ID: 968770639

View in Genome Browser
Species Human (GRCh38)
Location 4:2503895-2503917
Sequence CCTCTGGATCCTGGTATCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968770639_968770648 22 Left 968770639 4:2503895-2503917 CCCTGGATACCAGGATCCAGAGG No data
Right 968770648 4:2503940-2503962 CCCTCTAAACTTTGTGCCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 153
968770639_968770645 -3 Left 968770639 4:2503895-2503917 CCCTGGATACCAGGATCCAGAGG No data
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
968770639_968770644 -4 Left 968770639 4:2503895-2503917 CCCTGGATACCAGGATCCAGAGG No data
Right 968770644 4:2503914-2503936 GAGGTAGCCGTCAGAACATCAGG 0: 1
1: 0
2: 0
3: 5
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968770639 Original CRISPR CCTCTGGATCCTGGTATCCA GGG (reversed) Intronic