ID: 968791687

View in Genome Browser
Species Human (GRCh38)
Location 4:2669068-2669090
Sequence CGGGTAGGTCACCTGAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124957
Summary {0: 1, 1: 63, 2: 2263, 3: 28702, 4: 93928}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968791687_968791699 27 Left 968791687 4:2669068-2669090 CCTGACTTCAGGTGACCTACCCG 0: 1
1: 63
2: 2263
3: 28702
4: 93928
Right 968791699 4:2669118-2669140 CAGGCATGAGCTACCACGCCTGG 0: 187
1: 7167
2: 46335
3: 129270
4: 190929
968791687_968791692 -1 Left 968791687 4:2669068-2669090 CCTGACTTCAGGTGACCTACCCG 0: 1
1: 63
2: 2263
3: 28702
4: 93928
Right 968791692 4:2669090-2669112 GCCTTGGCCTCCCAAAGTGCTGG 0: 52775
1: 164492
2: 216668
3: 175886
4: 111238
968791687_968791696 8 Left 968791687 4:2669068-2669090 CCTGACTTCAGGTGACCTACCCG 0: 1
1: 63
2: 2263
3: 28702
4: 93928
Right 968791696 4:2669099-2669121 TCCCAAAGTGCTGGGATTACAGG 0: 284556
1: 262309
2: 153276
3: 130613
4: 189623
968791687_968791694 0 Left 968791687 4:2669068-2669090 CCTGACTTCAGGTGACCTACCCG 0: 1
1: 63
2: 2263
3: 28702
4: 93928
Right 968791694 4:2669091-2669113 CCTTGGCCTCCCAAAGTGCTGGG 0: 84285
1: 209100
2: 236161
3: 152470
4: 88713

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968791687 Original CRISPR CGGGTAGGTCACCTGAAGTC AGG (reversed) Intronic
Too many off-targets to display for this crispr