ID: 968770645

View in Genome Browser
Species Human (GRCh38)
Location 4:2503915-2503937
Sequence AGGTAGCCGTCAGAACATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968770634_968770645 27 Left 968770634 4:2503865-2503887 CCAGTAGCTCTGTACCTGTAATA 0: 1
1: 0
2: 0
3: 9
4: 102
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
968770639_968770645 -3 Left 968770639 4:2503895-2503917 CCCTGGATACCAGGATCCAGAGG No data
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
968770641_968770645 -4 Left 968770641 4:2503896-2503918 CCTGGATACCAGGATCCAGAGGT 0: 1
1: 0
2: 1
3: 10
4: 249
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73
968770637_968770645 13 Left 968770637 4:2503879-2503901 CCTGTAATATAGGAATCCCTGGA 0: 1
1: 0
2: 0
3: 5
4: 92
Right 968770645 4:2503915-2503937 AGGTAGCCGTCAGAACATCAGGG 0: 1
1: 0
2: 0
3: 5
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968770645 Original CRISPR AGGTAGCCGTCAGAACATCA GGG Intronic