ID: 968765731

View in Genome Browser
Species Human (GRCh38)
Location 4:2468265-2468287
Sequence CTGGGTATTCTCAGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968765722_968765731 12 Left 968765722 4:2468230-2468252 CCGAGGGACCAGAGATGCTGGCC 0: 1
1: 0
2: 0
3: 22
4: 259
Right 968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 180
968765720_968765731 22 Left 968765720 4:2468220-2468242 CCTGAGGGTGCCGAGGGACCAGA 0: 1
1: 0
2: 1
3: 16
4: 161
Right 968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 180
968765728_968765731 -9 Left 968765728 4:2468251-2468273 CCATGGACTAAGGTCTGGGTATT 0: 1
1: 0
2: 0
3: 5
4: 107
Right 968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 180
968765724_968765731 4 Left 968765724 4:2468238-2468260 CCAGAGATGCTGGCCATGGACTA 0: 1
1: 0
2: 0
3: 8
4: 121
Right 968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968765731 Original CRISPR CTGGGTATTCTCAGGCAGCA GGG Intronic
900411433 1:2514505-2514527 GTGGGGATTCGCAAGCAGCAGGG - Intronic
901822354 1:11838241-11838263 CTGGGCATATTCAGGCATCAAGG + Intronic
902169267 1:14597917-14597939 ATGGGTAAACTGAGGCAGCAGGG + Intergenic
904617865 1:31759746-31759768 CTGGCTATACACAGGCAGGAGGG - Intronic
905238968 1:36570409-36570431 CTGGGTTTTCCCAGGGACCAGGG + Intergenic
906964120 1:50439870-50439892 ATGGGCTTTCTCTGGCAGCAGGG - Exonic
907716663 1:56932705-56932727 AGGTGTATTCTCAGGCAGAAAGG - Intronic
909074267 1:71034747-71034769 TGGGGTATTCTAAGGCATCATGG + Intronic
909388154 1:75084280-75084302 GTGGGTAATGTCAGACAGCATGG + Intergenic
910086653 1:83411158-83411180 CTTGGTATTCTAAGCCAGGATGG - Intergenic
910362252 1:86424832-86424854 GTGAGAATTCTCAGGCAGAAAGG + Intronic
915066858 1:153232001-153232023 CTGGGGCTTCCCTGGCAGCAAGG - Intergenic
915871325 1:159562633-159562655 CTGGGTATTTACTGCCAGCAAGG + Intergenic
921813773 1:219544169-219544191 CTGGGTGAGCACAGGCAGCAGGG + Intergenic
923165589 1:231358465-231358487 CTGGGTATTCTCATGTTCCATGG + Intergenic
1064154769 10:12894786-12894808 CTGGGTCTTCTCAGGTGCCAAGG + Intergenic
1064559717 10:16584175-16584197 CGGGGTCTTCCCAGCCAGCAGGG + Intergenic
1064635848 10:17366239-17366261 ATGGGTATTGTCAACCAGCATGG + Intronic
1065522023 10:26582478-26582500 CGGGGTCTTCTCGGGCAGCATGG - Intergenic
1066519291 10:36197643-36197665 CTGGGGACTGTCAGGGAGCAGGG + Intergenic
1068117111 10:52747508-52747530 CTGGGTGCTGTCAGGAAGCAGGG + Intergenic
1070167519 10:73909920-73909942 CTGCTTATCCTCAGGCAGGAAGG + Intronic
1070864819 10:79701709-79701731 GTGGGGATGCTCAGACAGCAGGG + Intergenic
1070878609 10:79839837-79839859 GTGGGGATGCTCAGACAGCAGGG + Intergenic
1071321394 10:84462943-84462965 CTGGGTTTACTGAGGCAGCCAGG + Intronic
1071511803 10:86266772-86266794 CCTGGGATTCACAGGCAGCATGG + Intronic
1071631718 10:87223926-87223948 GTGGGGATGCTCAGACAGCAGGG + Intergenic
1073066760 10:100765056-100765078 CTGGATATTCTAAGGAAGTATGG + Intronic
1075839721 10:125490433-125490455 CTGGCTATGCTCAGTTAGCATGG - Intergenic
1076924182 10:133473517-133473539 TTTGGGATCCTCAGGCAGCAGGG - Intergenic
1080054424 11:27891016-27891038 CTGGGTTTCCTCAGGCATCTTGG + Intergenic
1085201026 11:74702453-74702475 GGGGGTCTTCTCAGGCAGGAGGG - Intronic
1085510605 11:77086294-77086316 CGGGGTATTTTCAGTCAGAAGGG - Intronic
1089605441 11:119638731-119638753 CTGGATATCCTCAGGCACAAGGG + Intronic
1091208242 11:133835117-133835139 CTGGGTATCCTCACACAGCACGG + Intergenic
1091822580 12:3487327-3487349 CTGAGATTTCCCAGGCAGCATGG + Intronic
1091864309 12:3818007-3818029 CTGGGAAGTATAAGGCAGCAAGG - Intronic
1094204940 12:27830034-27830056 CTGGGGATTCTCAGGATGCCAGG - Intergenic
1096651123 12:53062426-53062448 CTGGGAATGCGCAGGCAGCAGGG - Exonic
1097876083 12:64644812-64644834 CTGGGTATTCCCAGGTATCCTGG - Intronic
1099985699 12:89660530-89660552 ATGTGTGTTCTCAGGCAGTAGGG + Intronic
1101503777 12:105328508-105328530 TTGGATATTGTCAGGAAGCAGGG + Intronic
1101903141 12:108806521-108806543 GTGCATGTTCTCAGGCAGCAGGG + Intronic
1102202003 12:111063633-111063655 CTGGGGGTTCTCAGGCAGGCTGG + Intronic
1102462448 12:113108273-113108295 CTGCGTAAACTGAGGCAGCAAGG + Intronic
1106830073 13:33571544-33571566 CTGAGTCTTCTGAGCCAGCAAGG + Intergenic
1108743545 13:53364794-53364816 CAGGGTATTCTATGGAAGCAAGG + Intergenic
1109351026 13:61181318-61181340 CTGGCTCTTCTCACTCAGCATGG + Intergenic
1109688936 13:65860591-65860613 CTGTGTATTCAAAGGCAGCAGGG + Intergenic
1109865034 13:68252456-68252478 CTGGGAACTCTTAGGCAGCAGGG - Intergenic
1110665898 13:78116952-78116974 CTGGGGAGCCTCAGGCATCATGG + Intergenic
1110847115 13:80202612-80202634 CTGGGTAGTCCCAGGCAGATGGG + Intergenic
1111417582 13:87969039-87969061 CTGGGTAATTTCAGGCAGGAGGG + Intergenic
1112626937 13:101115789-101115811 CTGGGTAGTGTCAGGTACCAAGG + Intronic
1113022499 13:105903827-105903849 CTGGGAAGTCTGAGGCAGTAGGG + Intergenic
1113827432 13:113267796-113267818 CTGGGCATTGTCCTGCAGCAAGG + Intergenic
1118960520 14:70525824-70525846 CTGGGCATTCTAAGGAAGGAAGG + Intronic
1121965176 14:98296974-98296996 CCAGCCATTCTCAGGCAGCATGG + Intergenic
1121965201 14:98297106-98297128 CTGGCCACCCTCAGGCAGCATGG + Intergenic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1127323022 15:57865979-57866001 CTGGGGGTTCTCACGCAGCTAGG - Intergenic
1128710312 15:69866741-69866763 CTGGGTGTCAGCAGGCAGCATGG + Intergenic
1130447373 15:84015764-84015786 CTGGGGTTTCTCAGGGAGCATGG - Intronic
1130718145 15:86356969-86356991 AAGGTTATTCTCAGGCAACATGG - Intronic
1132399949 15:101498982-101499004 GTGAGTCTTCTCAGCCAGCAGGG + Intronic
1138199373 16:55077687-55077709 CAGGGGACTCTCAGGGAGCAGGG + Intergenic
1139507602 16:67406992-67407014 CTGAGAACCCTCAGGCAGCATGG - Intronic
1140520205 16:75574555-75574577 CTGGGCATTCTCAACCACCAGGG + Intronic
1143203789 17:5129605-5129627 CTGAGTATTCTCAGGAGGGACGG + Intronic
1144169953 17:12649885-12649907 GTGGGGATTCTAAGTCAGCAAGG + Intergenic
1144408865 17:14980043-14980065 CTGGGTCCTCTCTGGCAGAAGGG - Intergenic
1144676315 17:17164482-17164504 CTGCGTCTTCTCCAGCAGCAGGG - Intronic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1148767410 17:50047259-50047281 CTGGGTGCTCCCAGGCAGGAAGG - Intergenic
1151745708 17:76010625-76010647 CTGGGGAGTCTCAGGAAACAGGG - Intronic
1152635072 17:81427514-81427536 CTGGCTACTCTCAGGCTGCCTGG + Intronic
1155517262 18:26636452-26636474 CTGGCCAGTCTCAGGCAGCAGGG - Intronic
1156876929 18:42025556-42025578 CTAGGAATTCTCATGTAGCAGGG - Intronic
1158632094 18:59124172-59124194 CTGGGTTTACTCATGCAGCCTGG + Intergenic
1159152573 18:64538800-64538822 CAGGGCATTGCCAGGCAGCAAGG + Intergenic
1160855166 19:1214029-1214051 CTGGGCTTGCCCAGGCAGCATGG - Intronic
1162601633 19:11674315-11674337 CTGGTTCCTCTCAGGCCGCAGGG + Intergenic
1164151277 19:22554141-22554163 CTTGGTTTTCTCATGCAGAATGG - Intergenic
1165495976 19:36152122-36152144 CCGGGCCTTCTCAGGCAGCCTGG - Intronic
1167083511 19:47293429-47293451 CTCGGTTTTCTCTGGCACCATGG + Intronic
1168723714 19:58569516-58569538 CTGGGCCTCCTCAGGCAGGAGGG + Exonic
925153907 2:1635904-1635926 CTGGCTTTTCTCTGGAAGCACGG + Intronic
925905156 2:8535796-8535818 GTGGGGATTCTCACGCAGCCCGG + Intergenic
927434836 2:23058109-23058131 CTTGGAATTCTCAGGCAGGCGGG - Intergenic
928173428 2:29017996-29018018 CAGGGCATCCTGAGGCAGCATGG - Intronic
930004259 2:46883348-46883370 ATGGGGATTCTCAGGCAGGTAGG - Intergenic
932502162 2:72192544-72192566 CTGGGTCTTAGTAGGCAGCATGG + Intronic
933576388 2:84073511-84073533 CTGACTATGCTGAGGCAGCAAGG + Intergenic
938734750 2:134175936-134175958 CTGGCTATTTTCTGGGAGCAGGG + Intronic
940048482 2:149435538-149435560 CTGGCTTTTCTCTGCCAGCATGG - Intronic
940240649 2:151559777-151559799 CTGGGTCCTCTCAGGGAGTAGGG + Intronic
941748487 2:169111580-169111602 CTTGGTATCCTCAGAGAGCAGGG + Intergenic
942367554 2:175243642-175243664 CTGGGTATTCCCAGGACCCAGGG - Intergenic
943465172 2:188219914-188219936 CTGGATTTTCTAAGGTAGCAGGG - Intergenic
944361009 2:198856538-198856560 CTGGGTATTCACAGACATAAAGG + Intergenic
944713290 2:202355066-202355088 GTGGTTATTCTCAGGCATCATGG + Intergenic
948181003 2:235980261-235980283 CTGGGTTTTGGCAGGCAGCCAGG + Intronic
948883899 2:240873623-240873645 TTGGGAGTTCTCAGGCAGGAAGG + Intronic
1170129642 20:13005323-13005345 GGGGGTATTTTCAGGAAGCATGG + Intergenic
1170736503 20:19017729-19017751 GGTGATATTCTCAGGCAGCATGG - Intergenic
1171411080 20:24949438-24949460 CAGTGCCTTCTCAGGCAGCATGG - Exonic
1173227966 20:41172958-41172980 GTAGGTATTTTCAGGCATCAAGG + Intronic
1173413628 20:42837268-42837290 GTGGGTTGTCTGAGGCAGCAAGG - Intronic
1175440412 20:58986750-58986772 CTAGGTATTTTCAGGCAGGAGGG + Exonic
1175525265 20:59629337-59629359 CTGGGCCTTCTCAGGCAGCCAGG - Intronic
1178452153 21:32712086-32712108 CAGTGTATTCTCAGACTGCAAGG - Intronic
1181031158 22:20149403-20149425 CTGGAGATTCTCAGGTAACACGG - Exonic
1181046756 22:20218287-20218309 CTGGGTGTGCCCAGACAGCAGGG + Intergenic
1181183636 22:21085333-21085355 CAGGGTATTCTTGGGCTGCAGGG + Intergenic
1183958410 22:41396363-41396385 CTATGTCTTCTCAGGTAGCAGGG + Exonic
1185003680 22:48262747-48262769 CTGGGCTGTCTCGGGCAGCACGG + Intergenic
1185009521 22:48305416-48305438 CTGGCTATTTCCAGGAAGCAAGG + Intergenic
1185088938 22:48755334-48755356 CTGGGCCCTCTAAGGCAGCAGGG - Intronic
949155106 3:817336-817358 CTGGTGATTCTCAGGAAACAGGG + Intergenic
953042800 3:39269726-39269748 CTGGGGACTCTGAGACAGCAGGG - Intronic
953518126 3:43616927-43616949 CTGTGTTTTTTCATGCAGCAGGG + Intronic
954699042 3:52442112-52442134 ATGGGAATGTTCAGGCAGCAGGG + Intronic
956044569 3:65181634-65181656 CTGGGTATTCCCAGGCAACATGG - Intergenic
956758396 3:72413433-72413455 ATGGGTATTGACAGGCAGGATGG - Intronic
958871505 3:99564255-99564277 CTGGGTGTTCCCAGGGAACAAGG - Intergenic
959278110 3:104304005-104304027 CTGGGGATTCCCAGGCAAGATGG + Intergenic
960350455 3:116586704-116586726 CTGGTTAGTTTAAGGCAGCAAGG - Intronic
962609625 3:137063514-137063536 CTGGCTATTTACAGCCAGCAAGG + Intergenic
962850993 3:139308294-139308316 CTGTGTGTCCTCAGGCTGCAAGG - Intronic
966844292 3:184115347-184115369 CTGGGTTTCCTCAGGCAGCTTGG - Intergenic
966905958 3:184525905-184525927 GTGGGTATTCACAGGGAGCTGGG + Intronic
966918709 3:184598742-184598764 CTGGGTCTTCTCAGCCAGCCAGG - Intronic
967377174 3:188817623-188817645 CTGGGTTTTGTTTGGCAGCAGGG - Intronic
968460018 4:720171-720193 CTTGGCATACTCCGGCAGCAGGG - Intronic
968765731 4:2468265-2468287 CTGGGTATTCTCAGGCAGCAGGG + Intronic
969195666 4:5561919-5561941 ATGGGTATTCTCTGACAGTAGGG - Intronic
972356166 4:38280977-38280999 ATGGGAAGTCGCAGGCAGCAGGG + Intergenic
975122975 4:70749244-70749266 CTAGGTATTCTTCTGCAGCATGG + Intronic
975160754 4:71121242-71121264 TTGGGGAGTCTCGGGCAGCATGG - Intergenic
978857958 4:113414571-113414593 CTTGTTATTCTCAGGCAGCTTGG + Intergenic
982147325 4:152409512-152409534 CTGGGAATACTCTGGCAGAAGGG + Intronic
982378983 4:154727447-154727469 TTGGATGTTCTCAGGAAGCAGGG + Intronic
986501773 5:8408440-8408462 CTGGGTATGATCAGACAGCCTGG + Intergenic
987224993 5:15830959-15830981 CTGGAGAGTCTCAAGCAGCAAGG + Intronic
987326634 5:16817740-16817762 CAGCGTATTCACAAGCAGCAAGG + Intronic
989807533 5:45628327-45628349 ATGAGTATTCTCAGTAAGCAGGG - Intronic
992891878 5:81211220-81211242 TTGGGAATACACAGGCAGCATGG - Intronic
993078567 5:83267632-83267654 CTGGACAGTCTCAGGGAGCAGGG + Intronic
993168488 5:84385186-84385208 CAAGGGACTCTCAGGCAGCAAGG - Intergenic
993887682 5:93435593-93435615 CTGGGTATGCTCCTGCAGTAGGG + Intergenic
994197467 5:96936068-96936090 CTGGGCATGCTCAGTCAGCTGGG + Exonic
998940298 5:147274582-147274604 CTGGGTATTATCAGGCAATATGG - Intronic
999198350 5:149798542-149798564 CTGGCTGCTCACAGGCAGCACGG - Intronic
999400407 5:151259732-151259754 CTGGGGACAATCAGGCAGCAAGG - Intronic
999639519 5:153658182-153658204 CTGTGTATTCTTAAGCAGCAGGG - Intronic
1000929703 5:167236494-167236516 CTGAGTGTTCTCAGGCAACTTGG + Intergenic
1001879912 5:175234380-175234402 CTGTGTGTTCTCAGGGAGCTAGG - Intergenic
1002090665 5:176803621-176803643 CTGGGCACTCTCAGGCAGGTTGG - Intergenic
1002183576 5:177443617-177443639 CGGGGCATTCTCAGGGAGCTGGG - Intergenic
1002297606 5:178240148-178240170 CCGGGTTTCCTCAGGCAGCCTGG + Intronic
1003040115 6:2680277-2680299 CAGGATATTCTCAGGCTGCCAGG + Exonic
1005692012 6:28315686-28315708 CTGGGGCTTCTTAGGCAGGATGG + Intergenic
1005708517 6:28481273-28481295 CTGGGGAGTCTCATGCAGCCTGG + Intergenic
1006590344 6:35150581-35150603 CTGGGGAATCTCGGGCAGGAGGG - Intergenic
1007109459 6:39304535-39304557 CTGGGGCATCTCATGCAGCAGGG - Exonic
1007725667 6:43914323-43914345 CTGGGGATTTTCTGGGAGCAGGG - Intergenic
1008763261 6:54879573-54879595 CTGGGCATTTTCAGACAGCGGGG + Intronic
1010583643 6:77629900-77629922 TTGGGTACTTTCAGACAGCATGG - Intergenic
1011527540 6:88281713-88281735 CTGGGTGTTGGCAGGCACCATGG + Intergenic
1013398578 6:109768923-109768945 CTGGGTTTTCAGAGGGAGCATGG - Intronic
1016363671 6:143293527-143293549 GTGGACATTCTCAGGCACCAAGG - Intronic
1018237049 6:161736776-161736798 TTGGGGTTTCTCAGACAGCAGGG - Intronic
1019280392 7:196910-196932 CAGGTTACTCCCAGGCAGCATGG - Intronic
1019694127 7:2435326-2435348 CTGGGTACTGTCATCCAGCACGG - Intergenic
1019792914 7:3028991-3029013 CTGGGTTTCCACAGGCTGCAGGG + Intronic
1023699330 7:42876893-42876915 CTGGGTATTTTCACCAAGCATGG - Intergenic
1023845779 7:44119373-44119395 CTGGTTCTTCCCAGGCAGCAGGG - Intronic
1027303530 7:76867640-76867662 CTTGGTATTCTAAGCCAGGACGG - Intergenic
1028221220 7:88199356-88199378 ATGGAACTTCTCAGGCAGCAGGG - Intronic
1029276781 7:99409869-99409891 CTGGGTTCTCTCTGGCAGCAAGG + Intronic
1029338047 7:99919177-99919199 CTGCGTCTTCTCAGTCAGCCTGG + Exonic
1032500296 7:132394938-132394960 CTGGGGATTCTCAGCCTTCAGGG + Intronic
1033521084 7:142160957-142160979 CTGGGTGTGGGCAGGCAGCAGGG - Intronic
1034717277 7:153255267-153255289 CTGGTTATTATCAGGAAGCAGGG + Intergenic
1035793954 8:2336606-2336628 CTGGGGATTCCCAGGCAAGATGG + Intergenic
1035798851 8:2385102-2385124 CTGGGGATTCCCAGGCAAGATGG - Intergenic
1036741200 8:11363190-11363212 CTGGGGAGTCTGAGGCAGGAGGG + Intergenic
1037413463 8:18621706-18621728 TTGGCTGTTCTCTGGCAGCAGGG - Intronic
1037594894 8:20346824-20346846 CTGGTTAATCTCAGGCAGATGGG + Intergenic
1038649806 8:29392174-29392196 CTGGCTTTTCTCAGGCTGCATGG + Intergenic
1040417271 8:47206479-47206501 CTGGGTGTTCTCAGGCAGCCAGG - Intergenic
1045294548 8:100861927-100861949 GTGTGAATTCTCAGGCAGCCTGG + Intergenic
1046451815 8:114402664-114402686 CTGGGTATTGTCTGGGAGAACGG - Intergenic
1049584196 8:143425437-143425459 CTGTGTCTTCCCAGACAGCAGGG - Intronic
1050725430 9:8643726-8643748 CTGGGGGTGCTGAGGCAGCAAGG - Intronic
1050779229 9:9310123-9310145 CTGTGTATACTAAGGCAGCAAGG + Intronic
1052027419 9:23588969-23588991 CTGTGTTTCCTCAGGCAGAAGGG - Intergenic
1053278879 9:36803902-36803924 CTGGGATTTCTGAGACAGCAAGG + Intergenic
1055501090 9:76902856-76902878 CTGAGTATTCTCAGGAGGGAGGG + Intronic
1057991553 9:99776008-99776030 CAGGGTATTCTCCTGGAGCAGGG - Intergenic
1059890367 9:118795331-118795353 CAAGGTTTTCTGAGGCAGCAGGG - Intergenic
1060970119 9:127733020-127733042 CTGTGTTTCCTCAGGCAGCATGG - Intronic
1061028822 9:128067674-128067696 CTAAGTATCCTCAGGAAGCAGGG - Intronic
1198217175 X:134566282-134566304 CTGGCTACTCTCATGGAGCAGGG + Exonic
1200019520 X:153189940-153189962 TTGGGTAGGCTGAGGCAGCAGGG - Intergenic