ID: 968770637

View in Genome Browser
Species Human (GRCh38)
Location 4:2503879-2503901
Sequence TCCAGGGATTCCTATATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 92}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968770637_968770640 -7 Left 968770637 4:2503879-2503901 CCTGTAATATAGGAATCCCTGGA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 968770640 4:2503895-2503917 CCCTGGATACCAGGATCCAGAGG 0: 1
1: 0
2: 0
3: 20
4: 300
968770637_968770645 13 Left 968770637 4:2503879-2503901 CCTGTAATATAGGAATCCCTGGA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
968770637_968770644 12 Left 968770637 4:2503879-2503901 CCTGTAATATAGGAATCCCTGGA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 968770644 4:2503914-2503936 GAGGTAGCCGTCAGAACATCAGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968770637 Original CRISPR TCCAGGGATTCCTATATTAC AGG (reversed) Intronic