ID: 968761021

View in Genome Browser
Species Human (GRCh38)
Location 4:2442852-2442874
Sequence TGCCCCCAAGGCCACCGCGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 135}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968761021_968761035 10 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761035 4:2442885-2442907 TGGGGGTGCTGGGGGCCTTGGGG No data
968761021_968761038 16 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761038 4:2442891-2442913 TGCTGGGGGCCTTGGGGGCAGGG 0: 3
1: 1
2: 3
3: 96
4: 616
968761021_968761036 11 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761036 4:2442886-2442908 GGGGGTGCTGGGGGCCTTGGGGG 0: 3
1: 2
2: 8
3: 123
4: 941
968761021_968761029 -1 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761029 4:2442874-2442896 AGGGAGCTCACTGGGGGTGCTGG 0: 2
1: 0
2: 1
3: 34
4: 342
968761021_968761028 -7 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761028 4:2442868-2442890 GGGGGCAGGGAGCTCACTGGGGG 0: 2
1: 0
2: 3
3: 69
4: 952
968761021_968761037 15 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761037 4:2442890-2442912 GTGCTGGGGGCCTTGGGGGCAGG No data
968761021_968761042 28 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761042 4:2442903-2442925 TGGGGGCAGGGAGCTCACTGGGG 0: 4
1: 1
2: 7
3: 80
4: 632
968761021_968761034 9 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761034 4:2442884-2442906 CTGGGGGTGCTGGGGGCCTTGGG 0: 3
1: 0
2: 9
3: 80
4: 594
968761021_968761027 -8 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761027 4:2442867-2442889 TGGGGGCAGGGAGCTCACTGGGG 0: 4
1: 1
2: 7
3: 80
4: 632
968761021_968761040 26 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761040 4:2442901-2442923 CTTGGGGGCAGGGAGCTCACTGG No data
968761021_968761025 -10 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761025 4:2442865-2442887 CTTGGGGGCAGGGAGCTCACTGG 0: 4
1: 0
2: 4
3: 40
4: 382
968761021_968761041 27 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761041 4:2442902-2442924 TTGGGGGCAGGGAGCTCACTGGG 0: 4
1: 0
2: 4
3: 39
4: 372
968761021_968761033 8 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761033 4:2442883-2442905 ACTGGGGGTGCTGGGGGCCTTGG No data
968761021_968761030 0 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761030 4:2442875-2442897 GGGAGCTCACTGGGGGTGCTGGG 0: 2
1: 0
2: 2
3: 24
4: 267
968761021_968761032 2 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761032 4:2442877-2442899 GAGCTCACTGGGGGTGCTGGGGG 0: 1
1: 0
2: 5
3: 47
4: 383
968761021_968761026 -9 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761026 4:2442866-2442888 TTGGGGGCAGGGAGCTCACTGGG 0: 4
1: 0
2: 4
3: 39
4: 372
968761021_968761031 1 Left 968761021 4:2442852-2442874 CCTGCGCGGTGGCCTTGGGGGCA 0: 1
1: 0
2: 0
3: 10
4: 135
Right 968761031 4:2442876-2442898 GGAGCTCACTGGGGGTGCTGGGG 0: 2
1: 0
2: 2
3: 40
4: 396

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968761021 Original CRISPR TGCCCCCAAGGCCACCGCGC AGG (reversed) Intronic
900077369 1:828028-828050 TGCCGCCCTGGACACCGCGCCGG + Intergenic
900512271 1:3066385-3066407 TGTCCCCAAGGCCATGGCCCTGG - Intergenic
900936433 1:5769121-5769143 TACCCCCCAGCCCACCGCCCTGG + Intergenic
901039712 1:6356510-6356532 TGCTGCCAAGGTCACCGCACAGG - Intronic
903291286 1:22315840-22315862 TGCCCTCAGGGCCTCCGCACTGG - Intergenic
903330649 1:22595382-22595404 TGCCCCCAGCCCCACCGAGCCGG + Intronic
904461333 1:30682108-30682130 GACCCCCAAGGCCACCCAGCTGG - Intergenic
907912625 1:58840214-58840236 AGCCTCCAAGGCCACCCGGCAGG - Intergenic
912683145 1:111741469-111741491 TGCCCCCAAGGACACAGCTGTGG + Intronic
912947393 1:114096421-114096443 TGCCCCAAAGGTCACAGGGCAGG + Intronic
913608358 1:120487533-120487555 TTCCCCCAAGTCCACAGGGCTGG - Intergenic
914582844 1:149034304-149034326 TTCCCCCAAGTCCACAGGGCTGG + Intronic
916785664 1:168085444-168085466 TGCTCCCAAGGCCGCGGCACAGG + Exonic
918480725 1:184974270-184974292 TGCTCCCCAGGCCCCCGGGCGGG + Intronic
919936649 1:202255320-202255342 TGACCCCAAGGCCACTGCTGTGG - Intronic
923058599 1:230449188-230449210 TGCCCCCAACTCCACCCCGTGGG + Intergenic
1067225480 10:44373419-44373441 TGGCCCCAGGGCCTCCGCGCAGG - Intronic
1067661160 10:48237205-48237227 TGCCCCCAAGGGTACCTAGCAGG + Intronic
1070280376 10:75044004-75044026 TGCGCCCAGGGCGACGGCGCTGG - Exonic
1075172316 10:120127459-120127481 TGCCCCCAGTGCCACCCAGCTGG - Intergenic
1075777317 10:124997246-124997268 TTCCCACAAGGCCACAGAGCTGG + Intronic
1077027650 11:448387-448409 TGACCCCAACGCCACCGAGAGGG + Intronic
1077032829 11:477407-477429 TGACCCCAGGGCCACCCCCCAGG - Intronic
1084332195 11:68436828-68436850 TGCCCCCCAGCCCACCATGCAGG - Intronic
1085596852 11:77819508-77819530 TCCACATAAGGCCACCGCGCGGG - Intronic
1089273205 11:117315687-117315709 CGCCCCCCAGGCCGCTGCGCAGG + Exonic
1089339269 11:117746558-117746580 TGCCCCCAATGGCAGCGCGGAGG - Intronic
1090051385 11:123382822-123382844 TGCACCCAAGGCCACAGCTCAGG - Intergenic
1094064436 12:26348417-26348439 TGCCCTCAAGGCCACCATGTTGG - Intronic
1096510633 12:52125979-52126001 TTCCCCCAGGGCCACCTGGCTGG - Intergenic
1097679056 12:62632238-62632260 TGCCCTCAAGGTCGCGGCGCAGG - Intergenic
1103918082 12:124386180-124386202 TCCCACCGAGGCCACTGCGCGGG + Intronic
1103924566 12:124416491-124416513 TGCCACCAATGCCACCTCCCAGG + Intronic
1104021315 12:124994097-124994119 TGCCCGCCCGGCCAGCGCGCGGG + Intronic
1110925763 13:81149537-81149559 TGCCCCCCAGACCCCAGCGCAGG - Intergenic
1113930900 13:113968365-113968387 TGACCCCCAGGCCACCGTCCCGG + Intergenic
1115755139 14:36521353-36521375 TGCCTCCAAGACACCCGCGCTGG + Intergenic
1121178220 14:91906809-91906831 TGCCCCCAATGCCTCTGCTCAGG + Intronic
1122796109 14:104207051-104207073 TGCACCCAAGGCCAGCACCCAGG - Intergenic
1124943341 15:34239046-34239068 TGCCCCCAAGGCCACATGACTGG + Exonic
1128252400 15:66172368-66172390 TGCCCACCAGGCCACGGAGCAGG - Intronic
1129842081 15:78750146-78750168 TGCCACCCTGGCCACCCCGCTGG + Intergenic
1132229161 15:100168998-100169020 TGCCCCCACCACCACCGCGCTGG - Intronic
1132232352 15:100193453-100193475 TGCCTCCAAGGCCCCAGTGCTGG - Intronic
1136498744 16:30659348-30659370 TTGCCCCAAGGCCACGGCCCGGG - Exonic
1137709862 16:50559063-50559085 TTGGCCCAAGGCCACCGAGCTGG - Intronic
1138556940 16:57776263-57776285 TGCTCCCAGGGCCGCCCCGCTGG - Intronic
1139514766 16:67446517-67446539 TGCCCCCAACCCCACAGTGCTGG + Intronic
1139632642 16:68239795-68239817 TGTCCCCGAGGCAACAGCGCCGG - Intergenic
1141423477 16:83931514-83931536 TGCCTCCAGGGCCACCGCCCAGG - Intronic
1142130989 16:88431370-88431392 TGCCCCCAGGACCACCCAGCAGG - Exonic
1142132414 16:88437109-88437131 TGCCCTCCAGGCCTCCGGGCAGG - Exonic
1142223101 16:88864900-88864922 TGCCACCAAGGGCTCCGTGCAGG - Exonic
1142643660 17:1299138-1299160 TGCACCCCAGGCCATCGCGGGGG - Exonic
1143548625 17:7614932-7614954 GGCCCCGAGGGCCACCGCGCAGG + Intronic
1144465382 17:15492986-15493008 TGCTGCCAGGGCCACCGCGGGGG + Intronic
1145788732 17:27611038-27611060 TGGCGCCAAGGCCACCCCACTGG - Intronic
1147659137 17:42107898-42107920 CGCCCCAAAGGCCTCCGCCCCGG + Intronic
1149658295 17:58321692-58321714 TCCCTCCCAGGCCACCGCCCAGG + Intronic
1150143502 17:62749826-62749848 TGCCCCCGGTGCCACCGCTCAGG + Intronic
1157866967 18:51196446-51196468 GGCCCCCAAGTCCACCGCGAAGG - Intronic
1159304072 18:66616574-66616596 TGGCCCCAAGTCCACTGCACCGG - Intergenic
1160797505 19:952822-952844 TGGGCCCAAGGACACCGCCCTGG + Intronic
1161683514 19:5692195-5692217 TGCCCCCAGGCCAAGCGCGCAGG - Exonic
1163284056 19:16335336-16335358 GGCCCCCAAGGCCAGGGCACCGG - Intergenic
1163537247 19:17883841-17883863 TGCCCCCAGGGCGTCCTCGCGGG + Exonic
1164822567 19:31261394-31261416 TCCCTCCAAGGCCACCCCTCGGG - Intergenic
1165037200 19:33042284-33042306 TGCCCCCTTGGCCACAGAGCAGG + Intronic
1167605584 19:50480027-50480049 TGCCCACCAGGCCTCCGCGAAGG - Intronic
1168148935 19:54434815-54434837 TGCCCCCAGGGACACCTGGCTGG + Intronic
1168148946 19:54434849-54434871 TGCCCCCAGGGACACCTGGCCGG + Intronic
925921442 2:8640758-8640780 TGGCCCCAACGCCACCAGGCTGG + Intergenic
936158983 2:110070009-110070031 TTCCCCCAGTGCCACCGAGCTGG + Intergenic
936185678 2:110301323-110301345 TTCCCCCAGTGCCACCGAGCTGG - Intergenic
936522369 2:113219361-113219383 TACACCCAAGGCCACCACTCAGG + Intronic
937304965 2:120865523-120865545 TGCCTCCAAGGGCACCGCAAAGG - Intronic
938194376 2:129314144-129314166 TGCCCCCAAGACCACAGGGATGG + Intergenic
938405631 2:131031748-131031770 TACCCCCAAGGCCATGGCCCAGG + Intronic
947516966 2:230814433-230814455 TGCCACCCAGGCCACAGCCCAGG - Intronic
948408478 2:237740821-237740843 TGACCCCGAGGCCACGGCCCAGG + Intronic
948625481 2:239265644-239265666 TGCTCACCAGGCCACAGCGCCGG + Intronic
948826990 2:240577646-240577668 TGCCCTCAAGTCCTTCGCGCTGG + Exonic
1168955861 20:1833791-1833813 GGCACCCAAGGCCACAGAGCTGG + Intergenic
1170764056 20:19275179-19275201 TGCCCCTAAGGCCACTTCCCTGG + Intronic
1171988308 20:31676104-31676126 TGCCCCCAAGCCCATCACCCTGG - Intronic
1175599677 20:60263125-60263147 TGCCTCCATGGCCAGCGAGCAGG - Intergenic
1175786699 20:61716430-61716452 TGCCCCCAAAGCCCCAGCTCAGG - Intronic
1179611939 21:42557634-42557656 TGCCCCCAAGGCCACCCACTGGG + Intronic
1179873566 21:44255989-44256011 TGCCCCTCAGGCCACCCCCCGGG - Intronic
1180080890 21:45487087-45487109 TGCCAGCAAGGCCACCGCCCAGG - Intronic
1182751409 22:32644808-32644830 AGCCACCAAGGCCACAGCACTGG - Intronic
1183986795 22:41574654-41574676 TGCCCCCAAGGCCAGGCCACAGG + Intronic
950633165 3:14297741-14297763 TGCCCCCAACGCCAGCGCTCCGG + Intergenic
953910169 3:46888844-46888866 TGCCCCGAAGGCGGCCACGCTGG + Intronic
954302068 3:49705401-49705423 TGCCCCCATGGGCTCCCCGCGGG + Intronic
954613046 3:51956266-51956288 GGCCCCCACGGCCGGCGCGCGGG + Exonic
954925667 3:54232043-54232065 CGCCCCCAAGGCCACAGAGGAGG - Intronic
957193733 3:77040971-77040993 TGCCCCCAAGGAGCCCGTGCCGG - Intronic
963741584 3:149086702-149086724 CGCCCCCAAGGCGGGCGCGCGGG + Intergenic
966362927 3:179148905-179148927 TGCGCCCAGGGCCGCCGCCCCGG + Intronic
968641482 4:1717126-1717148 TCCCCCCAAAGCCACAGGGCAGG - Exonic
968667948 4:1831512-1831534 GGCCCCCAAGGCCACCCCAGTGG + Intronic
968760939 4:2442584-2442606 TGCCCCCAAGACCACCATTCAGG + Intronic
968761021 4:2442852-2442874 TGCCCCCAAGGCCACCGCGCAGG - Intronic
968997959 4:3956857-3956879 CACCCCCAAGCCCACCCCGCAGG - Intergenic
969393982 4:6909285-6909307 CGCTCCCAAGACCACCGCGGCGG + Intronic
969545147 4:7821148-7821170 TTCCCCCAAGGCCACACAGCTGG - Intronic
969672804 4:8598920-8598942 TGCCCCCAAGGACACCACCAGGG - Intronic
969717027 4:8872674-8872696 TGCCCCCAAGACCTTCGCCCAGG - Intergenic
970260203 4:14216557-14216579 TGCCTCCAAGTCCACCACCCTGG - Intergenic
985530385 5:430541-430563 AGGCCCCAAGGCCACCTTGCCGG + Intronic
986402790 5:7396049-7396071 CGCCGCCACCGCCACCGCGCGGG - Intergenic
992676743 5:79112527-79112549 TGCACCCAAGGCCCAGGCGCTGG + Intronic
993905610 5:93620669-93620691 TGCCCTGAAGGAGACCGCGCGGG - Exonic
998583501 5:143403827-143403849 TGCCCCCACGCCCTCCGCGCGGG + Intronic
1002493685 5:179597785-179597807 TGCCCCCAGGGCCACTCAGCTGG + Intronic
1002569332 5:180131112-180131134 TGCCCCCAATGCATCCACGCCGG + Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1002991861 6:2245723-2245745 TCCGCCGACGGCCACCGCGCGGG + Intergenic
1003040989 6:2687089-2687111 TACCCTCAAGGCCACAGGGCAGG + Intronic
1007518137 6:42429656-42429678 AGCCCCCAAGGACACAGCACTGG + Intronic
1017842277 6:158232008-158232030 CGTCCCCAACGCCACCCCGCGGG - Intergenic
1018709357 6:166486636-166486658 AGCCCCCAATGCCACCTGGCAGG - Intronic
1018987040 6:168645735-168645757 TTCCCCCCAGGTCACCACGCAGG + Intronic
1019235891 6:170612321-170612343 TGCCGCCCTGGACACCGCGCCGG - Intergenic
1022447038 7:30478968-30478990 TGAGCCCCTGGCCACCGCGCAGG + Intergenic
1027250818 7:76397752-76397774 TGCCCCACAGGCCACTGTGCAGG + Exonic
1027374472 7:77536976-77536998 CGCCCCCAAGCCCGCCCCGCCGG - Intergenic
1034838497 7:154374197-154374219 TGTCCCCAAGGTCACCCAGCAGG - Intronic
1034941628 7:155234333-155234355 TTCCCCCAAGGCCACCTTGCTGG - Intergenic
1035333488 7:158111426-158111448 TCCCCACAAGGCCACCTGGCTGG + Intronic
1035515804 8:231854-231876 TGCCGCCCTGGACACCGCGCCGG - Intergenic
1035580934 8:738617-738639 CGCCCCCCAGCCCTCCGCGCAGG - Intergenic
1049709338 8:144056632-144056654 TGCCCCGAAGTCCCCCGCACGGG + Exonic
1050294986 9:4195689-4195711 TCCGCCCATGGCCACAGCGCGGG + Intronic
1055231326 9:74070159-74070181 TGTCCCCATGGCCACCTCTCTGG - Intergenic
1056163620 9:83921553-83921575 CGCCTCCAAGCCCGCCGCGCAGG + Intergenic
1057281164 9:93712690-93712712 TGCCCTTCAGGCCACAGCGCTGG - Intergenic
1057294841 9:93828780-93828802 AGCCCCCCAGTCCACGGCGCAGG - Intergenic
1061261109 9:129481651-129481673 CACCCCCAAGGCCACTGCTCAGG - Intergenic
1061680216 9:132239330-132239352 GGCCCCAGAGGCCACCTCGCAGG - Intronic
1062646338 9:137550510-137550532 TGCCCCCATCCCCGCCGCGCTGG - Exonic
1192363264 X:70452426-70452448 TGCCGGCGAGGCCACCGGGCCGG - Intronic
1195697643 X:107678587-107678609 TTTCCCCAAGGCCACAGCTCAGG - Intergenic
1199991616 X:152990488-152990510 TGCACCTCAGGCCACCGTGCAGG - Exonic
1200072949 X:153537991-153538013 GGTCCCCAAGGCCACAGTGCAGG + Intronic