ID: 968764559

View in Genome Browser
Species Human (GRCh38)
Location 4:2461510-2461532
Sequence TGCCCACCAGCTCCCCAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 266}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968764554_968764559 8 Left 968764554 4:2461479-2461501 CCGCTGCTGGTGCTGTACAGGGC 0: 1
1: 0
2: 3
3: 53
4: 264
Right 968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG 0: 1
1: 0
2: 3
3: 28
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968764559 Original CRISPR TGCCCACCAGCTCCCCAAGG TGG Intronic
900185247 1:1330398-1330420 TGCCCCCCAGTTCCCCTGGGAGG + Intergenic
900298539 1:1965049-1965071 TGACCCCCAGGTGCCCAAGGAGG - Exonic
900363213 1:2299888-2299910 AAGCCACCAGCTCCCCATGGGGG - Intronic
900374492 1:2347215-2347237 TGGCCACCAGCTGCCCCAAGGGG - Intronic
900405096 1:2489517-2489539 TGGCCTCCATCTCCCCATGGTGG + Intronic
901391892 1:8951513-8951535 TTCCCACCAGCTGTCCAGGGAGG - Intronic
901646282 1:10718484-10718506 TGTCCACCTGCTCCCCAAGGAGG + Intronic
902280592 1:15371517-15371539 TTCCCAGCAGATCCGCAAGGAGG + Intronic
902488638 1:16764609-16764631 TCCCCTCCTGCTCCCCAAAGAGG + Intronic
904090537 1:27941894-27941916 TGCCCACCTGGACCCCAAGGAGG + Intronic
905548176 1:38816563-38816585 AGCCCACCAACAGCCCAAGGGGG - Intergenic
905584522 1:39106009-39106031 TCCCCAGCAACTCCCCACGGCGG - Intronic
905774827 1:40661838-40661860 TGCCCTCTGGCTCCCCAGGGAGG + Intronic
906163709 1:43669983-43670005 TCCCCACCAGTTCCCCCAAGTGG - Intronic
906193470 1:43914100-43914122 TCCCCATCAGATCGCCAAGGGGG + Intronic
906321942 1:44822611-44822633 AGTCCACCAGCTCCACAGGGAGG - Exonic
906740164 1:48174472-48174494 TGCCCCCCACCTCCCGCAGGGGG - Intergenic
907096925 1:51790589-51790611 TATCCACCTCCTCCCCAAGGTGG + Exonic
907274072 1:53307350-53307372 TGCCCACCACCTCAGCCAGGAGG + Intronic
913077548 1:115353791-115353813 TGCCCAGCAGCTTTCCATGGTGG + Intergenic
914950634 1:152110660-152110682 TGCCCAACAGCTCCAGGAGGAGG - Exonic
915141261 1:153770026-153770048 TGACTACCAGCACCCCAAGCAGG - Intronic
915400629 1:155619196-155619218 TACCCACCAGTGGCCCAAGGTGG - Intergenic
915418154 1:155758202-155758224 TACCCACCAGTGGCCCAAGGTGG - Intronic
920191035 1:204194024-204194046 TGCCCATCAGCTCCTAATGGTGG + Intronic
920345608 1:205303998-205304020 TGCCCCCCTGCTCCCCAAGAAGG - Exonic
920722178 1:208398101-208398123 TGCCCCACATCTCCCCAAGCAGG - Intergenic
922221563 1:223612245-223612267 TGCCCCACAGGTTCCCAAGGAGG - Exonic
922603214 1:226872200-226872222 TGCTCACCGTCCCCCCAAGGGGG + Intronic
922644936 1:227276479-227276501 TGCCCCCCACCTCCCGAACGGGG - Intronic
922814107 1:228437047-228437069 TGGCCACCAGCTTCCCCAGACGG - Intergenic
923531802 1:234817908-234817930 TCCCCTCCTGCTCCCCAAAGAGG - Intergenic
1064808545 10:19166277-19166299 TGTCCTCCAGTTCCCAAAGGTGG - Intronic
1065140591 10:22714852-22714874 TCCCCTGCCGCTCCCCAAGGAGG + Intergenic
1069698183 10:70402901-70402923 TGCCCACAACATGCCCAAGGTGG - Intergenic
1070585942 10:77766219-77766241 TGCTCACGGGCTCCCCAAGCAGG - Intergenic
1072720075 10:97774917-97774939 AGCCGACCAGCTGCCCAAGGAGG - Intergenic
1072888695 10:99302366-99302388 TGCTGTCCAGCTCCCAAAGGAGG + Intergenic
1073084954 10:100882408-100882430 TCCCCACCAGCCCCCCGAGAAGG - Intergenic
1074681630 10:115913309-115913331 TCCACACCAGCCCCCAAAGGTGG + Intronic
1074942511 10:118248896-118248918 TGTCCACCAGCAAGCCAAGGGGG + Intergenic
1075472977 10:122707153-122707175 AGCCCACCAGCTCCCCAGGGAGG - Intergenic
1075800384 10:125150084-125150106 TGACCCCCAACTCCCCAACGTGG + Intronic
1075989779 10:126825796-126825818 TTCCCAGCAGCTCTCCAAAGTGG - Intergenic
1076641961 10:131923517-131923539 TGCCAAACAGTTTCCCAAGGTGG + Intronic
1076842272 10:133051597-133051619 GGCCCAGCAGCTCCCTGAGGAGG + Intergenic
1077839695 11:5961075-5961097 TGCCCCCCAGCTCCCGGATGGGG - Intergenic
1077900420 11:6482916-6482938 TGGCCACTAACTTCCCAAGGAGG - Exonic
1078086675 11:8237668-8237690 TGGCCTCCAGCTCCCCACGAGGG + Intronic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1078781800 11:14445769-14445791 TGGCCCCCAGCTCCCCTAGAGGG - Intronic
1081625508 11:44653029-44653051 TGCACCCCACCTCCCCAACGTGG + Intergenic
1083289288 11:61680777-61680799 TGGCCACCACCGCACCAAGGTGG - Intronic
1083291294 11:61691700-61691722 TCACCACCAGCACTCCAAGGTGG - Intronic
1083299164 11:61731237-61731259 GGCCCAGCAGTTCCCCAGGGTGG - Intronic
1083307832 11:61770106-61770128 TGCCCCCCACCTACCCTAGGTGG - Intronic
1083627046 11:64077253-64077275 TGCCCAACAGGTACCCCAGGCGG + Intronic
1083720977 11:64603410-64603432 ATCCCTCCAGCTCACCAAGGGGG + Intergenic
1085159658 11:74328497-74328519 TGCCCCCCACTTCCCCAATGGGG - Intergenic
1085300524 11:75455767-75455789 TGCCCACCAGGGCCCCAAGAAGG + Intronic
1087297001 11:96389601-96389623 TTCCAAGCACCTCCCCAAGGCGG + Intronic
1089791837 11:120951199-120951221 GGCCCACCGGCTCCCTAAGAAGG + Intronic
1090412438 11:126518590-126518612 TCCCAGCCAGTTCCCCAAGGGGG - Intronic
1090961636 11:131562520-131562542 TCCCCACCAAATTCCCAAGGAGG + Intronic
1091846373 12:3659086-3659108 TGCCCAGCAGCTCCCCTAAGTGG - Intronic
1095942605 12:47736789-47736811 TGACCATCAGCTCCCCGTGGTGG - Intronic
1096968641 12:55648344-55648366 TGCCCCCCACCTCCCCGACGGGG + Intergenic
1098333092 12:69375048-69375070 TGCCCCCCACCTCCCGGAGGGGG + Intronic
1101029403 12:100644936-100644958 TGTCCACCAGGTCCCGAAGCAGG + Intergenic
1102011477 12:109621890-109621912 TCCCCACCTGCTGCCCAAGGTGG + Intergenic
1102217912 12:111174657-111174679 TACTCCCAAGCTCCCCAAGGTGG + Intronic
1103895765 12:124272246-124272268 TCCCCACCAGCTCCACAAAAGGG + Intronic
1104124036 12:125828297-125828319 TGCCCAACTGCTTCCCTAGGTGG - Intergenic
1104405175 12:128511017-128511039 TGCCTGCCAGCTCATCAAGGAGG - Intronic
1106501043 13:30329286-30329308 TGCCAAACAGCTCTCCAAAGTGG + Intergenic
1110284658 13:73735447-73735469 TGACCACCAGAGCCCCTAGGGGG - Intronic
1113401306 13:109996168-109996190 TGGCGACCAGCTATCCAAGGAGG + Intergenic
1114578751 14:23736954-23736976 TGCCCCCCATCTCCCGAACGGGG - Intergenic
1115515081 14:34176858-34176880 TGCCCACCATATCCCCAAGAAGG - Intronic
1116028078 14:39537903-39537925 AGCCCAGCAGTTCTCCAAGGAGG + Intergenic
1120174348 14:81277394-81277416 TGCCCACCACCACCACAAAGTGG - Exonic
1122181017 14:99954574-99954596 TGCCAATCAGCACCCTAAGGTGG + Intergenic
1122548799 14:102539147-102539169 TGCCCCCCAGCTGTCCAAGCAGG + Intergenic
1123398751 15:19963395-19963417 TGCCCACCTCCTTCCTAAGGGGG + Intergenic
1123879653 15:24665273-24665295 TGCTCACCAGCAGTCCAAGGAGG - Intergenic
1124619342 15:31265101-31265123 AGCCCACCAGCTCCCCACAGAGG - Intergenic
1128385209 15:67142818-67142840 TGCCCACCAGCTGCCCCACAGGG - Exonic
1129153883 15:73705525-73705547 TGCCCACCCCTTCCCCAAGATGG + Intronic
1129602271 15:77007124-77007146 TGCCTTACAGCTCCCCAAGAAGG + Intronic
1130465336 15:84189370-84189392 TCTGCACCAGCTCCCCAAGAAGG - Intergenic
1130498930 15:84484166-84484188 TCTGCACCAGCTCCCCAAGAAGG + Intergenic
1132146578 15:99433076-99433098 TGCCCTCCAGCTGCCCAGAGAGG + Intergenic
1132178114 15:99731801-99731823 TGTCCACCAGCCTCCCCAGGCGG - Exonic
1132222668 15:100116763-100116785 TGCCCCCCGGCTTCCCTAGGTGG + Intronic
1133236753 16:4390992-4391014 TGCCCAGCCACTCCCCAATGTGG + Intronic
1133398181 16:5464932-5464954 TGCCCTCAAGCTCCTAAAGGAGG - Intergenic
1133510134 16:6450083-6450105 TCCCCACCACCTCCTCAAAGAGG - Intronic
1135755164 16:25091322-25091344 TTCCCATGAGCTCCCAAAGGTGG - Intergenic
1135940779 16:26819971-26819993 TGAAAACCAGATCCCCAAGGAGG + Intergenic
1136016480 16:27404149-27404171 TGCTCACCTGCTCCCCACCGTGG + Intronic
1137666057 16:50249752-50249774 TGCCCACCACCTCCCCCAGCAGG - Intronic
1138319699 16:56101625-56101647 TGGGCACCAGCTCTCCACGGAGG + Intergenic
1138410211 16:56833452-56833474 TGGCCACCGTCGCCCCAAGGGGG - Intronic
1138460255 16:57143740-57143762 TGCCCCCAGGCTCCCCAGGGAGG + Intronic
1138540074 16:57682588-57682610 TTACCACCAGCTCCCCAGGGTGG + Intronic
1139884352 16:70197970-70197992 TGCTCACCAGTTGCCCAAAGTGG - Intergenic
1140368166 16:74397526-74397548 TGCTCACCAGTTGCCCAAAGTGG + Intergenic
1140478602 16:75251033-75251055 TGCCCACCGGCTCCCGGAGAGGG - Intronic
1140893604 16:79306063-79306085 TGACCACTAGCTTCCAAAGGAGG + Intergenic
1141925961 16:87169746-87169768 CCCCCACCAGCTCCTCATGGCGG + Intronic
1142237178 16:88927804-88927826 TTCCCACCTGCTCCCTCAGGAGG + Intronic
1142258166 16:89025717-89025739 TGCCCACCTGCTTCCCTGGGAGG + Intergenic
1143162786 17:4882168-4882190 TGCCCAACAGGTCCAGAAGGGGG - Intronic
1143376414 17:6470213-6470235 TGCCCACAGCCACCCCAAGGGGG - Intronic
1143441120 17:6975007-6975029 TGTCCACCAGCTCCCAGAGGAGG - Intronic
1146843962 17:36172195-36172217 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1146856268 17:36260130-36260152 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1146864351 17:36328245-36328267 TCACCCCCAGCTCCCCAGGGTGG - Intronic
1146872175 17:36384041-36384063 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1146879537 17:36435126-36435148 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1147067210 17:37928833-37928855 TCACCCCCAGCTCCCCAGGGTGG - Intronic
1147075061 17:37984665-37984687 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1147078742 17:38008394-38008416 TCACCCCCAGCTCCCCAGGGTGG - Intronic
1147086586 17:38064211-38064233 TCACCCCCAGCTCCCCAGGGTGG + Intronic
1147094680 17:38132329-38132351 TCACCCCCAGCTCCCCAGGGTGG - Intergenic
1147102529 17:38188174-38188196 TCACCCCCAGCTCCCCAGGGTGG + Intergenic
1149847102 17:60014640-60014662 TCACCCCCAGCTCCCCAGGGTGG + Intergenic
1149975439 17:61261193-61261215 TGTCCACCCGCTCCCCAGGGAGG - Intronic
1150085461 17:62271257-62271279 TCACCCCCAGCTCCCCAGGGTGG + Intergenic
1151161751 17:72171891-72171913 TGCCCAGCAGCTCCTCTTGGTGG - Intergenic
1151231035 17:72685252-72685274 TCTCCATCAGCTCCCAAAGGTGG - Intronic
1151451583 17:74201248-74201270 AGACCTCCAGCTCCCCAAGGGGG - Intergenic
1151680457 17:75620163-75620185 TGCCCACCTGCTCCCCCTGCTGG - Intergenic
1151712879 17:75816921-75816943 TGCCCACCCACTCCCCAGGATGG - Intronic
1151882828 17:76905192-76905214 TGCCCATCAGGTCCAGAAGGTGG - Exonic
1152290029 17:79435146-79435168 TGCCCCCCACCTCCGCAGGGTGG + Intronic
1152765559 17:82136024-82136046 TGCCCACCAGCTGCGCACGAAGG - Intronic
1157455945 18:47828298-47828320 TGCCCCCCACCTCCCGAACGGGG - Exonic
1161917475 19:7239702-7239724 TACTCACCAGCTCCCCTAGTGGG - Intronic
1162736179 19:12748241-12748263 TCCCCACCAGCCCCACCAGGGGG - Exonic
1162833876 19:13303542-13303564 CGCCCAGGAGCTCACCAAGGTGG - Exonic
1163434914 19:17289711-17289733 AGCCAACCAGGTCCCCCAGGGGG + Intergenic
1163827132 19:19530029-19530051 TGCCCACCAGACCACCACGGGGG - Intronic
1164555526 19:29248164-29248186 TGCCCACGAGTTCCCTCAGGAGG - Intergenic
1165423974 19:35735654-35735676 TGCCCACCATCTCCACCAGCAGG + Intronic
1165430379 19:35768478-35768500 CGCCCCCTAGGTCCCCAAGGAGG + Exonic
1165993195 19:39827389-39827411 TGCCCAGCACCTCCACAATGCGG + Exonic
1166090922 19:40508358-40508380 AGCCCCACAGCTCCCCATGGTGG - Intronic
1167272958 19:48516758-48516780 CGCCCACCACCTCCCCAGCGTGG + Intergenic
1167321036 19:48797233-48797255 CGACCACCAGCTCACCGAGGTGG - Exonic
1167436253 19:49480461-49480483 TGCTCACCTGCTCCCCAGGGCGG - Exonic
925153773 2:1635033-1635055 TACCCACCAGCTCTGCAGGGAGG + Intronic
927263680 2:21120450-21120472 TGCCCAAAAGCTTCCCAAGGGGG - Intergenic
928288145 2:30011218-30011240 GGCCCACCAGCTTCCCATGTAGG - Intergenic
929877156 2:45806324-45806346 AACCCACCCGCTCCCCAAGCAGG + Intronic
932276103 2:70453435-70453457 TCCAAACCAGCTCCCCATGGGGG + Intronic
933560093 2:83877388-83877410 TGCCCTCCAGCTCCTCCAGCTGG - Intergenic
934085581 2:88506415-88506437 TCCCCACCAGCTCCACAAATGGG - Intergenic
934683616 2:96304766-96304788 TGCCCTCCAGCTTCCCAACAAGG + Exonic
935755868 2:106275912-106275934 GGCCCACCTCCACCCCAAGGTGG + Intergenic
937076889 2:119113609-119113631 GGCAGACCAGCTCCCCAAGGAGG + Intergenic
937679369 2:124627209-124627231 AGCACACCAGCTCCCCTAAGGGG + Intronic
938100820 2:128497035-128497057 TGCCCCCCTTCTCCTCAAGGAGG - Intergenic
939731437 2:145789366-145789388 TTCCCTCCAGCTTCCAAAGGTGG + Intergenic
942507471 2:176658597-176658619 TCCCCACCTGCTCCCCAATTTGG - Intergenic
945195226 2:207231337-207231359 TGCCTACAGCCTCCCCAAGGAGG + Intergenic
946404872 2:219486905-219486927 TACCCCACTGCTCCCCAAGGAGG - Intronic
947501820 2:230676458-230676480 TGCCCAACAGGTCACCAAGGAGG + Intergenic
947733147 2:232441979-232442001 TGACCACCAGCTCCCCGAGCTGG + Intergenic
947825165 2:233100785-233100807 AGCCCTCCAGCTCCCCAGTGGGG - Intronic
948941853 2:241200779-241200801 TTCCCACCAGCCCCAAAAGGAGG - Intronic
1168745966 20:240745-240767 TGCCCATCAGCTACCCAAAGGGG - Intergenic
1168859600 20:1036632-1036654 TGCCCCCCTGGTCCCCATGGAGG - Intergenic
1170578133 20:17680255-17680277 TGCCCCCCAGCTGCACAGGGCGG + Intronic
1170779931 20:19416159-19416181 CCCCCACCACCTCACCAAGGTGG + Intronic
1172910837 20:38407701-38407723 TGCCCCCCACCTCCCCGATGGGG - Intergenic
1173918685 20:46727905-46727927 TGCCCCCCAGCCTCCCAAGTTGG - Intronic
1175274057 20:57755366-57755388 TGCCAAGCAGTTCCCCAAAGTGG + Intergenic
1175808445 20:61844724-61844746 CGCCGACCAGCCCCCCATGGAGG + Exonic
1175918032 20:62436574-62436596 TGCCCATCTGCTACCCACGGTGG + Intergenic
1176011931 20:62902076-62902098 TGCACCCCACCTGCCCAAGGTGG + Intronic
1176075692 20:63247357-63247379 TGCAAACCACCTCCCCCAGGCGG - Intronic
1176719188 21:10379483-10379505 TGCCCACATGTTCCCCGAGGAGG + Intergenic
1176745440 21:10648138-10648160 TGCCCACCTTCTTCCTAAGGGGG + Intergenic
1178707358 21:34886920-34886942 TGCGCACCAGCTCGCCCGGGTGG + Exonic
1179798645 21:43799983-43800005 TCCCCACCAGCACCCCAACGAGG - Intronic
1180074185 21:45454426-45454448 TGCACGCCAGCTCCCCCAGCTGG - Intronic
1180300415 22:11032412-11032434 TGCCCACGTGTTCCCCGAGGAGG + Intergenic
1180636997 22:17269448-17269470 TGCCCCCAAGCTCCTCAGGGTGG - Intergenic
1180956508 22:19743699-19743721 TGTCCCCCAGCACCCCAGGGTGG + Intergenic
1181041170 22:20193326-20193348 AGCCCACCAGCCCACCAAGGAGG - Intergenic
1181173524 22:21023359-21023381 TGGCCACGAGGTCCCCAATGCGG - Exonic
1181179484 22:21056765-21056787 TGTGCACCAGCTCCCCTGGGAGG - Intronic
1181920189 22:26314693-26314715 TCCCCGCTAGCTCCCCAAGAGGG + Intronic
1182278326 22:29204345-29204367 AGGGCAACAGCTCCCCAAGGGGG + Intergenic
1183507698 22:38218751-38218773 TTCCCACCAGCCTCCCGAGGCGG - Intergenic
1184004487 22:41698283-41698305 TGCCCCCCAGCTCCTCACAGTGG + Intergenic
1184201404 22:42971875-42971897 TGCCCCCCACCTCCCGAACGGGG - Intronic
1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG + Intronic
1184771884 22:46601950-46601972 TGCCCAAGAGCTGCCCAAGAAGG - Intronic
1184864465 22:47194628-47194650 TGCTGTCCAGATCCCCAAGGCGG + Intergenic
1185341016 22:50291156-50291178 TGCCCGCCAGAGCCCCCAGGCGG + Intronic
950628431 3:14265406-14265428 TGCCCAACTGCTTTCCAAGGTGG - Intergenic
950881503 3:16326275-16326297 TGGTCACCAGCTCCACAAAGGGG - Intronic
952902644 3:38120315-38120337 AGCCCAGCAGCTCCCCAACCTGG - Intronic
952927260 3:38329181-38329203 AGCCCAGCAGCTCCCCAACCTGG + Intergenic
953440146 3:42909693-42909715 TGCCCCCCACCTCCCGGAGGGGG + Intronic
953459772 3:43073036-43073058 TGCCCCACAGCTTCCCAGGGTGG - Intergenic
953607184 3:44419682-44419704 GGCCCATCAGCTCCACAGGGTGG - Intergenic
954117016 3:48472654-48472676 TGCCCAACAGAGGCCCAAGGAGG + Intronic
954457938 3:50610131-50610153 TGGCCTCCAGCTCTCCAAGAGGG - Intronic
958709531 3:97700479-97700501 TGCCCATCAGCTCTCAAGGGTGG + Intronic
960605349 3:119498901-119498923 TGCCAAACAGCTCCCGGAGGCGG - Exonic
961628898 3:128282086-128282108 TGCCCACCAGGGCCCAGAGGAGG + Intronic
964415531 3:156443937-156443959 TGCCACCCAGGTCCTCAAGGGGG - Intronic
967123276 3:186402684-186402706 TGCCCTCCAGCTTCCTAAGTAGG + Intergenic
968696816 4:2034499-2034521 TGCTGTCCAGCTCCCAAAGGAGG - Intronic
968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG + Intronic
968824282 4:2882018-2882040 TACCCAGCAGCTCCGCAAGGAGG + Exonic
968852728 4:3094586-3094608 TGCCCACCACCTCCCGGACGGGG + Intronic
968870914 4:3241804-3241826 TTCCCACCAGCTCCCAACAGAGG + Exonic
969038624 4:4276284-4276306 TACCCACAATCTCCCAAAGGAGG - Intronic
975673242 4:76802421-76802443 TTCCCTCCAGCTCGCCACGGAGG + Intergenic
975795927 4:78007192-78007214 TGCCCCCCACCTCCCAGAGGGGG + Intergenic
976775028 4:88698291-88698313 TGCACCCCAGGTCCCCAAAGGGG - Intronic
980107580 4:128602256-128602278 GTACCACCAGCTCCCCAAAGTGG - Intergenic
981993706 4:150954132-150954154 TGCCCCCCACCTCCCCGACGGGG - Intronic
985648303 5:1095479-1095501 TGCACACCAGCTCCCCAGACTGG + Intronic
989805690 5:45601151-45601173 TGCCCACCTACTCTCCAAGGTGG - Intronic
990357836 5:54987792-54987814 TGCCAAACAGGTGCCCAAGGTGG + Intronic
994907480 5:105859532-105859554 TGCCCACCACCTCCCGGACGGGG - Intergenic
997667261 5:135641602-135641624 TGCCCTACAGCTACCCAAAGAGG - Intergenic
998489771 5:142536471-142536493 TGCACCCCAGCTCCACAGGGAGG + Intergenic
1001130200 5:169057507-169057529 TGCCCATAAGCTCCCAGAGGGGG + Intronic
1001350474 5:170958253-170958275 TTCCCAGCAGCTCCTCAAAGAGG - Intronic
1001745466 5:174089304-174089326 TGCCCACCTTCGCCCCAAAGAGG + Intronic
1004346044 6:14850209-14850231 TCCCCACCCACACCCCAAGGTGG + Intergenic
1004427053 6:15513679-15513701 AGGCCACCTGCTCCCCAGGGAGG - Intronic
1006166856 6:32070358-32070380 TCACCCACAGCTCCCCAAGGCGG + Intronic
1006295928 6:33170078-33170100 GGCCCACAAGGTCCCCCAGGAGG - Exonic
1006375258 6:33668350-33668372 GGACTCCCAGCTCCCCAAGGAGG - Intronic
1007170054 6:39856452-39856474 TGACCACCAGCTCTGCAAAGCGG - Exonic
1010712645 6:79193031-79193053 TCCCAACAAGCTGCCCAAGGTGG + Intergenic
1015963512 6:138674893-138674915 TCCCCAGCAGCTCAGCAAGGTGG + Intronic
1016713581 6:147200031-147200053 TGACCACCAGTGACCCAAGGAGG - Intergenic
1017453674 6:154578244-154578266 TGCCCACCATCTGCCAAGGGAGG + Intergenic
1018827055 6:167416044-167416066 AGCCCACCAGCCCCCCCACGCGG - Intergenic
1020181040 7:5922575-5922597 TTCCCACTAGGTCCCCGAGGAGG + Intronic
1020301893 7:6802313-6802335 TTCCCACTAGGTCCCCGAGGAGG - Intronic
1020727245 7:11831690-11831712 AGCCCACCAGCTCCTTAATGTGG + Intronic
1022318162 7:29263999-29264021 TGCCCCCCAGCTCCCGGATGGGG - Intronic
1022473461 7:30695395-30695417 TCCCCTCCAGCTCCCCCGGGAGG + Intronic
1022700410 7:32754147-32754169 TGCCCCCCACCTCCCGAATGGGG - Intergenic
1023871866 7:44267628-44267650 TACACACCTGCTCCCCAAGGGGG + Intronic
1023965909 7:44962992-44963014 CGCCCACCAGCTCCCCAACGCGG + Exonic
1024305165 7:47922738-47922760 TGCCCCCCACCTCCCCAACGGGG - Intronic
1025209342 7:57011897-57011919 TGCCCACCTGGACCCCAGGGAGG + Intergenic
1025662603 7:63564957-63564979 TGCCCACCTGGACCCCAGGGAGG - Intergenic
1031857294 7:126937880-126937902 TGCCCACCTTCTTCCCAAAGAGG - Intronic
1032078980 7:128849292-128849314 AGCCCACCAGCTCCCTGAGCAGG + Intronic
1032490255 7:132319020-132319042 TGTCCACACGCACCCCAAGGTGG + Intronic
1035580611 8:737518-737540 TGCCCGCGCGCTCCCCAAGCCGG + Intronic
1037763303 8:21756438-21756460 TGCCAAGCACCTCACCAAGGAGG + Intronic
1037835372 8:22212208-22212230 TCCCCATCGGCTCCCCACGGTGG - Exonic
1037987006 8:23296324-23296346 TGCCCACCTGCACTGCAAGGTGG - Intergenic
1040478168 8:47799225-47799247 TGACCAACAGCTGCGCAAGGAGG - Exonic
1041725569 8:61014232-61014254 GGCACACCAGCTCCACAAGGGGG - Intergenic
1042271645 8:66961870-66961892 CGCCCACCAGCAGCCCAACGGGG + Exonic
1044558208 8:93587724-93587746 TGGTCACCAACTCTCCAAGGTGG - Intergenic
1045500048 8:102738178-102738200 TGCCCACCACCTCCCCTGGAGGG - Intergenic
1047204489 8:122792542-122792564 TGCCAAACAGTTCCCCAAAGTGG + Intronic
1049283237 8:141761169-141761191 TGCCCTCCAGCAGCCCAAGAGGG - Intergenic
1049366151 8:142237841-142237863 TGTCCACCAGCCCCGCAGGGTGG + Intronic
1049377270 8:142295217-142295239 TGCCCACCATCTCCCAGAGGAGG - Intronic
1049446036 8:142632123-142632145 CACACACCAGCTCCCCAGGGGGG + Intergenic
1051590997 9:18776887-18776909 CGCCTACCTGCTCCCCAAGACGG + Exonic
1052928764 9:34039218-34039240 CGCCCCCCAACTCCCCAACGGGG - Intronic
1055580474 9:77702810-77702832 TGCCCCCCAGCTCCCGGACGGGG + Intergenic
1055580493 9:77702852-77702874 TGCCCCCCAGCTCCCGGACGGGG + Intergenic
1056832292 9:89927046-89927068 TGCCCTCCTGGTTCCCAAGGTGG + Intergenic
1057298347 9:93862150-93862172 AGCCCACCAGCTCCTCCTGGAGG + Intergenic
1057674858 9:97130596-97130618 TGCCCACCACCTCCCAGACGTGG + Intergenic
1058638923 9:107064331-107064353 TGCCCACCACATCACCCAGGGGG + Intergenic
1059660103 9:116391852-116391874 TCCCCACCTTCTCCCCCAGGCGG - Intronic
1060220842 9:121763337-121763359 TCCCCAGCAGCCCCCAAAGGTGG + Intronic
1060497797 9:124130749-124130771 CGCCCTGCAGCTCCCCAATGTGG - Intergenic
1061823080 9:133239257-133239279 TGCTCACCAGCGCCCCCAGCTGG - Intergenic
1062116595 9:134812659-134812681 GGCCCACAAGGTCCCCCAGGTGG + Exonic
1062473147 9:136714948-136714970 GGGCCACCAGCTCCTCAACGAGG - Intronic
1062506803 9:136881779-136881801 TCCTCATCAGCTCCCCAGGGGGG - Intronic
1062567984 9:137171702-137171724 TGCCCGCCAGCACCACAAGGAGG + Exonic
1185477731 X:425365-425387 ATCCCACCAGCTGCCCACGGAGG + Intergenic
1186440725 X:9584153-9584175 TGCCAATCTGCTCCCCAAAGAGG - Intronic
1186749070 X:12602803-12602825 TGCCCACCAGCGTCACAAGAAGG - Intronic
1190335129 X:49257553-49257575 TGCCCCCCAGCTCTCAACGGTGG - Exonic
1190505077 X:51119250-51119272 TGCCCCCCACCTCCCGAATGGGG + Intergenic
1196496158 X:116327628-116327650 TGCTCACCATTTCCCCATGGTGG - Intergenic
1196616216 X:117769421-117769443 TGCCCACTAGTCCCGCAAGGCGG - Intergenic