ID: 968794211

View in Genome Browser
Species Human (GRCh38)
Location 4:2691540-2691562
Sequence AGCCCCTGGCTGTCACTTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
968794206_968794211 -9 Left 968794206 4:2691526-2691548 CCAGCCTAGGGTACAGCCCCTGG 0: 1
1: 0
2: 0
3: 12
4: 200
Right 968794211 4:2691540-2691562 AGCCCCTGGCTGTCACTTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 128
968794204_968794211 -1 Left 968794204 4:2691518-2691540 CCTGTCACCCAGCCTAGGGTACA 0: 1
1: 1
2: 45
3: 646
4: 4104
Right 968794211 4:2691540-2691562 AGCCCCTGGCTGTCACTTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 128
968794205_968794211 -8 Left 968794205 4:2691525-2691547 CCCAGCCTAGGGTACAGCCCCTG 0: 1
1: 0
2: 0
3: 24
4: 201
Right 968794211 4:2691540-2691562 AGCCCCTGGCTGTCACTTAGGGG 0: 1
1: 0
2: 1
3: 6
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
968794211 Original CRISPR AGCCCCTGGCTGTCACTTAG GGG Intronic
900707775 1:4091028-4091050 AGGCCCTGTCTCTGACTTAGAGG + Intergenic
902622885 1:17660627-17660649 AGCCCCTGGGTCTCCCTCAGGGG - Intronic
903535258 1:24062638-24062660 AAGCCCTGGCTCTCAGTTAGTGG + Intronic
903976784 1:27155138-27155160 AGCCCGGCGCTGTCACTTATAGG + Intronic
906646965 1:47482199-47482221 AGCCCTTGGCAGTGACTTGGGGG + Intergenic
907811120 1:57871039-57871061 AGCCCATGGCTGGCACTTTTAGG - Intronic
912548269 1:110466571-110466593 AGCCCCAGGCTGGCACAGAGAGG + Intergenic
912607624 1:111008355-111008377 AGCACTTGACTGTCCCTTAGTGG - Intergenic
912747857 1:112260430-112260452 AGGCCCTGGCTATCACAGAGAGG - Intergenic
917475566 1:175366297-175366319 AGCCCCTGGCCATCATTCAGAGG - Intronic
920562897 1:206951803-206951825 TGACCCTAGCTGTCACTCAGTGG + Intergenic
924452923 1:244195582-244195604 AGCCAGTGTCTGGCACTTAGAGG + Intergenic
924503449 1:244658243-244658265 GGCCCCTGGCTGACAGTTAAAGG + Intronic
924724675 1:246658273-246658295 AGCACCTTGCTGACACTGAGAGG - Intronic
1069572951 10:69505583-69505605 AGACCCTGTCTGTCTCTTAAGGG - Intronic
1075381799 10:122025054-122025076 GGACCCTGGCTGTCATTTGGTGG + Intronic
1076814660 10:132908864-132908886 AGCCCTTGGCTGCCCCTGAGCGG + Intronic
1076865747 10:133165442-133165464 TGCCTCTGGCTGTCACTCACAGG - Intronic
1078469794 11:11577739-11577761 AGCTCCCGGCTGGCACTTTGAGG + Intronic
1079051890 11:17168104-17168126 AGGAACTGGCTGTCACTGAGAGG - Intronic
1079344018 11:19636352-19636374 AGGCCCTGCCTGTAACTTAAGGG + Intronic
1081879692 11:46438101-46438123 AGCAACTGGCTTTCACTTAAAGG + Intronic
1090374749 11:126280846-126280868 AGCAACTGGCTGGCACCTAGGGG - Intergenic
1093323250 12:17740272-17740294 AGCCACTAGCTGGCACTAAGAGG + Intergenic
1095097189 12:38155033-38155055 AGCCCATGGCTTTCACCCAGGGG + Intergenic
1096698036 12:53363270-53363292 AGGCCCTACCTGTCACCTAGAGG - Intergenic
1097957146 12:65497561-65497583 ACCCTCTGGCTGGCACTCAGGGG - Intergenic
1102862174 12:116345411-116345433 TGCCCGTGGCTGTCATTTGGTGG + Intergenic
1104930219 12:132335056-132335078 GGCCGCTAGCTGTCACATAGGGG - Intergenic
1113575396 13:111391711-111391733 AGCCCCTGCTGGTCACCTAGGGG - Intergenic
1120827910 14:88971712-88971734 AGAGCCTGGCTGTCCCCTAGAGG - Intergenic
1121998927 14:98630056-98630078 AGTCCCTGCCTGTCACTGAAGGG + Intergenic
1122972334 14:105157439-105157461 GGCCCATGGCAGTGACTTAGTGG - Intronic
1125830891 15:42716457-42716479 AGCCTCTGCCTGTGGCTTAGAGG + Intronic
1128635853 15:69302007-69302029 AGCCCCAGTCTGTCTCTCAGCGG + Intronic
1129760962 15:78129152-78129174 AAACCCTAGGTGTCACTTAGGGG + Intronic
1130886891 15:88100665-88100687 AGCCCCAGGCATTCACTCAGAGG - Intronic
1133121819 16:3613151-3613173 ATCCCCTGGCAATCACTTATCGG + Intronic
1133775472 16:8891826-8891848 AGGCCCTTGCTGTCACGCAGTGG + Intergenic
1137901306 16:52272056-52272078 ACCGCCAGGCTGTCACTGAGCGG - Intergenic
1139334967 16:66225330-66225352 AGCCCCTCTCTGCCACTTAATGG + Intergenic
1139612024 16:68066090-68066112 AGCACCTGCCTGGCACCTAGTGG - Intronic
1141126575 16:81404811-81404833 GGGCTCTGGCTGTCACTCAGAGG - Intergenic
1141431818 16:83974137-83974159 AGCCCCTAACGGTCACATAGTGG - Intronic
1141482990 16:84319258-84319280 AGGCCCTGGGTCTCACTCAGCGG - Intronic
1141751316 16:85960325-85960347 AGCCTCTGTCTGGCACTGAGGGG + Intergenic
1142349610 16:89574193-89574215 AGCCCTTGGCTGTCACATAGCGG - Intergenic
1142499906 17:326457-326479 AGTCCCTCGCTGTCCCTCAGAGG - Intronic
1143878448 17:10011493-10011515 AGTCCCAGCCGGTCACTTAGTGG - Intronic
1145825939 17:27877401-27877423 AATCCCAGTCTGTCACTTAGTGG - Intronic
1147187572 17:38720910-38720932 AGCCAATGGCTGGCACTAAGTGG - Intronic
1147535865 17:41323098-41323120 AGGCTCTAGCTGTCACTCAGAGG + Intergenic
1148051789 17:44773161-44773183 AGCCCCTGGCTCCCACTTCCTGG + Intronic
1150325561 17:64253975-64253997 AGCCCCTGGGTGTTGCCTAGAGG + Intronic
1152606768 17:81295328-81295350 ACCCCCTGGCCGTCACTTCCGGG - Intronic
1153607487 18:6848715-6848737 ACCCATTGGCTGTCACTTTGGGG + Intronic
1157495852 18:48156936-48156958 TGCCCCTGCCTGTCACTCAGAGG + Intronic
1160127807 18:76194364-76194386 GGCCCCAGGCTGTGACTAAGAGG + Intergenic
1160813755 19:1026210-1026232 GGCCCCTCTCTGCCACTTAGAGG - Intergenic
1161250644 19:3278211-3278233 AGCCCCTGGCTGTCCTTCAGAGG + Intronic
1163317522 19:16551536-16551558 AGCTTCTTGCTGGCACTTAGGGG - Exonic
1164477019 19:28583605-28583627 TGCTCAGGGCTGTCACTTAGGGG - Intergenic
1166054502 19:40280313-40280335 AGCCCGTGGCTGTTACTTTTAGG - Intronic
1167442109 19:49514352-49514374 AGGCCCTGGCTATCAGTCAGCGG + Exonic
1167498389 19:49832019-49832041 CGCCCCTGACTGTCACCTACAGG - Exonic
925188847 2:1867170-1867192 AGCCCCAGGAAGTCACTGAGTGG + Intronic
927922208 2:26981726-26981748 AGCCACTGGCTGACACGTGGAGG - Intronic
929265290 2:39912314-39912336 AGCCTCTTGCTTTCACTCAGGGG - Intergenic
930277885 2:49334744-49334766 AGCAGCTGGTTGTTACTTAGGGG + Intergenic
937564062 2:123262165-123262187 TGCCCCTACCTGTCACTAAGGGG - Intergenic
941860487 2:170273854-170273876 AGCCCCTGGCTATTAATGAGAGG + Intronic
946475678 2:220004518-220004540 AGCCCTTGGCTTCCACTGAGGGG + Intergenic
1169486162 20:6034891-6034913 AGGCCCTGTCTTTCACCTAGTGG - Intronic
1170841863 20:19930312-19930334 TGTCTGTGGCTGTCACTTAGCGG - Intronic
1173951892 20:46999952-46999974 AGCAGCTGGCATTCACTTAGAGG - Intronic
1184096924 22:42321182-42321204 AGCCTCTGTCCGTCACTGAGAGG - Intronic
1184331355 22:43829823-43829845 AGCCCTGAGCTGTCACCTAGAGG + Intronic
1184452359 22:44590720-44590742 AGCCCCTGTCTCCCACTCAGTGG - Intergenic
1184779373 22:46638800-46638822 AGCCCCTGCCTGTCACAAATGGG - Intronic
1185042659 22:48513412-48513434 AGCTCCTTCCTGTCACTCAGAGG + Intronic
1185347906 22:50318575-50318597 AGCCCCTGGCGGCCACTGTGTGG + Intronic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
952827806 3:37538516-37538538 AGCCCCTGTCTGTCCCTGGGAGG - Intronic
954454618 3:50591009-50591031 AGCTCTTGGCTGTGACTAAGCGG - Intergenic
957618735 3:82567435-82567457 AGCACCTGGCTCTCCCTTGGTGG + Intergenic
961305891 3:125958993-125959015 TGGCCCTGGCGGTCACTTCGGGG + Intergenic
963969284 3:151411486-151411508 AGCCCCTGACTGGCTCTCAGAGG + Exonic
964709529 3:159656946-159656968 TGCCCCTGGATGTCACTTGAGGG - Intronic
966244872 3:177796279-177796301 AGCTCCTGGCTGCCTCTTTGAGG + Intergenic
967183588 3:186927556-186927578 AGCCTCTGCCTCTCACTTATAGG + Intergenic
967296412 3:187969533-187969555 AGTCCCTGGCTGCCACTTACAGG + Intergenic
968794211 4:2691540-2691562 AGCCCCTGGCTGTCACTTAGGGG + Intronic
969191713 4:5526609-5526631 AGTCACTGGCTGTGGCTTAGGGG - Intronic
977249248 4:94671025-94671047 AGCCCCAGGCTGTCCTTTAGAGG - Intergenic
978106112 4:104903895-104903917 AGCCACTGTCTGACACATAGAGG - Intergenic
979078660 4:116306227-116306249 CCCTCCTGGCTGTCACTTTGTGG - Intergenic
985973460 5:3395091-3395113 AGCCCCTGGTTGTCTCTTGCCGG + Intergenic
988033541 5:25796961-25796983 ATCCCATGGCTGCCCCTTAGTGG - Intergenic
990595055 5:57304161-57304183 GCCCCCTGCCTGTCACATAGTGG - Intergenic
991211937 5:64116127-64116149 AGATCCTGGCTGTCACTTTCTGG - Intergenic
992360333 5:76031460-76031482 AGCCCCTGGCAGGCACCGAGTGG - Intergenic
996672004 5:126128908-126128930 AGCTCAGGGCTGTCACCTAGAGG + Intergenic
997131922 5:131285758-131285780 AGCCCATAGCTGTGACTGAGAGG + Intronic
999710495 5:154314246-154314268 AATCCATGTCTGTCACTTAGTGG - Intronic
1001547953 5:172582229-172582251 AGCCCCTTTCTTTCACTTCGTGG - Intergenic
1003515855 6:6818327-6818349 AGCCCCTCACTGTCAGTTTGTGG + Intergenic
1006935713 6:37716033-37716055 AGCTTCTGGCTGCTACTTAGGGG + Intergenic
1009564852 6:65300771-65300793 TTCCCCTGACTGTCACTGAGTGG - Intronic
1012841845 6:104338811-104338833 AGCCTCTGGACGTCACTCAGTGG - Intergenic
1013737330 6:113242778-113242800 AGCTCCTGGCTCTCTCTTTGTGG + Intergenic
1018798784 6:167207146-167207168 GGCACCTGGCTGTCACTGACTGG + Intergenic
1019339658 7:503009-503031 AGTCCCTGGCTGTGTATTAGGGG - Intronic
1029293424 7:99519856-99519878 AGCTCCTGGCTGTCCTTCAGGGG - Exonic
1031420534 7:121546119-121546141 AGCCCAAGTCTGTCACTTATTGG - Intergenic
1032160046 7:129502876-129502898 AGCCCCAGGCTGTCCCGGAGAGG + Intronic
1034103992 7:148475071-148475093 AACCCATGGCTGTCTGTTAGTGG + Intergenic
1034386140 7:150742744-150742766 AGCTCCTGGCTGTGATTGAGAGG + Exonic
1036406516 8:8460245-8460267 AGCCCCTGGATGTCTCCAAGGGG + Intergenic
1036425384 8:8641133-8641155 ATTTCCTGGCTGTCCCTTAGAGG - Intergenic
1036654096 8:10664451-10664473 AGACCCTGTCTATCCCTTAGTGG - Intronic
1037491647 8:19402109-19402131 AGCCCAGGTATGTCACTTAGAGG + Intergenic
1047079013 8:121438516-121438538 TGCCCCAGGCAGTCACTTAGAGG - Intergenic
1047308843 8:123675850-123675872 AGCCCCTGACTGTGACCCAGTGG + Intergenic
1047715730 8:127593445-127593467 ATCTCCTGGCTGCCACTTACTGG + Intergenic
1048823580 8:138401497-138401519 AGCACGTGGCTGTCACTGACTGG - Intronic
1050093803 9:2042882-2042904 AGCCCATTTCTGTCACTGAGAGG + Intronic
1050276779 9:4008921-4008943 AGCCCTAGGCTGTGAGTTAGGGG - Intronic
1052124043 9:24754052-24754074 AGCCACTCTCTGTCATTTAGAGG - Intergenic
1057155430 9:92834081-92834103 AGGCCGTGGCTGTGACTAAGTGG + Intergenic
1058041154 9:100303448-100303470 AGCACCTGACTGTGACTTAATGG - Intronic
1058704907 9:107630095-107630117 AGTCCCTGGCCTTCACCTAGAGG + Intergenic
1186378685 X:9034215-9034237 AACCACGGGCTGTCACTTAGGGG - Intronic
1186403377 X:9280180-9280202 TTCCCCTGGCTGTGACTTTGAGG - Intergenic
1199285299 X:146048159-146048181 AGTCCCTTGCAGTCACATAGTGG - Intergenic
1200120661 X:153788755-153788777 AGGCCCTGGCAGTCAAGTAGAGG - Intronic
1201158138 Y:11150816-11150838 AGCCCATGGCTGTTACTGACCGG - Intergenic