 CAGCCTCCCTCCCAAAGCGCTGG + Intronic
1039589584 8:38735400-38735422 CAGCCTCCCAGGCACAGCGCGGG - Intronic
1039816654 8:41100518-41100540 CAGCCTCCCTGGGAAAGGGCAGG - Intergenic
1039957415 8:42218043-42218065 CAGCCTCCTGGCGAGAGGGCAGG + Intergenic
1040288302 8:46111559-46111581 CAGCCTGCCTGAGACAGCCCTGG + Intergenic
1040289651 8:46117783-46117805 CAGCCTGCCTGGGACAGCCTTGG + Intergenic
1040290072 8:46119732-46119754 CAGCCTGCCTGGGACAGCCCTGG + Intergenic
1040294079 8:46140225-46140247 CAGCCTGCCTGGGAAAGTGCAGG + Intergenic
1040294115 8:46140441-46140463 CAGCCCACCTGAGACAGCCCTGG + Intergenic
1040294245 8:46141089-46141111 CAGCCCGCCTGAGACAGCCCTGG + Intergenic
1040295045 8:46144721-46144743 CAGCCTTCCTGGGCCAGCCCAGG + Intergenic
1040295964 8:46149244-46149266 CAGCATGCCTGGGACAGCCCTGG + Intergenic
1040301664 8:46191190-46191212 CAGCCTTCCTGGGACAGTCCTGG - Intergenic
1040303525 8:46200380-46200402 CAGCCTGCCCGGGACAGCCCTGG - Intergenic
1040310435 8:46234071-46234093 CAGCCTGCCTGGTACAACGCGGG - Intergenic
1040314556 8:46254175-46254197 CAGCCCGCCTGGGACAGCCCTGG - Intergenic
1040325601 8:46339993-46340015 CAGCCCCCGTGGGACAGCCCTGG - Intergenic
1040329305 8:46377822-46377844 CAGCCCGCCTGGGACAGCCCTGG - Intergenic
1040329400 8:46378257-46378279 CAGCCCGCCTGGGACAGCCCTGG - Intergenic
1040329972 8:46380922-46380944 CAGCCTTCCTGGGTCAGCCCGGG - Intergenic
1040331730 8:46389064-46389086 CAGCCCACCTGGGACAGCCCTGG - Intergenic
1040331862 8:46389713-46389735 CAGCCTGCCTTGGACAGCCCTGG - Intergenic
1040332111 8:46391001-46391023 CAGCCCTCCTGGGACAGCCCTGG - Intergenic
1040333885 8:46406338-46406360 CAGCCTGCCCGGGACAGCTCTGG - Intergenic
1040334601 8:46409661-46409683 CAGCCCTCCTGGGACAGCCCTGG - Intergenic
1040334780 8:46410515-46410537 CAGCCTGCCTGGGGCAGCCCTGG - Intergenic
1040337075 8:46421438-46421460 CAGCCCACCTGAGACAGCCCTGG - Intergenic
1040337476 8:46423379-46423401 CAGCCTGCCCGGGACAGCCCTGG - Intergenic
1040339959 8:46435457-46435479 CAGCCTGCCTGGGACAGGCCTGG + Intergenic
1040340615 8:46438684-46438706 CAGCCTGCCCGGGACAGCCCTGG + Intergenic
1040902236 8:52428830-52428852 CAGCTTCCCTGCCCCAGGGCTGG + Intronic
1045188211 8:99858915-99858937 AAGCCTCCCCGGGACAGCGGAGG - Intronic
1049209604 8:141379430-141379452 CAGCCTCCCTGGGCCAGGCCCGG - Intergenic
1049556772 8:143286421-143286443 CAGCATCCGTGCGACAAGGCTGG + Intergenic
1051233859 9:14978540-14978562 CCGCCTCCCTGCGTGACCGCTGG + Intergenic
1053455567 9:38230887-38230909 CAGCCCCCCAGAGACAGGGCAGG - Intergenic
1054350964 9:64016540-64016562 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1056655430 9:88504838-88504860 CAGCCTCACTGTGAAAGCCCGGG - Intergenic
1056762869 9:89427412-89427434 CTGCCTCCCTGAGACAGCCGGGG + Intronic
1056970236 9:91195416-91195438 CAGGCTCCCAGCCACAGAGCAGG - Intergenic
1060991396 9:127851471-127851493 CAGCCTCCCTCCCAAAGTGCTGG + Intronic
1061280940 9:129597393-129597415 CAGCCTTCCCGGGACAGGGCCGG - Intergenic
1061899448 9:133665617-133665639 CAGCCTCCCAGCTCCACCGCCGG + Intronic
1061932858 9:133842309-133842331 CAGCCTCCCTGATACACTGCTGG - Intronic
1062663275 9:137651532-137651554 CGGCCTCCCTCCCACAGCGATGG - Intronic
1062685259 9:137809414-137809436 CCGCCTCCCTCCGAGGGCGCAGG - Intronic
1203551562 Un_KI270743v1:167545-167567 CTGCCTCTCTGCGCCTGCGCCGG + Intergenic
1188647763 X:32591764-32591786 CAGCCACCCAGCCACAGCTCCGG + Intronic
1190318633 X:49166398-49166420 GAGCCTACCTCTGACAGCGCGGG + Exonic
1192200101 X:69061163-69061185 CCTCCTCCCTGCAACAGCACAGG + Intergenic
1197348773 X:125357515-125357537 GAGCCTGCCTGTGACAGTGCTGG + Intergenic
1199483648 X:148325362-148325384 CATCCTCCGTGGGACAGAGCCGG - Intergenic
1200093870 X:153648211-153648233 CGGCCTCCCCGCGCCGGCGCCGG - Exonic
1202386300 Y:24329785-24329807 CAGCCTCCCTGTCACAGCTATGG + Intergenic
1202484486 Y:25340343-25340365 CAGCCTCCCTGTCACAGCTATGG - Intergenic