ID: 968782776

View in Genome Browser
Species Human (GRCh38)
Location 4:2595572-2595594
Sequence CAAGGCCCAGACGCCCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 204}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968782776_968782780 19 Left 968782776 4:2595572-2595594 CCTGGAAGGGCGTCTGGGCCTTG 0: 1
1: 0
2: 2
3: 14
4: 204
Right 968782780 4:2595614-2595636 CTCCCTGTTTATCTTGAATCTGG 0: 1
1: 0
2: 2
3: 7
4: 119
968782776_968782783 26 Left 968782776 4:2595572-2595594 CCTGGAAGGGCGTCTGGGCCTTG 0: 1
1: 0
2: 2
3: 14
4: 204
Right 968782783 4:2595621-2595643 TTTATCTTGAATCTGGAATTTGG 0: 1
1: 0
2: 5
3: 40
4: 906

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968782776 Original CRISPR CAAGGCCCAGACGCCCTTCC AGG (reversed) Intronic
900763252 1:4486929-4486951 CACTGACCAGACGGCCTTCCAGG - Intergenic
901821596 1:11833810-11833832 CAAGGCCCAGTAGACCTACCGGG - Intronic
902089718 1:13893337-13893359 CAAGTTCCAGCCACCCTTCCGGG + Intergenic
902178901 1:14672716-14672738 CAATGCCCAGACCCCATTGCAGG + Intronic
904032172 1:27540104-27540126 CAATCCCCAGGGGCCCTTCCTGG + Intronic
904578376 1:31521288-31521310 CAAGTCCCAGTCTTCCTTCCAGG - Intergenic
904592393 1:31622267-31622289 CACCGCCCAGACGCCAATCCAGG - Intronic
907251428 1:53142260-53142282 TCAGGCCCACACGCCCCTCCTGG + Intronic
908869286 1:68589992-68590014 CAAGTCCCAGACATTCTTCCAGG - Intergenic
912406595 1:109443822-109443844 CAAGGCTCAGAGGAGCTTCCTGG + Intergenic
912437019 1:109668866-109668888 CAAAGCCCAGCCCTCCTTCCTGG - Intronic
915044320 1:152999419-152999441 CAAGTTCCAGTCACCCTTCCTGG - Intergenic
915551577 1:156638423-156638445 CAAGACCCAGATGCCCGTGCAGG + Intergenic
915606188 1:156952849-156952871 CAAGGCCCAGATGCACGTTCAGG - Intronic
917333228 1:173903960-173903982 CAAGGCCAACAGGCCTTTCCTGG - Exonic
919564181 1:199162930-199162952 CATGACCCACAAGCCCTTCCAGG + Intergenic
924163513 1:241258666-241258688 CAAGGAACAGACACCCTTGCAGG + Intronic
1066113191 10:32215590-32215612 CAAGCCCAAGACACCCTACCAGG + Intergenic
1067229972 10:44399303-44399325 CAGAGCCCAGACGCACTTCAAGG + Intergenic
1067719493 10:48716630-48716652 CAAGGCCCAGACTCCTTCCTGGG - Intronic
1069989993 10:72309322-72309344 CCAGGTCCAGATGCCCTTGCAGG + Intergenic
1072077616 10:91993690-91993712 TAAGGCCCAGAAGCCTTACCTGG + Exonic
1073181908 10:101588456-101588478 CCAGGCCCTGAGGCCCTTCCCGG - Intronic
1074815215 10:117137463-117137485 CAAGGGCCGGACGACCTGCCGGG - Intronic
1076107545 10:127835303-127835325 CAAGGCACAGACCCCGTTCCGGG + Intergenic
1076408759 10:130231254-130231276 CAAGGAACAGATGCCCCTCCAGG - Intergenic
1076685897 10:132198360-132198382 CAAGGCCCAGGCTCCCTTCAGGG + Intronic
1077040764 11:521079-521101 CACGGGGCAGACGCCCTGCCAGG + Intergenic
1077606619 11:3616770-3616792 CAAAGCCCAGTCGGCCCTCCTGG - Intergenic
1079334140 11:19556093-19556115 CAAGTCGCTGACACCCTTCCTGG - Intronic
1080760577 11:35245225-35245247 CTCTGCCCAGACCCCCTTCCTGG + Intergenic
1083765328 11:64838803-64838825 CACGGCCTAGCCGCTCTTCCTGG + Exonic
1084321386 11:68375331-68375353 GAAGGCTCCGACTCCCTTCCTGG + Intronic
1084456084 11:69268953-69268975 CTAGGCCCAGAGGGCCTCCCTGG - Intergenic
1085803635 11:79614328-79614350 CTATGCCCAGAGGCCCCTCCTGG - Intergenic
1089560550 11:119341082-119341104 CAAGGACCAGACCCCATTTCAGG + Exonic
1089590416 11:119536834-119536856 AAAGGGCCACACTCCCTTCCGGG + Intergenic
1091973991 12:4810425-4810447 CGAGGCCCTGGCGGCCTTCCGGG + Exonic
1096063732 12:48723486-48723508 CAAGGCCCAGACCCTATTTCAGG + Intergenic
1097195076 12:57238636-57238658 CAAGGACCAGGCGCCCCTTCCGG - Intronic
1108228975 13:48318295-48318317 CACTGCCCAGATGCACTTCCTGG - Intronic
1111677377 13:91403656-91403678 CAAGGCCCAGTTCCACTTCCAGG + Intronic
1111996936 13:95174755-95174777 CAAGCCACAGAGGCCCTTCTCGG + Intronic
1112507469 13:99983582-99983604 CGGGGTCCAAACGCCCTTCCCGG + Intronic
1117075721 14:52101993-52102015 CAAGGCCCCGTTGGCCTTCCGGG + Intergenic
1117463181 14:55967043-55967065 CAAGTCACAGAATCCCTTCCTGG - Intergenic
1119479277 14:74949623-74949645 CAAGGCCCTGCTGGCCTTCCAGG + Intronic
1119674795 14:76545878-76545900 CAAGGTCCAGACGTCCTTGCTGG + Intergenic
1122114328 14:99520312-99520334 CCAGGGCCAGAGGCCCTTGCTGG - Intronic
1124138642 15:27057573-27057595 CACAGCCCAGAGGCCTTTCCAGG - Intronic
1125195181 15:37038075-37038097 CAATTCCCAGATGTCCTTCCAGG - Intronic
1126852515 15:52805816-52805838 CAAGCCCAAGACGCCCATCCCGG - Intergenic
1127774229 15:62253019-62253041 CTAGGGCCAGGTGCCCTTCCTGG - Intergenic
1127789875 15:62390400-62390422 CGAGGCTCAGGCGCCCGTCCTGG - Intergenic
1128340433 15:66818900-66818922 AGAGACCCAGAGGCCCTTCCTGG - Intergenic
1128458320 15:67846086-67846108 CAAAGCCCAGAAGAGCTTCCCGG - Intergenic
1128784776 15:70386738-70386760 CTTAGCCCAGACCCCCTTCCTGG - Intergenic
1129677955 15:77642580-77642602 CTAGGCCCAGACTGCCCTCCTGG - Intronic
1131231802 15:90665330-90665352 TCAGGCCCAGCCGCCTTTCCCGG - Intergenic
1132677755 16:1127665-1127687 CAGGGCCCAGGTGCCCTCCCAGG + Intergenic
1136501083 16:30669937-30669959 CAGGGCCTAGAGGCCCTTACAGG - Exonic
1136666813 16:31819617-31819639 CAAGGCCCAGGCCCCGTCCCCGG - Intergenic
1138710097 16:58961523-58961545 CAACGCCCAGACTCCTTTGCTGG + Intergenic
1139559902 16:67735303-67735325 CAAGGCCCAAGAGCCCTTTCTGG + Intronic
1140041991 16:71414144-71414166 CAAGGCCCAGACTCCTCTCCTGG - Intergenic
1141649684 16:85386221-85386243 CAAGGCCCTGACGCCGTGGCAGG + Intergenic
1142888871 17:2930080-2930102 ACAGTCCCAGACACCCTTCCAGG - Intronic
1146277130 17:31523117-31523139 GGAGGCCCAGACCCTCTTCCAGG + Intronic
1147038719 17:37701013-37701035 CATGGCCCAGCAGCCCTTCATGG - Exonic
1147677898 17:42220009-42220031 CAGGGCCCAGAGGCGCCTCCTGG - Intronic
1148458939 17:47826763-47826785 CCAGGTCCTGAAGCCCTTCCTGG - Exonic
1151550411 17:74819474-74819496 CAAGGCCCAGGTGTCATTCCAGG - Intronic
1152785427 17:82245580-82245602 CAGGACACAGACGCCCCTCCAGG + Intronic
1155035524 18:22021952-22021974 CAAGCGCCAGACCCCCTTGCTGG + Intergenic
1155420052 18:25646124-25646146 CATTGCCCAGTCTCCCTTCCAGG - Intergenic
1157560098 18:48639711-48639733 CCAGCCCCAAACGCCCATCCAGG - Intronic
1160033350 18:75281057-75281079 GAGGGTCCAGACGCCCTGCCTGG + Intronic
1160442006 18:78900132-78900154 CAGGCCCCAGACACCATTCCTGG - Intergenic
1160686373 19:438807-438829 CAAGGCCCTGGCGTCCGTCCTGG - Exonic
1160705800 19:529706-529728 GGAGGCCCAGAGGCCCTTACGGG + Intergenic
1161464255 19:4419254-4419276 CAAAGCCCAGAGGCCTTCCCTGG - Intronic
1162585281 19:11554439-11554461 CAAGTCCCAGACCCTCTTTCCGG - Intronic
1165830806 19:38729355-38729377 CAGGGCCCTGACGCCGTGCCCGG + Exonic
1167358224 19:49016799-49016821 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167359723 19:49023688-49023710 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167362244 19:49036388-49036410 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167363838 19:49044470-49044492 AAAGACCCAGAGACCCTTCCCGG - Intronic
1167364660 19:49048457-49048479 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167365949 19:49055093-49055115 AAAGACCCAGAGACCCTTCCCGG + Intronic
1167645869 19:50704436-50704458 CAACGGACAGACCCCCTTCCAGG - Exonic
1168204561 19:54840009-54840031 CATTTCCCAGAAGCCCTTCCTGG + Intronic
925054055 2:842409-842431 CAAGGGCAAGAAGCCCTGCCAGG - Intergenic
925267618 2:2577544-2577566 CAAGGCCCAGGCCCCGTTCCCGG - Intergenic
926296676 2:11573981-11574003 CCAGGCTTAGAAGCCCTTCCAGG + Intronic
926580820 2:14632243-14632265 CAGGGCCCAGACGCCCGCCTCGG + Intergenic
931216217 2:60247463-60247485 CACGGCCCAGCCGCCCTCCTGGG + Intergenic
934603781 2:95679059-95679081 CAAGGCCCAGAGGCCATAGCAGG - Intergenic
936400295 2:112159814-112159836 GTGGGCCCAGATGCCCTTCCAGG + Exonic
936537161 2:113321289-113321311 CAAGGCCCAGAGGCCATAGCAGG - Intergenic
937551282 2:123095388-123095410 CAAGGCCAAGAGGGCCGTCCCGG - Intergenic
938232022 2:129669498-129669520 CAGGGTCCACACACCCTTCCCGG + Intergenic
941174504 2:162180197-162180219 CAAAGCCCAGATACCTTTCCTGG - Intronic
941398497 2:165001321-165001343 CAAGTCCCAGACTCCTATCCAGG + Intergenic
945966252 2:216190407-216190429 CACGGCCCAGACTCATTTCCAGG - Intronic
946449987 2:219771608-219771630 CAATGCCCAGATATCCTTCCAGG - Intergenic
948148941 2:235729419-235729441 CAAGGCCCAGTGGTTCTTCCAGG - Intronic
948383703 2:237568469-237568491 CAAGGCCCAGACCACCTACACGG + Intergenic
1170665228 20:18380980-18381002 CAAGGCCTGGTCGCTCTTCCTGG - Intergenic
1170857525 20:20070902-20070924 CATGGCCCAGGCCACCTTCCTGG + Exonic
1171444565 20:25194759-25194781 CAAGGGCCAGAGCCCCTTCCCGG - Intergenic
1175985199 20:62761002-62761024 CAAGGCCCAGGGGCTCTGCCAGG + Exonic
1178719215 21:34993039-34993061 AAGGCCCCAGATGCCCTTCCTGG - Intronic
1180098598 21:45573834-45573856 CAAGGCCAGGAGGCGCTTCCTGG - Intergenic
1180762881 22:18222729-18222751 CACCTCCCAGACGCACTTCCAGG + Intergenic
1180772765 22:18401818-18401840 CACCTCCCAGACGCACTTCCAGG - Intergenic
1180804144 22:18651434-18651456 CACCTCCCAGACGCACTTCCAGG - Intergenic
1180806630 22:18718043-18718065 CACCTCCCAGACGCACTTCCAGG + Intergenic
1181078948 22:20401213-20401235 CCAGGCCCAGTCGACCTTACAGG - Intronic
1181217576 22:21343825-21343847 CACCTCCCAGACGCACTTCCAGG + Intergenic
1181425392 22:22834312-22834334 CAAGGCCCACAGTCCCTTCTAGG - Intronic
1181869066 22:25883616-25883638 CAGGGATCAGACACCCTTCCAGG + Intronic
1182749237 22:32628396-32628418 CCAGTCCCAGATGTCCTTCCAGG - Intronic
1183700996 22:39451033-39451055 CTTGGCCCAGACACCCTACCTGG + Intergenic
1183826461 22:40391828-40391850 CAAGGCTCAGAAGCACTTCTGGG - Intronic
1184257174 22:43293988-43294010 CAAGGCCCAGCCGCCCTGCCAGG - Intronic
1184738463 22:46412695-46412717 CCAGCCTCAGACGCCCTTCCAGG + Intronic
1203234600 22_KI270731v1_random:142806-142828 CACCTCCCAGACGCACTTCCAGG - Intergenic
950196873 3:11015556-11015578 CACAGCCCAGACGCCCTGGCAGG + Intronic
950447210 3:13045198-13045220 CCAGGCCCAGAGGCCTTCCCTGG + Intronic
952745890 3:36778851-36778873 CTAGGCCCAGACGGCTTTACAGG - Intergenic
953607138 3:44419484-44419506 CAGGGCCCAGATGACCTTGCAGG + Intergenic
953617162 3:44501611-44501633 CACTGCCAAGAAGCCCTTCCAGG + Intronic
954431015 3:50470874-50470896 CACGTCTCAGACGCCCTCCCGGG + Intronic
955415368 3:58686618-58686640 AGAAGCCCAGACTCCCTTCCTGG + Intergenic
957956824 3:87197762-87197784 GATGGCCCTGACTCCCTTCCAGG - Intergenic
965505678 3:169512259-169512281 CAAGGCCAAGACTTACTTCCAGG + Intronic
965735092 3:171810763-171810785 CAAGGACCAGCCACCTTTCCCGG + Intronic
966936229 3:184711636-184711658 CAAGGCCCTCGCGCCTTTCCGGG + Exonic
967852948 3:194095794-194095816 TCAGGCCCAGAGGCTCTTCCGGG - Intergenic
968262480 3:197336077-197336099 CAAGGCTCAAACTTCCTTCCAGG - Intergenic
968482743 4:843637-843659 CTACGCCCAGACTCCTTTCCTGG - Intergenic
968622608 4:1610611-1610633 CCAAGCCCAGATGCCCTGCCTGG - Intergenic
968782776 4:2595572-2595594 CAAGGCCCAGACGCCCTTCCAGG - Intronic
968878943 4:3288749-3288771 AAAGGCCCAGAGTCCCTTCACGG - Intergenic
969094817 4:4724337-4724359 CAAGGCCCAGATGCTGATCCTGG - Intergenic
969378386 4:6778262-6778284 CAAGGCCCAGAACCGCCTCCTGG - Intergenic
969598203 4:8160551-8160573 CATGGCCCCGAGGCCCTTCCAGG - Intergenic
972235417 4:37127669-37127691 CCAGGCCCAGATGCCCTCACTGG + Intergenic
972511317 4:39770737-39770759 CAATGCCCAGGCCCCCTCCCAGG + Intronic
973752448 4:54035346-54035368 CCAGGCCCAGATGCCTTTACTGG - Intronic
975865664 4:78721295-78721317 CACAGCCCAGACTCCCTTCGGGG + Intergenic
977925397 4:102694821-102694843 CAAGGCCTTGAGGCCCTCCCTGG + Intronic
979099744 4:116599534-116599556 CAGGGCCCTGACGCCGTGCCCGG + Intergenic
980727900 4:136788210-136788232 CAAGGTACAGCCTCCCTTCCAGG - Intergenic
983708556 4:170687631-170687653 CAAGGTCCAAACGTCCTGCCTGG + Intergenic
985836140 5:2273231-2273253 TAAGGGCCAGACGCCATCCCCGG + Intergenic
995804749 5:116038934-116038956 CAAGCCCCAGACAGCCTTTCAGG + Intronic
996121708 5:119680674-119680696 CCAGGTCCTGAAGCCCTTCCTGG + Intergenic
998374683 5:141682633-141682655 CAGGGTCCAGCCACCCTTCCGGG - Intergenic
998633995 5:143932145-143932167 CAAGGCCCACATGTACTTCCTGG - Intergenic
1001274591 5:170341137-170341159 CAACTCCCAGACTCACTTCCAGG + Intergenic
1002711083 5:181195397-181195419 CAGGGCCCAGACGCCCTCCTCGG + Exonic
1004359235 6:14956307-14956329 AAAGGCCAAGGCGCCCATCCTGG - Intergenic
1005475690 6:26205408-26205430 TAAGGCCCACACTCCTTTCCAGG - Intergenic
1005895230 6:30172096-30172118 CACGGCCCAGACGCCGTCCTCGG - Exonic
1006034755 6:31202590-31202612 CCAGGCCCAGGGGCCCCTCCAGG - Exonic
1006106856 6:31721962-31721984 TCAGGCCAAGATGCCCTTCCTGG + Intronic
1006136768 6:31900600-31900622 CAATGCCCAGACCCCCTCCCAGG + Exonic
1006458126 6:34143584-34143606 GAAGGCCCTGAGGCCCTTCTGGG + Intronic
1006502239 6:34466267-34466289 CAAGGGCCAGACCTCCTACCTGG - Exonic
1007240666 6:40422696-40422718 CAAGTCCCAGGCACTCTTCCAGG + Intronic
1007989938 6:46244463-46244485 CAAGTTCCAGACACCCTTACTGG - Intronic
1011113038 6:83859673-83859695 CAAGCCCCCGACCCACTTCCGGG - Exonic
1013174745 6:107667713-107667735 GAAGGCCCAGACCCCCTCCTGGG + Intergenic
1016204112 6:141452426-141452448 CAAGGCCAAGAACCCCCTCCTGG - Intergenic
1019126139 6:169841188-169841210 CAAGGCCCAGCCGTCCTCTCTGG - Intergenic
1019942494 7:4302457-4302479 CAAGCCCCAGGTGCCTTTCCCGG + Intergenic
1022318589 7:29266822-29266844 CTAGGTCCAGACCTCCTTCCAGG + Intronic
1023867864 7:44247331-44247353 GAAGCCCCAGAGGCCCCTCCTGG - Intronic
1026208184 7:68277774-68277796 CAAGCCCCTGACCCCTTTCCAGG + Intergenic
1028170711 7:87592156-87592178 CAAGGCACTGATGCCCTTCATGG - Intronic
1028971657 7:96865894-96865916 GAAGGCCCAGAGGCTCTTCCAGG - Intergenic
1032504063 7:132422730-132422752 CAAGGCCCAGGCCCTGTTCCAGG + Intronic
1034218140 7:149423143-149423165 CGAGGCCCGCCCGCCCTTCCTGG - Intergenic
1034976527 7:155452041-155452063 CAAGGCCCAAACCACCTTTCCGG - Intergenic
1035623399 8:1052163-1052185 CTGGGCCCGGCCGCCCTTCCTGG + Intergenic
1037281489 8:17246984-17247006 CACGGCCCAGACGCCCAAACCGG - Exonic
1041738181 8:61133110-61133132 CAAGGGCCAGATGCTCTGCCTGG + Intronic
1044835720 8:96293555-96293577 CAATGCCCTGTGGCCCTTCCAGG + Intronic
1047349979 8:124064468-124064490 CCAGGCCCAGCCGGCCATCCTGG + Exonic
1047916729 8:129591853-129591875 CAGGGTCCTGACCCCCTTCCAGG + Intergenic
1049104173 8:140601082-140601104 GATGACCCAGTCGCCCTTCCTGG - Intronic
1049172611 8:141171009-141171031 CAGGGCCCACGCACCCTTCCCGG - Intronic
1049213738 8:141398439-141398461 CAAGTCCCTGACTCCCATCCTGG + Intronic
1049623948 8:143611839-143611861 CAGGACCCAGATGCCCTCCCTGG - Intergenic
1050102057 9:2129545-2129567 CAAGGCCCAGTAGCACTCCCTGG - Intronic
1051903252 9:22065222-22065244 CAAAGCCCAGACACCCATCTAGG + Intergenic
1053320584 9:37095004-37095026 CAAAACCCAGAAGACCTTCCAGG - Intergenic
1053352511 9:37422890-37422912 CAAGGCCCAAACGCCCCGCCCGG - Intronic
1053902147 9:42805920-42805942 CAAGGCCCCCACGCCCACCCCGG - Intergenic
1054532830 9:66199605-66199627 CAAGGCCCCCACGCCCACCCCGG + Intergenic
1054808190 9:69412748-69412770 CAGGCCCCAGACTCCTTTCCCGG + Intergenic
1056913853 9:90728312-90728334 CCAGGCCCAGCCGCCCAGCCAGG + Intergenic
1057230810 9:93320282-93320304 CCAGGCCCTGACACCCTCCCAGG - Intronic
1057593114 9:96391173-96391195 CAAGGCCCAGAAGCTCTGCTAGG + Intronic
1057693567 9:97308001-97308023 CAAAGCCTAGACGCGTTTCCTGG + Exonic
1058943879 9:109838813-109838835 CAAGACACATACACCCTTCCAGG + Intronic
1059363788 9:113769706-113769728 CAAGCCCCAGATGCTCTTCTTGG + Intergenic
1062231927 9:135486685-135486707 CACAGCCCAGACGCACTTCTTGG + Exonic
1062433189 9:136535056-136535078 CAGGCCCCAGACCTCCTTCCAGG + Intronic
1062570028 9:137180700-137180722 CAGGGCCCTGACGCCGTGCCTGG - Intronic
1062613953 9:137387688-137387710 CAAGCCCCACCCGCCCTTCTCGG - Intronic
1062677830 9:137758304-137758326 CCACGGCCAGACGCCCTCCCTGG + Intronic
1185620160 X:1449312-1449334 CCTGGCCCTGACGCCCATCCTGG + Intronic
1192784855 X:74325710-74325732 CAGGGACCAGAGGCCTTTCCTGG - Intergenic
1193241985 X:79181280-79181302 CAAGGCTCAGAGGAGCTTCCTGG + Intergenic
1196018540 X:110965183-110965205 CAAGGCCCACATGGCCTTCAGGG - Intronic
1200067516 X:153511002-153511024 CACGACCCAGAAGCCCTTGCAGG - Intergenic
1202109465 Y:21405653-21405675 CAAGGCCCAGGGGCCCTTCCGGG + Intergenic
1202337449 Y:23826644-23826666 CAAGGCTCAGTGACCCTTCCGGG - Intergenic
1202533317 Y:25843427-25843449 CAAGGCTCAGTGACCCTTCCGGG + Intergenic