ID: 968772573

View in Genome Browser
Species Human (GRCh38)
Location 4:2517055-2517077
Sequence TTTTTTCCTAAGACGGAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 5061
Summary {0: 1, 1: 2, 2: 77, 3: 1389, 4: 3592}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968772571_968772573 -8 Left 968772571 4:2517040-2517062 CCTTGCTATTTTTTTTTTTTTCC 0: 1
1: 21
2: 460
3: 5789
4: 38604
Right 968772573 4:2517055-2517077 TTTTTTCCTAAGACGGAGTCTGG 0: 1
1: 2
2: 77
3: 1389
4: 3592
968772570_968772573 -1 Left 968772570 4:2517033-2517055 CCAGAATCCTTGCTATTTTTTTT 0: 1
1: 1
2: 6
3: 124
4: 1488
Right 968772573 4:2517055-2517077 TTTTTTCCTAAGACGGAGTCTGG 0: 1
1: 2
2: 77
3: 1389
4: 3592

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968772573 Original CRISPR TTTTTTCCTAAGACGGAGTC TGG Intronic
Too many off-targets to display for this crispr