ID: 968770641

View in Genome Browser
Species Human (GRCh38)
Location 4:2503896-2503918
Sequence ACCTCTGGATCCTGGTATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 249}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968770641_968770644 -5 Left 968770641 4:2503896-2503918 CCTGGATACCAGGATCCAGAGGT 0: 1
1: 0
2: 1
3: 10
4: 249
Right 968770644 4:2503914-2503936 GAGGTAGCCGTCAGAACATCAGG 0: 1
1: 0
2: 0
3: 5
4: 62
968770641_968770648 21 Left 968770641 4:2503896-2503918 CCTGGATACCAGGATCCAGAGGT 0: 1
1: 0
2: 1
3: 10
4: 249
Right 968770648 4:2503940-2503962 CCCTCTAAACTTTGTGCCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 153
968770641_968770645 -4 Left 968770641 4:2503896-2503918 CCTGGATACCAGGATCCAGAGGT 0: 1
1: 0
2: 1
3: 10
4: 249
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968770641 Original CRISPR ACCTCTGGATCCTGGTATCC AGG (reversed) Intronic