ID: 968757862

View in Genome Browser
Species Human (GRCh38)
Location 4:2426151-2426173
Sequence CCATCACCACAGACCGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 151}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968757862_968757871 15 Left 968757862 4:2426151-2426173 CCAGCTTCGGTCTGTGGTGATGG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 968757871 4:2426189-2426211 GAACTCACCCAGGCCAGCCTGGG 0: 1
1: 0
2: 1
3: 18
4: 249
968757862_968757867 -9 Left 968757862 4:2426151-2426173 CCAGCTTCGGTCTGTGGTGATGG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 968757867 4:2426165-2426187 TGGTGATGGGGGTGACCTGATGG 0: 1
1: 0
2: 2
3: 27
4: 362
968757862_968757870 14 Left 968757862 4:2426151-2426173 CCAGCTTCGGTCTGTGGTGATGG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 968757870 4:2426188-2426210 TGAACTCACCCAGGCCAGCCTGG No data
968757862_968757868 5 Left 968757862 4:2426151-2426173 CCAGCTTCGGTCTGTGGTGATGG 0: 1
1: 0
2: 0
3: 7
4: 151
Right 968757868 4:2426179-2426201 ACCTGATGGTGAACTCACCCAGG 0: 1
1: 0
2: 0
3: 9
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968757862 Original CRISPR CCATCACCACAGACCGAAGC TGG (reversed) Intronic
901135308 1:6989141-6989163 CCACCACCACAGCCTGATGCAGG + Intronic
901829253 1:11882080-11882102 ACACCACCACACACAGAAGCAGG + Intergenic
904600110 1:31668392-31668414 CCACCACCACAGACCTGGGCTGG + Intronic
905335906 1:37244357-37244379 CCATCACCTCGGAGGGAAGCAGG + Intergenic
905424285 1:37870663-37870685 CCCTCACCAGACACCAAAGCTGG + Intronic
913460740 1:119083372-119083394 CCCTCACCACACACCAAGGCTGG + Intronic
914702372 1:150146998-150147020 TCTTCACCACAGACAGAAACTGG + Intergenic
918100443 1:181368586-181368608 CCATCCTCACAGACAGAAGAGGG - Intergenic
918353655 1:183684309-183684331 CCAGCATCAAAGACCAAAGCTGG - Intronic
919332781 1:196192717-196192739 CCATCATCAAAGACCAAAGGTGG - Intergenic
922727975 1:227933830-227933852 CAATCACCACAGTCAGACGCAGG + Intronic
923601600 1:235408097-235408119 CCATTACCACAGACACAGGCTGG - Intronic
1069001255 10:63268874-63268896 CCAAGACCACAGAACGAAGCAGG + Intronic
1070276307 10:75010724-75010746 CCAACCCCACAGACCGATGGTGG - Intronic
1071633029 10:87231310-87231332 CCAGCATCACAGACCAAAGTGGG + Intronic
1071646478 10:87363528-87363550 CCAGCATCACAGACCAAAGTGGG + Intronic
1072840485 10:98768933-98768955 CCAGCTACTCAGACCGAAGCAGG + Intronic
1074800120 10:116991404-116991426 CCATCAACACAAACAGATGCTGG - Intronic
1075189973 10:120298183-120298205 CAATCACCACAAAGCAAAGCAGG + Intergenic
1075932873 10:126314134-126314156 GCATCACCACCGACCTGAGCAGG + Intronic
1076522499 10:131089874-131089896 CCATCCCCACAGCCCCGAGCTGG - Intergenic
1077389542 11:2293688-2293710 CCATCACCCCTGATCCAAGCAGG - Intergenic
1077457567 11:2690058-2690080 CCTTCAGCCCAGACAGAAGCAGG - Intronic
1077591762 11:3498067-3498089 CCATCATCAAAGACCAAAGATGG - Intergenic
1080739116 11:35047385-35047407 CCCCCACCACAGACAGAAGAGGG - Intergenic
1082905978 11:58309273-58309295 CCATCATCAAAGACCAAAGGTGG - Intergenic
1083592333 11:63903074-63903096 CCACCAGCACAAATCGAAGCAGG + Exonic
1083609875 11:63999635-63999657 CCCTCACCACCGAGCGGAGCCGG + Exonic
1087508739 11:99062173-99062195 CCATCAGCACAGTCTGAATCTGG - Intronic
1088198430 11:107302257-107302279 CCATCCCCACTGAGCTAAGCGGG - Intergenic
1089598057 11:119594635-119594657 CCAACTACACAGACCCAAGCTGG - Intergenic
1091326497 11:134693063-134693085 CCATCATCAAAGACCAAAGGTGG + Intergenic
1094512070 12:31102927-31102949 CCATCACCACACACCTGGGCGGG - Exonic
1101330941 12:103757551-103757573 CCATCACTTCAGACAGAAGGGGG - Intronic
1104099545 12:125593516-125593538 CCCTAACCTCAGACCTAAGCAGG - Intronic
1106702570 13:32245689-32245711 ACATGACCACAGACTAAAGCAGG + Intronic
1106779418 13:33042424-33042446 CCATCACCACAGACTGATTTTGG + Intronic
1109729161 13:66387664-66387686 CCCTCACCAGAAACAGAAGCTGG + Intronic
1112295674 13:98184652-98184674 CCATCACCAAAGGCGGAAGCAGG - Intronic
1115034981 14:28846223-28846245 CCAACATCAAAGACCGAAGGTGG + Intergenic
1117580111 14:57143441-57143463 CCATCATCCCGGACCCAAGCTGG + Intergenic
1117718441 14:58604459-58604481 CCACCACCACAGAAAGAGGCTGG + Intergenic
1118902570 14:69999040-69999062 CCATCAGCACAGACATAAGGTGG + Intronic
1122021082 14:98838536-98838558 TCATCATCTCAGACAGAAGCAGG - Intergenic
1122457051 14:101862285-101862307 CCATCACCACTGAGCTCAGCAGG - Intronic
1126198235 15:45955414-45955436 CCATCAGCAGAGTCAGAAGCGGG + Intergenic
1127227529 15:56948640-56948662 CAATCACCTCAGAATGAAGCTGG + Intronic
1127287124 15:57541924-57541946 CCAACACCACAGGGGGAAGCTGG - Intronic
1128854063 15:70992443-70992465 CCATCATCAAAGACCAAAGTTGG - Intronic
1130722466 15:86402697-86402719 CCATCACCACAAAAGGAAACGGG - Intronic
1131866148 15:96712153-96712175 CTTTGACCACAGACCCAAGCAGG - Intergenic
1133587042 16:7205700-7205722 CCATCACCAAAGACTGCAGATGG - Intronic
1136028385 16:27484930-27484952 CCATCAACACTGACCTATGCAGG + Intronic
1138126432 16:54442643-54442665 CTCTCACTACAGACTGAAGCTGG + Intergenic
1141669640 16:85485088-85485110 CCGCCACCACAGACAAAAGCAGG + Intergenic
1146284742 17:31566841-31566863 CCATCACCAGACACAGAAGGAGG - Intergenic
1151850556 17:76687233-76687255 CCATCAGCACAGCCTGAAGCAGG - Intronic
1152552150 17:81035218-81035240 GCTGCACCACAGACCGGAGCGGG - Exonic
1156296041 18:35791602-35791624 CCATCATCAAAGACCAAAGGTGG + Intergenic
1157397763 18:47356924-47356946 CCATCTCCACAGTTGGAAGCTGG - Intergenic
1159002528 18:62986991-62987013 CCATCACCAGTGAACGAAGAGGG + Intergenic
1160145213 18:76358113-76358135 AAATAACCACAGACCAAAGCGGG + Intergenic
1164234083 19:23316975-23316997 CCGTCAACACAGACCACAGCTGG + Intronic
1165312026 19:35034218-35034240 TCATCACCACAGAGGGCAGCAGG - Exonic
1165391787 19:35543214-35543236 CCACCACCACAGACCACAGGAGG - Intronic
927863634 2:26575580-26575602 CCATCCCCAAAGACCTGAGCAGG + Intronic
929795485 2:45055564-45055586 CCATCAGCCCAGACCCCAGCAGG + Intergenic
931189267 2:59983772-59983794 CCAAGACCACAGACCCAATCAGG + Intergenic
934475053 2:94588210-94588232 GCATCTCCACAGTCCAAAGCTGG + Intergenic
934700267 2:96433950-96433972 CAAGCCCCACAGACTGAAGCTGG + Intergenic
937445263 2:121952235-121952257 GCATCACCACACACAGGAGCAGG + Intergenic
940695063 2:156967471-156967493 CCATCATCAAAGACCAAAGGTGG - Intergenic
940705688 2:157102418-157102440 CCATCATCAAAGACCAAAGGTGG - Intergenic
946667823 2:222069150-222069172 CAATCACAACAGACAGAATCTGG + Intergenic
947931199 2:233966579-233966601 ACATCAGCACAGAGAGAAGCTGG - Intronic
1169020610 20:2328137-2328159 CGAACACCAATGACCGAAGCGGG - Exonic
1175117312 20:56691645-56691667 CCTTCACCACCGAGAGAAGCAGG + Intergenic
1175757525 20:61538990-61539012 CCAGCGGCAGAGACCGAAGCAGG - Intronic
1176177787 20:63736851-63736873 CCAGCAGCAGAGACAGAAGCTGG - Intronic
1177188259 21:17821296-17821318 CCATCACCAGAAACAGATGCTGG - Intergenic
1178229288 21:30762812-30762834 CCATCACCACAGCCAGAGCCAGG + Intergenic
1180098899 21:45575129-45575151 CCATCACCAGAGGCAGGAGCTGG - Intergenic
1180963317 22:19772719-19772741 ACATCATCACAGAACGAAGATGG + Intronic
1181044318 22:20207461-20207483 CCATCACCCCAGACCCATGCAGG + Intergenic
1184886656 22:47350655-47350677 CCATCATCAAAGACCAAAGGTGG - Intergenic
949919657 3:8990791-8990813 CCATCCCCAGACGCCGAAGCGGG - Exonic
951816557 3:26761543-26761565 TCATCACCACAGAGCCCAGCCGG - Intergenic
955303814 3:57809639-57809661 CCAGCCCTACAGACAGAAGCGGG + Intronic
956579670 3:70796540-70796562 CCATCATCAAAGACCAAAGGTGG - Intergenic
960061686 3:113329510-113329532 GCATCACCACAGGGTGAAGCTGG + Intronic
964922553 3:161914929-161914951 CCATTACCACAGAATGAAGATGG + Intergenic
965581289 3:170270434-170270456 CCATCTGCACAGACCGAATATGG + Exonic
968757862 4:2426151-2426173 CCATCACCACAGACCGAAGCTGG - Intronic
971081290 4:23214746-23214768 GCATCAGCAAAGACAGAAGCCGG - Intergenic
972057207 4:34818172-34818194 CCATTGCCAAAGACTGAAGCTGG + Intergenic
972156117 4:36164300-36164322 CCATGATCACACACCTAAGCTGG + Intronic
972416798 4:38848289-38848311 CCATCATCAAAGACCAAAGGTGG + Intronic
972455245 4:39247361-39247383 CCATCATCAAAGACCAAAGGTGG + Intronic
982677442 4:158392067-158392089 CCATCACCAGGGTCCGAGGCTGG + Intronic
983183642 4:164676881-164676903 CCATCATCAAAGACCAAAGGTGG + Intergenic
984222398 4:176994281-176994303 CCATAACCACAGATCTATGCAGG + Intergenic
985600244 5:824892-824914 CCATCACCACAGCCTGATGGTGG + Intronic
987274390 5:16346641-16346663 CCATCATCACTGGCCGAAGATGG + Intergenic
988478496 5:31609549-31609571 CCATCACCTAACACCGAACCTGG - Intergenic
992926489 5:81592847-81592869 CCATCATCAAAGACCAAAGGTGG + Intronic
996507157 5:124280388-124280410 CAAGCACCACAGACCCAGGCAGG + Intergenic
998266198 5:140669477-140669499 CCACCACCACAGCTCGCAGCTGG - Exonic
999252390 5:150190462-150190484 CCTTCCCCAGAGCCCGAAGCTGG - Intronic
1002169912 5:177369214-177369236 CCATCCCCACAGACCCATCCTGG + Intronic
1002915180 6:1523225-1523247 CCATCACCACCACCCGAATCAGG - Intergenic
1006047965 6:31314803-31314825 CCATCACTACAGAAGGGAGCTGG - Intronic
1014291011 6:119558845-119558867 CCATCACTACAGACATTAGCCGG - Intergenic
1023402436 7:39800290-39800312 CCAACACCAGAGACTGATGCTGG + Intergenic
1024647184 7:51380375-51380397 CCAACACCAGAGACTGATGCTGG - Intergenic
1026902406 7:74044472-74044494 CCATCATCACAGCCCGAGGCGGG + Intronic
1028814931 7:95132792-95132814 CCAGCACCCAAGACCGAAGCAGG - Intronic
1029255752 7:99268377-99268399 CCAACTTCACAGAACGAAGCGGG + Intergenic
1029965391 7:104734853-104734875 CCATCATCAAAGACCAAAGGTGG - Intronic
1034196972 7:149255493-149255515 CCATCCCCCCAGACAGCAGCGGG - Exonic
1035662189 8:1356488-1356510 CCACCAGCACAGACAGAACCAGG - Intergenic
1039850014 8:41357085-41357107 CCATCATCAAAGACCAAAGGTGG - Intergenic
1040390227 8:46943150-46943172 CCATCATCAAAGACCAAAGGTGG + Intergenic
1041035509 8:53785673-53785695 CCATCATCAAAGACCAAAGGTGG - Intronic
1042691426 8:71503813-71503835 GCATCCCCACAGACCACAGCAGG + Intronic
1044601355 8:94008757-94008779 CCATCATCAAAGACCAAAGGTGG - Intergenic
1047349542 8:124060504-124060526 CCATCACCACAGATCCACGGAGG - Intronic
1049179752 8:141216175-141216197 CCAGCACCACAGACAGAAATTGG + Intronic
1049787348 8:144457364-144457386 TCATCAGCACAGAATGAAGCTGG - Intronic
1049837670 8:144748844-144748866 CCATCACTCCTGGCCGAAGCAGG + Intronic
1049940862 9:544945-544967 CCATCCTCACATACCCAAGCTGG - Intronic
1051354032 9:16224332-16224354 CCATCATCAAAGACCAAAGTCGG + Intronic
1051387392 9:16523676-16523698 CCAACACCAGAGGCCGAGGCGGG + Intronic
1052854998 9:33401552-33401574 GCATCTCCACAGTCCAAAGCCGG - Intronic
1053683018 9:40497881-40497903 GCATCTCCACAGTCCAAAGCTGG - Intergenic
1053725829 9:40999458-40999480 CCATGACCAACGACTGAAGCTGG - Intergenic
1053933000 9:43126195-43126217 GCATCTCCACAGTCCAAAGCTGG - Intergenic
1054280696 9:63127047-63127069 GCATCTCCACAGTCCAAAGCTGG + Intergenic
1054296118 9:63333381-63333403 GCATCTCCACAGTCCAAAGCTGG - Intergenic
1054394134 9:64637876-64637898 GCATCTCCACAGTCCAAAGCTGG - Intergenic
1054428784 9:65143089-65143111 GCATCTCCACAGTCCAAAGCTGG - Intergenic
1054501596 9:65878454-65878476 GCATCTCCACAGTCCAAAGCTGG + Intronic
1057120913 9:92573235-92573257 CCATCATCAAAGACCAAAGGTGG - Intronic
1057250056 9:93493836-93493858 CCACCACTACGGACAGAAGCTGG - Intronic
1057415837 9:94861531-94861553 CCATGACAACAGAGCCAAGCTGG + Intronic
1058305723 9:103438668-103438690 CCATCATCAAAGACCAAAGGTGG - Intergenic
1058703615 9:107621017-107621039 CCACCAGCACAGACCGGGGCTGG - Intergenic
1185736813 X:2501370-2501392 CCAGGACCACAGACCCCAGCAGG + Intronic
1185736826 X:2501410-2501432 CCAGGACCACAGACCCCAGCAGG + Intronic
1186870298 X:13764906-13764928 CCATCACCCAGGACCGCAGCAGG + Intronic
1188972269 X:36632581-36632603 CCATCACCACAGGCCTATGGGGG + Intergenic
1190635277 X:52426819-52426841 GCTTCACCACAGACCCCAGCTGG - Intergenic
1190908789 X:54753610-54753632 CCATCACCATACACCAAAGCTGG - Intronic
1191615575 X:63166721-63166743 CCATTTCCCCAGACCCAAGCAGG + Intergenic
1191620723 X:63212202-63212224 CCATTTCCCCAGACCCAAGCAGG - Intergenic
1192185694 X:68945436-68945458 CCCTCCCTACAGACAGAAGCTGG + Intergenic
1193194811 X:78619466-78619488 CCACCACCACAGACCCATGGGGG + Intergenic
1195908145 X:109865284-109865306 GTATCACCACGGACCCAAGCTGG + Intergenic
1195966525 X:110434580-110434602 GTATCACCACGGACCCAAGCTGG - Intronic
1196502461 X:116401298-116401320 CCTTCACCTCAGGCCGAAGTAGG + Intergenic