ID: 968770634

View in Genome Browser
Species Human (GRCh38)
Location 4:2503865-2503887
Sequence TATTACAGGTACAGAGCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 112
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 102}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968770634_968770640 7 Left 968770634 4:2503865-2503887 CCAGTAGCTCTGTACCTGTAATA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 968770640 4:2503895-2503917 CCCTGGATACCAGGATCCAGAGG 0: 1
1: 0
2: 0
3: 20
4: 300
968770634_968770644 26 Left 968770634 4:2503865-2503887 CCAGTAGCTCTGTACCTGTAATA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 968770644 4:2503914-2503936 GAGGTAGCCGTCAGAACATCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
968770634_968770638 -2 Left 968770634 4:2503865-2503887 CCAGTAGCTCTGTACCTGTAATA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 968770638 4:2503886-2503908 TATAGGAATCCCTGGATACCAGG 0: 1
1: 0
2: 1
3: 6
4: 141
968770634_968770645 27 Left 968770634 4:2503865-2503887 CCAGTAGCTCTGTACCTGTAATA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
968770634_968770636 -10 Left 968770634 4:2503865-2503887 CCAGTAGCTCTGTACCTGTAATA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 968770636 4:2503878-2503900 ACCTGTAATATAGGAATCCCTGG 0: 1
1: 0
2: 0
3: 5
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968770634 Original CRISPR TATTACAGGTACAGAGCTAC TGG (reversed) Intronic