ID: 968756413

View in Genome Browser
Species Human (GRCh38)
Location 4:2418428-2418450
Sequence CAGCCTCCCTGCGACAGCGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 230}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968756413_968756424 16 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756424 4:2418467-2418489 GCGCCGAGCGGGCGGCGGGCAGG 0: 1
1: 0
2: 6
3: 70
4: 607
968756413_968756429 29 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756429 4:2418480-2418502 GGCGGGCAGGTGCGCGGGGCAGG 0: 1
1: 0
2: 10
3: 115
4: 866
968756413_968756416 -8 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756416 4:2418443-2418465 GGAGGCTGGCTAGCGAAGCCCGG 0: 1
1: 0
2: 0
3: 16
4: 178
968756413_968756418 5 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756418 4:2418456-2418478 CGAAGCCCGGAGCGCCGAGCGGG 0: 1
1: 0
2: 0
3: 6
4: 77
968756413_968756427 24 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756427 4:2418475-2418497 CGGGCGGCGGGCAGGTGCGCGGG 0: 1
1: 1
2: 8
3: 62
4: 419
968756413_968756426 23 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756426 4:2418474-2418496 GCGGGCGGCGGGCAGGTGCGCGG 0: 1
1: 0
2: 13
3: 82
4: 725
968756413_968756417 4 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756417 4:2418455-2418477 GCGAAGCCCGGAGCGCCGAGCGG 0: 1
1: 0
2: 0
3: 7
4: 78
968756413_968756428 25 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756428 4:2418476-2418498 GGGCGGCGGGCAGGTGCGCGGGG 0: 1
1: 1
2: 9
3: 59
4: 600
968756413_968756423 12 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756423 4:2418463-2418485 CGGAGCGCCGAGCGGGCGGCGGG 0: 1
1: 0
2: 2
3: 34
4: 284
968756413_968756422 11 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756422 4:2418462-2418484 CCGGAGCGCCGAGCGGGCGGCGG 0: 1
1: 0
2: 3
3: 15
4: 253
968756413_968756419 8 Left 968756413 4:2418428-2418450 CCCGCGCTGTCGCAGGGAGGCTG 0: 1
1: 0
2: 1
3: 22
4: 230
Right 968756419 4:2418459-2418481 AGCCCGGAGCGCCGAGCGGGCGG 0: 1
1: 0
2: 2
3: 19
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968756413 Original CRISPR CAGCCTCCCTGCGACAGCGC GGG (reversed) Exonic