ID: 968778497

View in Genome Browser
Species Human (GRCh38)
Location 4:2560591-2560613
Sequence CAAAGTTAACTGCGTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968778497 Original CRISPR CAAAGTTAACTGCGTGCTCC AGG Intronic
903487296 1:23699882-23699904 CAAAGGCAACTGAGTGCTACAGG + Intergenic
906746484 1:48225476-48225498 CAAAATTAACTTCCTCCTCCTGG + Intronic
907458970 1:54594035-54594057 CCAAGGTAACTGGGTGCGCCTGG + Exonic
911662437 1:100516984-100517006 TAAAGTTAACATCGTGCACCAGG - Intronic
912444578 1:109725300-109725322 CAAAGTAAACTTGGGGCTCCTGG + Intronic
914959078 1:152190020-152190042 CAAACATAACCGCGTGCTCTGGG - Intergenic
1064891828 10:20183959-20183981 CAAAGTTATAAGCTTGCTCCTGG + Intronic
1079932876 11:26586858-26586880 CATAGTTAACTCTGGGCTCCTGG - Intronic
1082883564 11:58061301-58061323 CAAAGTTAACTGCTCCTTCCAGG + Intronic
1083947521 11:65932562-65932584 CAAAGTGAAGTGCTTGCTCCTGG - Intergenic
1085573695 11:77583513-77583535 CAAAGTAAACTTGGGGCTCCTGG - Intronic
1086215109 11:84369843-84369865 CAAATGTATCTGCATGCTCCTGG - Intronic
1087674337 11:101141587-101141609 CAAAGATAACTTGGGGCTCCTGG + Intergenic
1091961699 12:4701056-4701078 GAAAGTTGAATGCGTGCTTCCGG + Intronic
1095229447 12:39721035-39721057 CAATGATAACTGCGTTCTGCAGG + Exonic
1098809157 12:75062380-75062402 AAAAGTTAACTTCATTCTCCTGG - Intronic
1098871305 12:75820279-75820301 TACAGTTAATTGAGTGCTCCAGG - Intergenic
1104849099 12:131862756-131862778 CAACGTGAACTGCGGACTCCGGG - Intergenic
1105073920 12:133258617-133258639 CAATGTTAAGTGTGGGCTCCTGG + Intergenic
1107350999 13:39514629-39514651 CAAAGTTAACTGAGTGCCAGGGG + Intronic
1113135396 13:107083377-107083399 CAAATTGAACTGTGTCCTCCAGG - Intergenic
1113446024 13:110367744-110367766 AAAAGTGAACTGCTTCCTCCAGG - Intronic
1121388472 14:93552844-93552866 CAAAGATAACTTGGGGCTCCTGG + Intronic
1121945097 14:98112556-98112578 CAAAATTAGCTGAGTGCTTCAGG - Intergenic
1124432027 15:29616037-29616059 CACTGTTACCTGCATGCTCCAGG - Intergenic
1135415722 16:22266774-22266796 CCAGGTTGGCTGCGTGCTCCAGG - Exonic
1143239143 17:5429228-5429250 CCAAGTTAAATGCCTCCTCCAGG - Intronic
1143274133 17:5697356-5697378 ATAACTTAGCTGCGTGCTCCGGG - Intergenic
1153976751 18:10275017-10275039 CAAAGTGAACTGAGTTCTCAAGG + Intergenic
1155308031 18:24498338-24498360 CACTGTTAACTGCCTGCCCCTGG + Intergenic
1155739991 18:29277778-29277800 CACAGAGCACTGCGTGCTCCTGG + Intergenic
1158505489 18:58043819-58043841 CACAGTTAACAGCGAGCTCAGGG + Intergenic
1164493448 19:28735868-28735890 CTAATTTAACTGCCTGCTCCTGG + Intergenic
1164743446 19:30594088-30594110 CAAAGTTCAATGAGTGATCCAGG + Intronic
925256049 2:2489655-2489677 GAAAGTTAACATCGTGCTCCAGG + Intergenic
926280787 2:11444082-11444104 GAAAGTTCACTGTGTGCTTCAGG + Intergenic
926776461 2:16428393-16428415 CACAGTTAGCTGTGTGATCCAGG + Intergenic
939951712 2:148483270-148483292 GAAAATGAAGTGCGTGCTCCTGG - Exonic
941877494 2:170449095-170449117 CTAAGGTAACTTGGTGCTCCTGG + Intronic
943058803 2:183016697-183016719 CAAAGATGAGTGCGTGGTCCAGG + Intronic
947533333 2:230926318-230926340 CCAAGTCCACTGCCTGCTCCAGG + Intronic
947641292 2:231709092-231709114 CAAAGTTATTTCCGTGCGCCCGG - Intronic
1177080664 21:16635021-16635043 AAAAGATAACTGTGTGATCCTGG + Intergenic
1178267159 21:31154270-31154292 CAAGGTGATCTGCGAGCTCCTGG - Exonic
1180067501 21:45419934-45419956 CAAAGCTACCTGCGTCCACCGGG - Intronic
1181431035 22:22882060-22882082 CAATGTTAACTGCTGGTTCCAGG - Intronic
1181710756 22:24686191-24686213 CAATGATAACTTTGTGCTCCTGG - Intergenic
950646866 3:14382593-14382615 AAAGGTTAACAGCGTGGTCCTGG + Intergenic
961242454 3:125423713-125423735 CACAGTTAACTGCTTACTTCTGG + Intergenic
964332339 3:155617877-155617899 CAAAGTTAACTTGGGGCTCCTGG - Intronic
968778497 4:2560591-2560613 CAAAGTTAACTGCGTGCTCCAGG + Intronic
970055807 4:11970827-11970849 CACAGATAACTGCATGCTCCAGG + Intergenic
971308727 4:25505924-25505946 CAAAGTCAAGTCCGTGCTCGTGG + Intergenic
971505690 4:27364433-27364455 CAAACTAATCTGAGTGCTCCAGG + Intergenic
973539100 4:51917805-51917827 CAATTTTAACAGCGTGCACCTGG - Intergenic
976510567 4:85904259-85904281 CCATGTGAACTGCCTGCTCCTGG - Intronic
987419144 5:17697950-17697972 CCAACTTTCCTGCGTGCTCCAGG + Intergenic
996041939 5:118824142-118824164 CAGTGTTAGCTGCCTGCTCCAGG + Intergenic
998046649 5:138992371-138992393 ATAAGTTAACTGCATGCTCTTGG + Intronic
998897187 5:146812071-146812093 CAAAGTTAACTCAGAGCTCTTGG - Intronic
1003703749 6:8500086-8500108 CACAGTTAAATGCAAGCTCCTGG + Intergenic
1009834925 6:68987690-68987712 TAAGGTTAACTGCATTCTCCAGG - Intronic
1015835334 6:137414616-137414638 CACGGTTAACTGCTTGCTCCTGG - Intergenic
1017927490 6:158922804-158922826 CAAACTTAACTGACTGCTTCAGG - Intergenic
1019256693 7:57051-57073 CAATGCTCACTGTGTGCTCCTGG - Intergenic
1019831054 7:3330895-3330917 CAAAGTTTACTGCAGCCTCCTGG - Intronic
1021965648 7:25915607-25915629 CAAATCCAACTGCGTTCTCCAGG + Intergenic
1026483633 7:70799362-70799384 CAATGTTAACTGAGTGCTTTTGG + Intergenic
1035494672 7:159313663-159313685 CAATGTTAAGTGTGGGCTCCTGG + Intergenic
1037991600 8:23325266-23325288 CAAAGTTACATGCGTGGTTCCGG + Intronic
1041062185 8:54044836-54044858 CAAAGTTAACTGTGTCATGCGGG + Intergenic
1042121161 8:65489970-65489992 CAAAGTGAACTGTGTGCGCCAGG - Intergenic
1043676958 8:82968784-82968806 CCAAGATAACTTGGTGCTCCAGG + Intergenic
1044009021 8:86968531-86968553 CAAAGTTAAGGACGTGCACCAGG + Intronic
1045060129 8:98403748-98403770 CAAAGTAGACTGCGTGCTATAGG + Intronic
1048763445 8:137822017-137822039 CAAAGTTAAGGACGTGCACCTGG + Intergenic
1054846657 9:69805853-69805875 CTAAGTTTAATGGGTGCTCCTGG - Intergenic
1186140927 X:6572749-6572771 TAAAGATAACTGAGTGGTCCTGG + Intergenic
1187732635 X:22271332-22271354 CAAACTTAGCTACTTGCTCCAGG + Intergenic
1192086388 X:68102245-68102267 GAAAGTGAACAGCCTGCTCCTGG + Intronic
1192952340 X:76029841-76029863 CAATGATAACTTTGTGCTCCTGG - Intergenic
1197870415 X:131058348-131058370 AAAGGTTAACTGCGAGCTGCCGG + Exonic
1201775342 Y:17657424-17657446 CAAAGTTAACTGAGTTCTCTAGG - Intergenic
1201826214 Y:18248565-18248587 CAAAGTTAACTGAGTTCTCTAGG + Intergenic